| 8560823 | CV24033 | single nucleotide variant | STAR, IVS1, G-T, +1 | Cholesterol monooxygenase (side-chain cleaving) deficiency [RCV000009557] | pathogenic | | | | Human | | name |
| 8596855 | CV20649 | single nucleotide variant | NM_006017.3(PROM1):c.1117C>T (p.Arg373Cys) | Cone-rod dystrophy 12 [RCV000005962]|Macular dystrophy [RCV000787649]|Retinal dystrophy [RCV000504765]|Retinal macular dystrophy type 2 [RCV000005961]|Retinitis pigmentosa [RCV001723543]|Stargardt disease 4 [RCV000005960]|Star n>gardt disease 4 [RCV002496275]|Stargardt disease [RCV000787648]|not provided [RCV000479499] | pathogenic|likely pathogenic | 4 | 16013299 | 16013299 | Human | 10 | trait , alternate_id |
| 8560202 | CV22952 | single nucleotide variant | NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) | ABCA4-related disorder [RCV001101950]|ABCA4-related retinopathy [RCV005364873]|Cone-Rod Dystrophy, Recessive [RCV000349295]|MACULAR DEGENERATION, AGE-RELATED, 2, SUSCEPTIBILITY TO [RCV000008374]|Macular degeneration [RCV000294335]|Retinal dystrophy [RCV003887858]|Retinitis Pigmentosa, Recessive [RCV 000392936]|Severe early-childhood-onset retinal dystrophy [RCV000008375]|Stargardt Disease, Recessive [RCV000399411]|Stargardt disease 3 [RCV004558243]|Stargardt disease [RCV001002837]|not provided [RCV000085512]|not specified [RCV000152706] | pathogenic|likely pathogenic|risk factor|established risk allele|benign|likely benign|uncertain significance|not provided | 1 | 94047009 | 94047009 | Human | 10 | trait , alternate_id |
| 598123909 | CV3885106 | single nucleotide variant | NM_000349.3(STAR):c.*5C>T | not specified [RCV005238718] | uncertain significance | 8 | 38144268 | 38144268 | Human | | name |
| 11633986 | CV305176 | single nucleotide variant | NM_000349.3(STAR):c.*88G>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000385205]|not provided [RCV004696072] | uncertain significance | 8 | 38144185 | 38144185 | Human | 2 | name |
| 11633431 | CV305191 | single nucleotide variant | NM_000349.3(STAR):c.-70G>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000336663] | uncertain significance | 8 | 38150888 | 38150888 | Human | 2 | name |
| 11633280 | CV314156 | single nucleotide variant | NM_000349.3(STAR):c.*93C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000326040] | uncertain significance | 8 | 38144180 | 38144180 | Human | 2 | name |
| 28871430 | CV899455 | single nucleotide variant | NM_000349.3(STAR):c.-16C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163951] | uncertain significance | 8 | 38150834 | 38150834 | Human | 2 | name |
| 127238469 | CV1061339 | single nucleotide variant | NM_000349.3(STAR):c.64+1G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV005040253]|not provided [RCV001383037] | pathogenic|likely pathogenic | 8 | 38150754 | 38150754 | Human | 2 | name |
| 127272313 | CV1075365 | single nucleotide variant | NM_000349.3(STAR):c.64+9T>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV002488221]|not provided [RCV001405683] | likely benign | 8 | 38150746 | 38150746 | Human | 2 | name |
| 152110443 | CV1586244 | single nucleotide variant | NM_000349.3(STAR):c.64+9T>G | not provided [RCV002134412] | likely benign | 8 | 38150746 | 38150746 | Human | | name |
| 152111915 | CV1635031 | single nucleotide variant | NM_000349.3(STAR):c.64+7G>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV002486800]|not provided [RCV002096968] | likely benign | 8 | 38150748 | 38150748 | Human | 2 | name |
| 152057298 | CV1647411 | single nucleotide variant | NM_000349.3(STAR):c.64+7G>A | not provided [RCV002208248] | likely benign | 8 | 38150748 | 38150748 | Human | | name |
| 11633632 | CV305147 | single nucleotide variant | NM_000349.3(STAR):c.*913C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000353839] | uncertain significance | 8 | 38143360 | 38143360 | Human | 2 | name |
| 11651571 | CV305163 | single nucleotide variant | NM_000349.3(STAR):c.*817C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000299920] | uncertain significance | 8 | 38143456 | 38143456 | Human | 2 | name |
| 11655280 | CV305171 | single nucleotide variant | NM_000349.3(STAR):c.*348C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000324387] | uncertain significance | 8 | 38143925 | 38143925 | Human | 2 | name |
| 11633925 | CV305173 | single nucleotide variant | NM_000349.3(STAR):c.*230A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000379432] | uncertain significance | 8 | 38144043 | 38144043 | Human | 2 | name |
| 11632621 | CV305174 | single nucleotide variant | NM_000349.3(STAR):c.*116T>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000270862]|not provided [RCV004696071] | uncertain significance | 8 | 38144157 | 38144157 | Human | 2 | name |
| 11659566 | CV308906 | single nucleotide variant | NM_000349.3(STAR):c.*796A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000359307] | uncertain significance | 8 | 38143477 | 38143477 | Human | 2 | name |
| 11645283 | CV308937 | single nucleotide variant | NM_000349.3(STAR):c.*556A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000264518] | uncertain significance | 8 | 38143717 | 38143717 | Human | 2 | name |
| 11663517 | CV308948 | single nucleotide variant | NM_000349.2(STAR):c.-249C>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000396536] | uncertain significance | 8 | 38151067 | 38151067 | Human | 2 | name |
| 11633104 | CV314150 | single nucleotide variant | NM_000349.3(STAR):c.*981A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000311188] | uncertain significance | 8 | 38143292 | 38143292 | Human | 2 | name |
| 11634102 | CV314153 | single nucleotide variant | NM_000349.3(STAR):c.*987A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000396171] | benign|likely benign | 8 | 38143286 | 38143286 | Human | 2 | name |
| 11632533 | CV314155 | single nucleotide variant | NM_000349.3(STAR):c.*818G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000263470] | uncertain significance | 8 | 38143455 | 38143455 | Human | 2 | name |
| 11663471 | CV314160 | deletion | NM_000349.3(STAR):c.*967del | Congenital adrenal hyperplasia [RCV000396156] | benign | 8 | 38143306 | 38143306 | Human | 2 | name |
| 11651463 | CV314161 | deletion | NM_000349.3(STAR):c.*948del | Congenital adrenal hyperplasia [RCV000298963] | uncertain significance | 8 | 38143325 | 38143325 | Human | 2 | name |
| 11632982 | CV314171 | single nucleotide variant | NM_000349.2(STAR):c.-255G>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000301699] | uncertain significance | 8 | 38151073 | 38151073 | Human | 2 | name |
| 596920613 | CV3533981 | single nucleotide variant | NM_000349.3(STAR):c.64+5G>A | not specified [RCV004783199] | uncertain significance | 8 | 38150750 | 38150750 | Human | | name |
| 13788593 | CV544809 | single nucleotide variant | NM_000349.3(STAR):c.64+2T>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000674046] | likely pathogenic | 8 | 38150753 | 38150753 | Human | 2 | name |
| 13789336 | CV544814 | single nucleotide variant | NM_000349.3(STAR):c.64+1G>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000665946]|STAR-related disorder [RCV003411572]|not provided [RCV000804772] | pathogenic | 8 | 38150754 | 38150754 | Human | 2 | name |
| 28870497 | CV899439 | single nucleotide variant | NM_000349.3(STAR):c.*930C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163549] | uncertain significance | 8 | 38143343 | 38143343 | Human | 2 | name |
| 28870500 | CV899440 | single nucleotide variant | NM_000349.3(STAR):c.*897C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163550] | uncertain significance | 8 | 38143376 | 38143376 | Human | 2 | name |
| 28871174 | CV899441 | single nucleotide variant | NM_000349.3(STAR):c.*880C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163845] | uncertain significance | 8 | 38143393 | 38143393 | Human | 2 | name |
| 28871177 | CV899442 | single nucleotide variant | NM_000349.3(STAR):c.*768G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163846] | uncertain significance | 8 | 38143505 | 38143505 | Human | 2 | name |
| 28871178 | CV899443 | single nucleotide variant | NM_000349.3(STAR):c.*699C>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163847] | uncertain significance | 8 | 38143574 | 38143574 | Human | 2 | name |
| 28871180 | CV899444 | single nucleotide variant | NM_000349.3(STAR):c.*698C>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163848] | uncertain significance | 8 | 38143575 | 38143575 | Human | 2 | name |
| 28871182 | CV899445 | single nucleotide variant | NM_000349.3(STAR):c.*688C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163849] | uncertain significance | 8 | 38143585 | 38143585 | Human | 2 | name |
| 28906362 | CV899446 | single nucleotide variant | NM_000349.3(STAR):c.*550A>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001158928] | uncertain significance | 8 | 38143723 | 38143723 | Human | 2 | name |
| 28906365 | CV899447 | single nucleotide variant | NM_000349.3(STAR):c.*456C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001158929]|not provided [RCV004706044] | likely benign | 8 | 38143817 | 38143817 | Human | 2 | name |
| 28906367 | CV899448 | single nucleotide variant | NM_000349.3(STAR):c.*395G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001158930] | uncertain significance | 8 | 38143878 | 38143878 | Human | 2 | name |
| 28906369 | CV899449 | single nucleotide variant | NM_000349.3(STAR):c.*187T>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001158931] | uncertain significance | 8 | 38144086 | 38144086 | Human | 2 | name |
| 28906552 | CV899456 | single nucleotide variant | NM_000349.2(STAR):c.-152G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001159019] | uncertain significance | 8 | 38150970 | 38150970 | Human | 2 | name |
| 127247012 | CV1055731 | single nucleotide variant | NM_000349.3(STAR):c.307-1G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001826129]|not provided [RCV001377697] | likely pathogenic | 8 | 38146448 | 38146448 | Human | 2 | name |
| 127278303 | CV1075356 | single nucleotide variant | NM_000349.3(STAR):c.650+8G>A | not provided [RCV001408405] | likely benign | 8 | 38145955 | 38145955 | Human | | name |
| 127250299 | CV1075357 | single nucleotide variant | NM_000349.3(STAR):c.650+7C>A | not provided [RCV001399849] | likely benign | 8 | 38145956 | 38145956 | Human | | name |
| 127268677 | CV1097017 | deletion | NM_000349.3(STAR):c.744+8del | not provided [RCV001440863] | likely benign | 8 | 38145214 | 38145214 | Human | | name |
| 127256084 | CV1097020 | single nucleotide variant | NM_000349.3(STAR):c.650+8G>C | not provided [RCV001426740] | likely benign | 8 | 38145955 | 38145955 | Human | | name |
| 127301711 | CV1118577 | single nucleotide variant | NM_000349.3(STAR):c.744+7G>A | not provided [RCV001461463] | likely benign | 8 | 38145215 | 38145215 | Human | | name |
| 127320452 | CV1118581 | single nucleotide variant | NM_000349.3(STAR):c.651-7T>C | not provided [RCV001466919] | likely benign | 8 | 38145322 | 38145322 | Human | | name |
| 127298119 | CV1118583 | single nucleotide variant | NM_000349.3(STAR):c.466-6T>C | not provided [RCV001477831] | likely benign | 8 | 38146153 | 38146153 | Human | | name |
| 127323213 | CV1139468 | single nucleotide variant | NM_000349.3(STAR):c.650+7C>T | not provided [RCV001485178] | likely benign | 8 | 38145956 | 38145956 | Human | | name |
| 127295115 | CV1139473 | single nucleotide variant | NM_000349.3(STAR):c.306+9C>T | STAR-related disorder [RCV003980438]|not provided [RCV001497181] | likely benign | 8 | 38148191 | 38148191 | Human | 1 | name |
| 150497641 | CV1219439 | single nucleotide variant | NM_000349.3(STAR):c.65-64G>C | not provided [RCV001620108] | benign | 8 | 38148818 | 38148818 | Human | | name |
| 150497882 | CV1281613 | deletion | NM_000349.3(STAR):c.65-59del | not provided [RCV001717922] | benign | 8 | 38148813 | 38148813 | Human | | name |
| 150545079 | CV1315410 | single nucleotide variant | NM_000349.3(STAR):c.650+1G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001783826] | likely pathogenic | 8 | 38145962 | 38145962 | Human | 2 | name |
| 151884052 | CV1452554 | single nucleotide variant | NM_000349.3(STAR):c.650+2T>A | not provided [RCV002037475] | likely pathogenic | 8 | 38145961 | 38145961 | Human | | name |
| 151844808 | CV1457910 | single nucleotide variant | NM_000349.3(STAR):c.465+2T>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV005042543]|not provided [RCV001936563] | pathogenic|likely pathogenic | 8 | 38146287 | 38146287 | Human | 2 | name |
| 152142196 | CV1526634 | single nucleotide variant | NM_000349.3(STAR):c.179-5T>C | not provided [RCV002084308] | likely benign | 8 | 38148332 | 38148332 | Human | | name |
| 152098501 | CV1530776 | single nucleotide variant | NM_000349.3(STAR):c.65-10C>A | not provided [RCV002132951] | likely benign | 8 | 38148764 | 38148764 | Human | | name |
| 152115865 | CV1553949 | single nucleotide variant | NM_000349.3(STAR):c.466-4G>A | not provided [RCV002117178] | likely benign | 8 | 38146151 | 38146151 | Human | | name |
| 152138225 | CV1563498 | single nucleotide variant | NM_000349.3(STAR):c.465+8A>G | not provided [RCV002200236] | likely benign | 8 | 38146281 | 38146281 | Human | | name |
| 152093145 | CV1571474 | single nucleotide variant | NM_000349.3(STAR):c.307-9C>T | not provided [RCV002150850] | likely benign | 8 | 38146456 | 38146456 | Human | | name |
| 152042605 | CV1619666 | single nucleotide variant | NM_000349.3(STAR):c.745-9C>T | not provided [RCV002188459] | likely benign | 8 | 38144395 | 38144395 | Human | | name |
| 155937683 | CV1868127 | single nucleotide variant | NM_000349.3(STAR):c.306+1G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV002510254]|STAR-related disorder [RCV004731276]|not provided [RCV002571585] | likely pathogenic | 8 | 38148199 | 38148199 | Human | 2 | name |
| 156414060 | CV1915650 | single nucleotide variant | NM_000349.3(STAR):c.650+8G>T | not provided [RCV002588383] | likely benign | 8 | 38145955 | 38145955 | Human | | name |
| 156308834 | CV1928173 | single nucleotide variant | NM_000349.3(STAR):c.64+19A>C | not provided [RCV002648036] | likely benign | 8 | 38150736 | 38150736 | Human | | name |
| 156306685 | CV1999869 | single nucleotide variant | NM_000349.3(STAR):c.179-4C>T | not provided [RCV002671415] | likely benign | 8 | 38148331 | 38148331 | Human | | name |
| 156193983 | CV2066505 | single nucleotide variant | NM_000349.3(STAR):c.179-7T>C | not provided [RCV002828704] | likely benign | 8 | 38148334 | 38148334 | Human | | name |
| 156249813 | CV2147074 | single nucleotide variant | NM_000349.3(STAR):c.650+9G>A | not provided [RCV003008404] | likely benign | 8 | 38145954 | 38145954 | Human | | name |
| 156308208 | CV2167777 | single nucleotide variant | NM_000349.3(STAR):c.651-5G>A | not provided [RCV003045886] | likely benign | 8 | 38145320 | 38145320 | Human | | name |
| 156073036 | CV2172741 | single nucleotide variant | NM_000349.3(STAR):c.307-9C>A | not provided [RCV003053776] | likely benign | 8 | 38146456 | 38146456 | Human | | name |
| 156238000 | CV2183828 | deletion | NM_000349.3(STAR):c.466-9del | not provided [RCV003059554] | likely benign | 8 | 38146156 | 38146156 | Human | | name |
| 8560822 | CV24029 | duplication | NM_000349.3(STAR):c.178+2dup | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000009553] | pathogenic | 8 | 38148638 | 38148639 | Human | 2 | name |
| 405055792 | CV2890331 | single nucleotide variant | NM_000349.3(STAR):c.64+19A>G | not provided [RCV003580053] | likely benign | 8 | 38150736 | 38150736 | Human | | name |
| 402498277 | CV2906071 | single nucleotide variant | NM_000349.3(STAR):c.65-10C>T | not provided [RCV003573650] | likely benign | 8 | 38148764 | 38148764 | Human | | name |
| 405070005 | CV2933298 | single nucleotide variant | NM_000349.3(STAR):c.307-1G>C | not provided [RCV003581057] | likely pathogenic | 8 | 38146448 | 38146448 | Human | | name |
| 405239155 | CV2996850 | single nucleotide variant | NM_000349.3(STAR):c.307-7C>T | not provided [RCV003718725] | likely benign | 8 | 38146454 | 38146454 | Human | | name |
| 405000044 | CV3005307 | single nucleotide variant | NM_000349.3(STAR):c.306+1G>T | not provided [RCV003693085] | likely pathogenic | 8 | 38148199 | 38148199 | Human | | name |
| 405163219 | CV3017853 | single nucleotide variant | NM_000349.3(STAR):c.745-6C>T | not provided [RCV003704047] | likely benign | 8 | 38144392 | 38144392 | Human | | name |
| 405162811 | CV3021661 | single nucleotide variant | NM_000349.3(STAR):c.307-8T>C | not provided [RCV003704023] | likely benign | 8 | 38146455 | 38146455 | Human | | name |
| 405141153 | CV3026290 | single nucleotide variant | NM_000349.3(STAR):c.65-11C>G | not provided [RCV003702517] | likely benign | 8 | 38148765 | 38148765 | Human | | name |
| 11633996 | CV305179 | single nucleotide variant | NM_000349.3(STAR):c.466-5G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000386225]|STAR-related disorder [RCV004755903]|not provided [RCV000898475]|not specified [RCV000436485] | benign|likely benign|uncertain significance | 8 | 38146152 | 38146152 | Human | 2 | name |
| 405194329 | CV3066341 | single nucleotide variant | NM_000349.3(STAR):c.64+13G>A | not provided [RCV003729971] | likely benign | 8 | 38150742 | 38150742 | Human | | name |
| 11633411 | CV308947 | single nucleotide variant | NM_000349.3(STAR):c.178+9T>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000335570]|STAR-related disorder [RCV003902416]|not provided [RCV001438234] | likely benign|uncertain significance | 8 | 38148632 | 38148632 | Human | 2 | name |
| 11634289 | CV314123 | single nucleotide variant | NM_000349.3(STAR):c.*1524A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000406235] | benign | 8 | 38142749 | 38142749 | Human | 2 | name |
| 11650112 | CV314138 | deletion | NM_000349.3(STAR):c.*1384del | Congenital adrenal hyperplasia [RCV000291009] | uncertain significance | 8 | 38142889 | 38142889 | Human | 2 | name |
| 11633538 | CV314140 | single nucleotide variant | NM_000349.3(STAR):c.*1122T>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000346141] | uncertain significance | 8 | 38143151 | 38143151 | Human | 2 | name |
| 11633519 | CV314147 | single nucleotide variant | NM_000349.3(STAR):c.*1543C>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000344827] | uncertain significance | 8 | 38142730 | 38142730 | Human | 2 | name |
| 405192564 | CV3157203 | deletion | NM_000349.3(STAR):c.306+1del | not provided [RCV003859891] | pathogenic | 8 | 38148199 | 38148199 | Human | | name |
| 405136480 | CV3160244 | single nucleotide variant | NM_000349.3(STAR):c.65-14A>G | not provided [RCV003855059] | likely benign | 8 | 38148768 | 38148768 | Human | | name |
| 405243651 | CV3164793 | single nucleotide variant | NM_000349.3(STAR):c.64+14G>A | not provided [RCV003867874] | likely benign | 8 | 38150741 | 38150741 | Human | | name |
| 402519703 | CV3175301 | single nucleotide variant | NM_000349.3(STAR):c.307-5G>A | not provided [RCV003879584] | likely benign | 8 | 38146452 | 38146452 | Human | | name |
| 597651981 | CV3722717 | single nucleotide variant | NM_000349.3(STAR):c.744+1G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV005041171] | likely pathogenic | 8 | 38145221 | 38145221 | Human | 2 | name |
| 597735824 | CV3722721 | single nucleotide variant | NM_000349.3(STAR):c.651-2A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV005051618] | likely pathogenic | 8 | 38145317 | 38145317 | Human | 2 | name |
| 13469727 | CV441231 | single nucleotide variant | NM_000349.3(STAR):c.745-1G>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001834677]|not provided [RCV000516306] | likely pathogenic | 8 | 38144387 | 38144387 | Human | 2 | name |
| 13784776 | CV544418 | single nucleotide variant | NM_000349.3(STAR):c.179-2A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000671263] | likely pathogenic | 8 | 38148329 | 38148329 | Human | 2 | name |
| 13788236 | CV544420 | single nucleotide variant | NM_000349.3(STAR):c.178+1G>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000673860]|not provided [RCV003558526] | likely pathogenic | 8 | 38148640 | 38148640 | Human | 2 | name |
| 13789306 | CV544721 | single nucleotide variant | NM_000349.3(STAR):c.651-1G>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000674443] | likely pathogenic | 8 | 38145316 | 38145316 | Human | 2 | name |
| 28908564 | CV899435 | single nucleotide variant | NM_000349.3(STAR):c.*1557A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001160164] | uncertain significance | 8 | 38142716 | 38142716 | Human | 2 | name |
| 28908566 | CV899436 | single nucleotide variant | NM_000349.3(STAR):c.*1513C>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001160165] | uncertain significance | 8 | 38142760 | 38142760 | Human | 2 | name |
| 28870489 | CV899437 | single nucleotide variant | NM_000349.3(STAR):c.*1473G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163547] | uncertain significance | 8 | 38142800 | 38142800 | Human | 2 | name |
| 28870493 | CV899438 | single nucleotide variant | NM_000349.3(STAR):c.*1472C>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163548] | uncertain significance | 8 | 38142801 | 38142801 | Human | 2 | name |
| 28871419 | CV900484 | single nucleotide variant | NM_000349.3(STAR):c.178+7G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163946]|not provided [RCV001407453] | likely benign|uncertain significance | 8 | 38148634 | 38148634 | Human | 2 | name |
| 150332964 | CV1171850 | single nucleotide variant | NM_000349.3(STAR):c.650+95C>G | not provided [RCV001539250] | likely benign | 8 | 38145868 | 38145868 | Human | | name |
| 150428447 | CV1187344 | single nucleotide variant | NM_000349.3(STAR):c.306+54G>A | not provided [RCV001562280] | likely benign | 8 | 38148146 | 38148146 | Human | | name |
| 150498167 | CV1281822 | single nucleotide variant | NM_000349.3(STAR):c.466-68C>A | not provided [RCV001717970] | benign | 8 | 38146215 | 38146215 | Human | | name |
| 152072241 | CV1643699 | single nucleotide variant | NM_000349.3(STAR):c.466-11T>C | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV005042726]|not provided [RCV002111612] | likely benign|uncertain significance | 8 | 38146158 | 38146158 | Human | 2 | name |
| 156098249 | CV2007525 | single nucleotide variant | NM_000349.3(STAR):c.651-10C>T | not provided [RCV002695204] | likely benign | 8 | 38145325 | 38145325 | Human | | name |
| 405045913 | CV2859742 | single nucleotide variant | NM_000349.3(STAR):c.650+10G>C | not provided [RCV003579324] | likely benign | 8 | 38145953 | 38145953 | Human | | name |
| 405199721 | CV2876831 | single nucleotide variant | NM_000349.3(STAR):c.744+20G>C | not provided [RCV003551171] | likely benign | 8 | 38145202 | 38145202 | Human | | name |
| 405053098 | CV2893540 | single nucleotide variant | NM_000349.3(STAR):c.466-15C>T | STAR-related disorder [RCV003954276]|not provided [RCV003579873]|not specified [RCV005240815] | benign|likely benign | 8 | 38146162 | 38146162 | Human | 1 | name |
| 405231573 | CV2895673 | single nucleotide variant | NM_000349.3(STAR):c.178+15T>C | not provided [RCV003555548] | likely benign | 8 | 38148626 | 38148626 | Human | | name |
| 405233046 | CV2896495 | single nucleotide variant | NM_000349.3(STAR):c.179-12C>T | not provided [RCV003555764] | likely benign | 8 | 38148339 | 38148339 | Human | | name |
| 402508095 | CV2927907 | single nucleotide variant | NM_000349.3(STAR):c.466-20G>C | not provided [RCV003574496] | likely benign | 8 | 38146167 | 38146167 | Human | | name |
| 405128568 | CV2954924 | single nucleotide variant | NM_000349.3(STAR):c.179-14G>C | not provided [RCV003668168] | likely benign | 8 | 38148341 | 38148341 | Human | | name |
| 405144793 | CV2958980 | single nucleotide variant | NM_000349.3(STAR):c.465+15G>A | not provided [RCV003673450] | likely benign | 8 | 38146274 | 38146274 | Human | | name |
| 402495132 | CV2978428 | single nucleotide variant | NM_000349.3(STAR):c.651-19T>G | not provided [RCV003714091] | likely benign | 8 | 38145334 | 38145334 | Human | | name |
| 405242216 | CV3014545 | single nucleotide variant | NM_000349.3(STAR):c.744+16G>C | not provided [RCV003719337] | likely benign | 8 | 38145206 | 38145206 | Human | | name |
| 405064774 | CV3020783 | single nucleotide variant | NM_000349.3(STAR):c.306+13G>A | not provided [RCV003697947] | likely benign | 8 | 38148187 | 38148187 | Human | | name |
| 405235860 | CV3040723 | single nucleotide variant | NM_000349.3(STAR):c.745-12C>T | not provided [RCV003712160] | likely benign | 8 | 38144398 | 38144398 | Human | | name |
| 405251544 | CV3049846 | single nucleotide variant | NM_000349.3(STAR):c.178+20G>T | not provided [RCV003721849] | likely benign | 8 | 38148621 | 38148621 | Human | | name |
| 405078793 | CV3050225 | single nucleotide variant | NM_000349.3(STAR):c.306+13G>T | not provided [RCV003716971] | likely benign | 8 | 38148187 | 38148187 | Human | | name |
| 405224799 | CV3058234 | single nucleotide variant | NM_000349.3(STAR):c.179-15C>T | not provided [RCV003733859] | likely benign | 8 | 38148342 | 38148342 | Human | | name |
| 405043564 | CV3064140 | deletion | NM_000349.3(STAR):c.465+14del | not provided [RCV003739994] | likely benign | 8 | 38146275 | 38146275 | Human | | name |
| 405201684 | CV3066900 | single nucleotide variant | NM_000349.3(STAR):c.744+18G>A | not provided [RCV003730791] | likely benign | 8 | 38145204 | 38145204 | Human | | name |
| 405044192 | CV3074165 | single nucleotide variant | NM_000349.3(STAR):c.465+17T>G | not provided [RCV003740065] | likely benign | 8 | 38146272 | 38146272 | Human | | name |
| 405044926 | CV3074254 | single nucleotide variant | NM_000349.3(STAR):c.745-19C>G | not provided [RCV003740101] | likely benign | 8 | 38144405 | 38144405 | Human | | name |
| 405235748 | CV3079348 | single nucleotide variant | NM_000349.3(STAR):c.306+13G>C | not provided [RCV003735802] | likely benign | 8 | 38148187 | 38148187 | Human | | name |
| 405049593 | CV3079955 | single nucleotide variant | NM_000349.3(STAR):c.745-17C>A | not provided [RCV003740431] | likely benign | 8 | 38144403 | 38144403 | Human | | name |
| 405244864 | CV3080387 | single nucleotide variant | NM_000349.3(STAR):c.745-16C>T | not provided [RCV003738001] | likely benign | 8 | 38144402 | 38144402 | Human | | name |
| 405113473 | CV3118694 | single nucleotide variant | NM_000349.3(STAR):c.744+19G>A | not provided [RCV003813922] | likely benign | 8 | 38145203 | 38145203 | Human | | name |
| 405194777 | CV3128519 | single nucleotide variant | NM_000349.3(STAR):c.650+18C>T | not provided [RCV003821256] | likely benign | 8 | 38145945 | 38145945 | Human | | name |
| 405051594 | CV3150912 | single nucleotide variant | NM_000349.3(STAR):c.465+10G>A | not provided [RCV003849516] | likely benign | 8 | 38146279 | 38146279 | Human | | name |
| 405218750 | CV3161047 | single nucleotide variant | NM_000349.3(STAR):c.178+17C>T | not provided [RCV003863109] | likely benign | 8 | 38148624 | 38148624 | Human | | name |
| 405238210 | CV3166948 | single nucleotide variant | NM_000349.3(STAR):c.650+20C>A | not provided [RCV003854203] | likely benign | 8 | 38145943 | 38145943 | Human | | name |
| 405090245 | CV3167848 | single nucleotide variant | NM_000349.3(STAR):c.650+16G>A | not provided [RCV003852238] | likely benign | 8 | 38145947 | 38145947 | Human | | name |
| 405255039 | CV3175608 | single nucleotide variant | NM_000349.3(STAR):c.744+15A>G | not provided [RCV003871875] | likely benign | 8 | 38145207 | 38145207 | Human | | name |
| 597835390 | CV3828206 | single nucleotide variant | NM_000349.3(STAR):c.744+12G>A | not provided [RCV005171098] | likely benign | 8 | 38145210 | 38145210 | Human | | name |
| 13504329 | CV441233 | single nucleotide variant | NM_000349.3(STAR):c.465+20A>G | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001809464]|not provided [RCV001653881]|not specified [RCV000518572] | benign | 8 | 38146269 | 38146269 | Human | 2 | name |
| 13788403 | CV544739 | single nucleotide variant | NM_000349.3(STAR):c.466-11T>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000673944] | conflicting interpretations of pathogenicity|uncertain significance | 8 | 38146158 | 38146158 | Human | 2 | name |
| 15170328 | CV744360 | single nucleotide variant | NM_000349.3(STAR):c.306+10G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163636]|not provided [RCV000905242] | likely benign|uncertain significance | 8 | 38148190 | 38148190 | Human | 2 | name |
| 28908780 | CV900482 | single nucleotide variant | NM_000349.3(STAR):c.650+13G>T | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001160265]|not provided [RCV003558729] | benign|uncertain significance | 8 | 38145950 | 38145950 | Human | 2 | name |
| 28870724 | CV900483 | single nucleotide variant | NM_000349.3(STAR):c.179-14G>A | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV001163637]|not provided [RCV001354114] | benign|uncertain significance | 8 | 38148341 | 38148341 | Human | 2 | name |
| 150427518 | CV1187343 | single nucleotide variant | NM_000349.3(STAR):c.307-157G>A | not provided [RCV001561029] | likely benign | 8 | 38146604 | 38146604 | Human | | name |
| 150431279 | CV1206296 | single nucleotide variant | NM_000349.3(STAR):c.178+113C>T | not provided [RCV001580945] | likely benign | 8 | 38148528 | 38148528 | Human | | name |
| 150463670 | CV1252555 | deletion | NM_000349.3(STAR):c.744+212del | not provided [RCV001669878] | benign | 8 | 38145010 | 38145010 | Human | | name |
| 405278303 | CV3216566 | single nucleotide variant | NM_020759.3(STARD9):c.560-6C>T | STARD9-related disorder [RCV003954476] | likely benign | 15 | 42651010 | 42651010 | Human | | name |
| 150506655 | CV1210976 | single nucleotide variant | NM_020759.3(STARD9):c.1254+4T>G | STARD9-related disorder [RCV003983993]|not provided [RCV001596094] | benign | 15 | 42665334 | 42665334 | Human | | name |
| 151662507 | CV1333163 | single nucleotide variant | NM_020759.3(STARD9):c.1771-2A>T | not provided [RCV001837396] | uncertain significance | 15 | 42675870 | 42675870 | Human | | name |
| 153000706 | CV1683820 | deletion | NM_000349.3(STAR):c.65-12_68del | not provided [RCV002254439] | pathogenic | 8 | 38148751 | 38148766 | Human | | name |
| 11635493 | CV308905 | duplication | NM_000349.3(STAR):c.*965_*967dup | Congenital adrenal hyperplasia [RCV000351952] | uncertain significance | 8 | 38143305 | 38143306 | Human | 2 | name |
| 13790141 | CV544709 | deletion | NM_000349.3(STAR):c.745-1_757del | Congenital lipoid adrenal hyperplasia due to STAR deficency [RCV000674882] | likely pathogenic | 8 | 38144374 | 38144387 | Human | 2 | name |
| 15157359 | CV779785 | single nucleotide variant | NM_020759.3(STARD9):c.13372+9C>A | not provided [RCV000969293] | benign | 15 | 42716773 | 42716773 | Human | | name |
| 21074613 | CV797130 | single nucleotide variant | NM_020759.3(STARD9):c.13147-3C>A | not provided [RCV000995308] | uncertain significance | 15 | 42695740 | 42695740 | Human | | name |
| 15176305 | CV778114 | single nucleotide variant | NM_020759.3(STARD9):c.13372+10G>A | not provided [RCV000950794] | benign | 15 | 42716774 | 42716774 | Human | | name |
| 8587588 | CV122219 | single nucleotide variant | NM_014725.4(STARD8):c.-79-10343C>T | Lung cancer [RCV000102739] | uncertain significance | X | 68702571 | 68702571 | Human | | name |
| 151745077 | CV1501652 | deletion | NM_000349.3(STAR):c.466-3_466-1del | not provided [RCV002042640] | likely pathogenic | 8 | 38146148 | 38146150 | Human | | name |
| 8582779 | CV117335 | single nucleotide variant | NM_178006.3(STARD13):c.170-35549G>A | Lung cancer [RCV000097856] | uncertain significance | 13 | 33203171 | 33203171 | Human | | name |
| 8582780 | CV117336 | single nucleotide variant | NM_178006.3(STARD13):c.169+48719C>T | Lung cancer [RCV000097857] | uncertain significance | 13 | 33236751 | 33236751 | Human | | name |
| 8582782 | CV117338 | single nucleotide variant | NM_001243476.2(STARD13):c.-421+706C>G | Lung cancer [RCV000097859] | uncertain significance | 13 | 33675972 | 33675972 | Human | | name |
| 151891744 | CV1394493 | indel | NM_000349.3(STAR):c.745-1_745delinsAA | not provided [RCV002039226] | likely pathogenic | 8 | 38144386 | 38144387 | Human | | name |
| 8580238 | CV114668 | single nucleotide variant | NR_040093.1(STARD4-AS1):n.284-36251A>T | Lung cancer [RCV000095191] | uncertain significance | 5 | 111633168 | 111633168 | Human | | name |
| 150481899 | CV1279856 | deletion | NM_000349.3(STAR):c.744+211_744+212del | not provided [RCV001714929] | benign | 8 | 38145010 | 38145011 | Human | | name |
| 8582781 | CV117337 | single nucleotide variant | NM_001243476.2(STARD13):c.-105-61478C>A | Lung cancer [RCV000097858] | uncertain significance | 13 | 33585850 | 33585850 | Human | | name |
| 15099279 | CV622967 | microsatellite | NM_020151.3(STARD7):c.291-1572_291-1518ATTTT[376]ATTTC[274] | Epilepsy, familial adult myoclonic, 2 [RCV000856832] | pathogenic | 2 | 96197066 | 96200315 | Human | | name |
| 8645565 | CV104973 | single nucleotide variant | NM_000350.3(ABCA4):c.1804C>T (p.Arg602Trp) | ABCA4-related disorder [RCV001849310]|Cone-rod dystrophy 3 [RCV000850520]|Cone-rod dystrophy 3 [RCV001353025]|Cone-rod dystrophy 3 [RCV002498452]|Retinal dystrophy [RCV000504951]|Retinitis pigmentosa 19 [RCV002250560]|Retinitis pigmentosa [RCV001723664]|Severe early-childhood-onset retinal dystrophy [RCV000408597]|Stargardt disease 3 [RCV004558305]|Stargardt disease [RCV003324506]|not provided [RCV000085428] | pathogenic|likely pathogenic|not provided | 1 | 94062710 | 94062710 | Human | 11 | trait , alternate_id |
| 8645869 | CV105279 | single nucleotide variant | NM_000350.3(ABCA4):c.5603A>T (p.Asn1868Ile) | ABCA4-related disorder [RCV001097975]|ABCA4-related retinopathy [RCV005357537]|Age related macular degeneration 2 [RCV001197336]|Cone-Rod Dystrophy, Recessive [RCV000293913]|Cone-rod dystrophy 3 [RCV001262623]|Macular degeneration [RCV000391356]|Retinal dystrophy [RCV004815126]|Retinitis Pigmentosa, Recessive [RCV000348932]|Retinitis pigmentosa [RCV001723669]|Severe early-childhood-onset retinal dystrophy [RCV000721173]|Stargardt Disease, Recessive [RCV000309306]|Stargardt disease [RCV001002812]|not provided [RCV000085744]|not specified [RCV000178424] | likely pathogenic|established risk allele|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|other|not provided | 1 | 94010911 | 94010911 | Human | 12 | trait , alternate_id |
| 8645882 | CV105292 | single nucleotide variant | NM_000350.3(ABCA4):c.5714+5G>A | ABCA4-related disorder [RCV000778997]|Age related macular degeneration 2 [RCV001196124]|Cone-rod dystrophy 3 [RCV000332324]|Cone-rod dystrophy 3 [RCV002498458]|Cone-rod dystrophy 3 [RCV005357538]|Optic atrophy [RCV004815127]|Retinal dystrophy [RCV001074898]|Retinitis pigmentosa 19 [RCV000210303]|Sev ere early-childhood-onset retinal dystrophy [RCV000210321]|Stargardt disease [RCV000515694]|Stargardt disease [RCV000845081]|not provided [RCV000085757] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94010795 | 94010795 | Human | 13 | trait , alternate_id |
| 10045206 | CV188992 | single nucleotide variant | NM_006017.3(PROM1):c.604C>G (p.Arg202Gly) | Autosomal recessive retinitis pigmentosa [RCV001257791]|Retinal dystrophy [RCV004815269]|Retinal macular dystrophy type 2 [RCV000348573]|Retinitis pigmentosa 41 [RCV000987426]|Retinitis pigmentosa [RCV000390528]|Stargardt disease 4 [RCV000356757]|Star nt-weight:700;'>Stargardt disease 4 [RCV000765766]|not provided [RCV000171375] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 4 | 16025218 | 16025218 | Human | 7 | trait |
| 8560170 | CV22918 | single nucleotide variant | NM_000350.3(ABCA4):c.2588G>C (p.Gly863Ala) | ABCA4-related disorder [RCV004532312]|Abnormal macular morphology [RCV000415097]|Age related macular degeneration 2 [RCV001198385]|Cone-rod dystrophy 3 [RCV000008329]|Cone-rod dystrophy 3 [RCV001535670]|Cone-rod dystrophy 3 [RCV005025029]|Cone-rod dystrophy 3 [RCV005357096]|Cone-rod dystrophy [RCV00 0787768]|Inborn genetic diseases [RCV000623365]|Retinal dystrophy [RCV000505063]|Retinitis pigmentosa 19 [RCV003224856]|Retinitis pigmentosa [RCV000787487]|Severe early-childhood-onset retinal dystrophy [RCV000008328]|Stargardt disease 3 [RCV004558239]|Stargardt disease [RCV000787486]|not provided [RCV000085494] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|low penetrance|no classifications from unflagged records|not provided | 1 | 94051698 | 94051698 | Human | 19 | trait , alternate_id |
| 8560175 | CV22923 | single nucleotide variant | NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) | ABCA4-related disorder [RCV000778139]|Cone dystrophy [RCV000504806]|Cone-Rod Dystrophy, Recessive [RCV000285333]|Cone-rod dystrophy 3 [RCV004783720]|Macular degeneration [RCV000393726]|Retinal dystrophy [RCV001075661]|Retinitis Pigmentosa, Recessive [RCV000393715]|Retinitis pigmentosa [RCV000787769] |Severe early-childhood-onset retinal dystrophy [RCV000008335]|Stargardt Disease, Recessive [RCV000340261]|Stargardt disease [RCV002470704]|not provided [RCV000078671]|not specified [RCV000259072] | pathogenic|likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|no classifications from unflagged records|not provided | 1 | 94001992 | 94001992 | Human | 15 | trait , alternate_id |
| 8560188 | CV22937 | single nucleotide variant | NM_000350.3(ABCA4):c.634C>T (p.Arg212Cys) | Cone-rod dystrophy 3 [RCV000179293]|Cone-rod dystrophy 3 [RCV000763050]|Retinal dystrophy [RCV001074780]|Severe early-childhood-onset retinal dystrophy [RCV000008355]|Stargardt disease 3 [RCV004558240]|Stargardt disease [RCV 000787521]|not provided [RCV000085812] | pathogenic|likely pathogenic|not provided | 1 | 94098928 | 94098928 | Human | 9 | trait , alternate_id |
| 11598651 | CV237685 | single nucleotide variant | NM_000350.3(ABCA4):c.2894A>G (p.Asn965Ser) | Cone-rod dystrophy 3 [RCV004796120]|Cone-rod dystrophy [RCV000787491]|Macular dystrophy [RCV000787492]|Retinal dystrophy [RCV001074886]|Retinitis pigmentosa 19 [RCV005252130]|Retinitis pigmentosa [RCV000787770]|Severe early-childhood-onset retinal dystrophy [RCV000408500]|Star 0;'>Stargardt disease 3 [RCV004558582]|Stargardt disease [RCV000787490]|not provided [RCV000413621] | pathogenic | 1 | 94046943 | 94046943 | Human | 15 | trait , alternate_id |
| 11578307 | CV237686 | single nucleotide variant | NM_000350.3(ABCA4):c.2875A>G (p.Thr959Ala) | Cone-Rod Dystrophy, Recessive [RCV000278622]|Cone-rod dystrophy 3 [RCV005025374]|Macular degeneration [RCV000338922]|Optic atrophy [RCV004816397]|Retinal dystrophy [RCV004816396]|Retinitis Pigmentosa, Recessive [RCV000323631]|Severe early-childhood-onset retinal dystrophy [RCV000408538]|Star 'font-weight:700;'>Stargardt Disease, Recessive [RCV000373695]|Stargardt disease [RCV005418022]|not provided [RCV000425865] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94046962 | 94046962 | Human | 14 | trait , alternate_id |
| 11577626 | CV267624 | single nucleotide variant | NM_000350.3(ABCA4):c.1532G>A (p.Arg511His) | ABCA4-related disorder [RCV001102037]|Cone-Rod Dystrophy, Recessive [RCV000328209]|Macular degeneration [RCV000385092]|Retinal dystrophy [RCV001073584]|Retinitis Pigmentosa, Recessive [RCV000270788]|Severe early-childhood-onset retinal dystrophy [RCV000505101]|Star an>gardt Disease, Recessive [RCV000264059]|Stargardt disease [RCV000844930]|not provided [RCV000512657] | likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94077712 | 94077712 | Human | 8 | trait , alternate_id |
| 11586427 | CV294078 | single nucleotide variant | NM_006017.3(PROM1):c.631-14T>C | Cone-rod dystrophy 12 [RCV000314928]|Retinal macular dystrophy type 2 [RCV000287975]|Retinitis pigmentosa [RCV000396849]|Stargardt disease 4 [RCV000345306]|Stargardt disease 4 [RCV002502339]|not provided [RCV001518834] | benign|likely benign | 4 | 16024372 | 16024372 | Human | 5 | trait |
| 11584378 | CV297522 | single nucleotide variant | NM_006017.3(PROM1):c.181A>G (p.Ile61Val) | Cone-rod dystrophy 12 [RCV000273204]|Retinal macular dystrophy type 2 [RCV000308324]|Retinitis pigmentosa [RCV000400360]|Stargardt disease 4 [RCV000363045]|Stargardt disease 4 [RCV005398476]|not provided [RCV001439949] | likely benign|conflicting interpretations of pathogenicity|uncertain significance | 4 | 16075726 | 16075726 | Human | 5 | trait |
| 11649817 | CV297621 | single nucleotide variant | NM_006017.3(PROM1):c.-127A>G | Cone-rod dystrophy 12 [RCV000290663]|Retinal macular dystrophy type 2 [RCV000289358]|Retinitis pigmentosa [RCV000384989]|Stargardt disease 4 [RCV000344310]|Stargardt disease 4 [RCV002480212] | uncertain significance | 4 | 16076033 | 16076033 | Human | 5 | trait |
| 14746749 | CV672055 | single nucleotide variant | NM_006017.3(PROM1):c.2112C>T (p.Arg704=) | Cone-rod dystrophy 12 [RCV001146426]|Retinal macular dystrophy type 2 [RCV001146425]|Retinitis pigmentosa [RCV001146427]|Stargardt disease 4 [RCV001146424]|Stargardt disease [RCV000844932]|not provided [RCV000908779] | likely benign|uncertain significance|not provided | 4 | 15987681 | 15987681 | Human | 6 | trait , alternate_id |
| 8645528 | CV104937 | deletion | NM_000350.3(ABCA4):c.1344del (p.Met448fs) | Severe early-childhood-onset retinal dystrophy [RCV002509208]|not provided [RCV000085390] | pathogenic|not provided | 1 | 94078602 | 94078602 | Human | 2 | alternate_id |
| 8645790 | CV105200 | single nucleotide variant | NM_000350.3(ABCA4):c.4685T>C (p.Ile1562Thr) | ABCA4-related disorder [RCV000314956]|Cone-Rod Dystrophy, Recessive [RCV000335992]|Cone-rod dystrophy 3 [RCV001005005]|Cone-rod dystrophy [RCV000787778]|Retinal dystrophy [RCV000505175]|Retinitis Pigmentosa, Recessive [RCV000407014]|Severe early-childhood-onset retinal dystrophy [RCV002509209]|Star style='font-weight:700;'>Stargardt disease [RCV000787502]|not provided [RCV000085664] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94021934 | 94021934 | Human | 9 | alternate_id |
| 8560185 | CV22934 | single nucleotide variant | ABCA4, IVS13AS, G-A, -1 | Stargardt disease 1 [RCV000008351]|Retinitis pigmentosa 19 [RCV000008352] | pathogenic | | | | Human | | alternate_id |
| 8560187 | CV22936 | single nucleotide variant | ABCA4, IVS5AS, A-G, -2 | Stargardt disease 1 [RCV000008354] | pathogenic | | | | Human | | alternate_id |
| 126737789 | CV1003044 | single nucleotide variant | NM_000350.3(ABCA4):c.4217A>G (p.His1406Arg) | Severe early-childhood-onset retinal dystrophy [RCV005235564]|not provided [RCV001324844] | pathogenic|likely pathogenic|uncertain significance | 1 | 94031032 | 94031032 | Human | 2 | alternate_id |
| 126772646 | CV1003053 | single nucleotide variant | NM_000350.3(ABCA4):c.2828G>T (p.Arg943Leu) | Cone-rod dystrophy 3 [RCV002499633]|not provided [RCV001323880] | uncertain significance | 1 | 94047009 | 94047009 | Human | 1 | alternate_id |
| 8642841 | CV101825 | single nucleotide variant | NM_019098.5(CNGB3):c.892A>C (p.Thr298Pro) | Achromatopsia 3 [RCV000988077]|Achromatopsia [RCV001831882]|Severe early-childhood-onset retinal dystrophy [RCV000373837]|not provided [RCV001522472]|not specified [RCV000081979] | benign | 8 | 86654023 | 86654023 | Human | 6 | alternate_id |
| 126770069 | CV1023523 | single nucleotide variant | NM_000350.3(ABCA4):c.5324T>A (p.Ile1775Asn) | Severe early-childhood-onset retinal dystrophy [RCV004563030]|not provided [RCV001344272] | pathogenic|likely pathogenic|uncertain significance | 1 | 94014679 | 94014679 | Human | 2 | alternate_id |
| 126736032 | CV1023539 | single nucleotide variant | NM_000350.3(ABCA4):c.3248T>A (p.Val1083Glu) | Cone-rod dystrophy 3 [RCV005023077]|not provided [RCV001350170]|not specified [RCV004699327] | likely pathogenic|uncertain significance | 1 | 94042841 | 94042841 | Human | 1 | alternate_id |
| 126770372 | CV1023553 | single nucleotide variant | NM_000350.3(ABCA4):c.1201A>T (p.Thr401Ser) | Stargardt disease [RCV002469377]|not provided [RCV001344435] | likely pathogenic|likely benign|uncertain significance | 1 | 94079360 | 94079360 | Human | 1 | alternate_id |
| 126753432 | CV1036047 | deletion | NM_000350.2:c.(2918+765_2918+775)_(3328+618_3328+662)del | Severe early-childhood-onset retinal dystrophy [RCV001353006] | likely pathogenic | | | | Human | 2 | alternate_id |
| 126753426 | CV1036052 | single nucleotide variant | NM_000350.3(ABCA4):c.6731T>A (p.Val2244Glu) | Severe early-childhood-onset retinal dystrophy [RCV001353004] | likely pathogenic | 1 | 93996194 | 93996194 | Human | 2 | alternate_id |
| 126753440 | CV1036053 | single nucleotide variant | NM_000350.3(ABCA4):c.6428T>A (p.Met2143Lys) | Severe early-childhood-onset retinal dystrophy [RCV001353009] | likely pathogenic | 1 | 94000887 | 94000887 | Human | 2 | alternate_id |
| 126753387 | CV1036054 | indel | NM_000350.3(ABCA4):c.6323_6331delinsGGC (p.Met2108_Asn2111delinsArgHis) | Severe early-childhood-onset retinal dystrophy [RCV001352983] | likely pathogenic | 1 | 94001057 | 94001065 | Human | | alternate_id |
| 126753404 | CV1036055 | single nucleotide variant | NM_000350.3(ABCA4):c.6282+1G>C | Retinal dystrophy [RCV004815443]|Severe early-childhood-onset retinal dystrophy [RCV001352994] | likely pathogenic | 1 | 94001857 | 94001857 | Human | 4 | alternate_id |
| 126753401 | CV1036056 | single nucleotide variant | NM_000350.3(ABCA4):c.6122G>A (p.Gly2041Asp) | Severe early-childhood-onset retinal dystrophy [RCV001352992]|not provided [RCV002548492]|not specified [RCV004699329] | pathogenic|likely pathogenic|uncertain significance | 1 | 94005466 | 94005466 | Human | 2 | alternate_id |
| 126753453 | CV1036057 | single nucleotide variant | NM_000350.3(ABCA4):c.5924G>T (p.Gly1975Val) | Severe early-childhood-onset retinal dystrophy [RCV001353016] | likely pathogenic | 1 | 94007715 | 94007715 | Human | 2 | alternate_id |
| 126753446 | CV1036058 | microsatellite | NM_000350.3(ABCA4):c.5762_5763del (p.Val1921fs) | Severe early-childhood-onset retinal dystrophy [RCV001353012] | likely pathogenic | 1 | 94008823 | 94008824 | Human | | alternate_id |
| 126753502 | CV1036059 | deletion | NM_000350.3(ABCA4):c.5690_5704del (p.Gln1897_Phe1901del) | Severe early-childhood-onset retinal dystrophy [RCV001353046] | likely pathogenic | 1 | 94010810 | 94010824 | Human | 2 | alternate_id |
| 126753371 | CV1036060 | single nucleotide variant | NM_000350.3(ABCA4):c.5461-6T>C | Severe early-childhood-onset retinal dystrophy [RCV001352975] | likely pathogenic | 1 | 94011391 | 94011391 | Human | 2 | alternate_id |
| 126753388 | CV1036061 | single nucleotide variant | NM_000350.3(ABCA4):c.5377G>A (p.Val1793Met) | Severe early-childhood-onset retinal dystrophy [RCV001352984]|not provided [RCV005094466] | pathogenic|likely pathogenic | 1 | 94014626 | 94014626 | Human | 2 | alternate_id |
| 126753494 | CV1036062 | single nucleotide variant | NM_000350.3(ABCA4):c.5311G>A (p.Gly1771Arg) | Retinal dystrophy [RCV004815444]|Severe early-childhood-onset retinal dystrophy [RCV001353043]|not provided [RCV001366508] | pathogenic|likely pathogenic|uncertain significance | 1 | 94015740 | 94015740 | Human | 4 | alternate_id |
| 126753449 | CV1036063 | single nucleotide variant | NM_000350.3(ABCA4):c.4978C>T (p.Pro1660Ser) | ABCA4-related disorder [RCV004733268]|Retinitis pigmentosa [RCV001724300]|Severe early-childhood-onset retinal dystrophy [RCV001353015]|not provided [RCV001379165] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94021280 | 94021280 | Human | 4 | alternate_id |
| 126753316 | CV1036064 | single nucleotide variant | NM_000350.3(ABCA4):c.4958G>A (p.Gly1653Glu) | Severe early-childhood-onset retinal dystrophy [RCV001352944] | likely pathogenic | 1 | 94021300 | 94021300 | Human | 2 | alternate_id |
| 126753332 | CV1036065 | deletion | NM_000350.3(ABCA4):c.4609del (p.Thr1537fs) | Severe early-childhood-onset retinal dystrophy [RCV001352951] | likely pathogenic | 1 | 94024979 | 94024979 | Human | 2 | alternate_id |
| 126753333 | CV1036066 | single nucleotide variant | NM_000350.3(ABCA4):c.4383G>C (p.Trp1461Cys) | Severe early-childhood-onset retinal dystrophy [RCV001352952]|not provided [RCV001871907] | pathogenic|likely pathogenic | 1 | 94029601 | 94029601 | Human | 2 | alternate_id |
| 126753391 | CV1036067 | single nucleotide variant | NM_000350.3(ABCA4):c.3523-1G>A | Severe early-childhood-onset retinal dystrophy [RCV001352986] | likely pathogenic | 1 | 94040128 | 94040128 | Human | 2 | alternate_id |
| 126753457 | CV1036068 | deletion | NM_000350.3(ABCA4):c.3323del (p.Arg1108fs) | Severe early-childhood-onset retinal dystrophy [RCV001353018] | likely pathogenic | 1 | 94042766 | 94042766 | Human | 2 | alternate_id |
| 126753322 | CV1036069 | single nucleotide variant | NM_000350.3(ABCA4):c.3179A>C (p.Gln1060Pro) | Severe early-childhood-onset retinal dystrophy [RCV001352946]|not provided [RCV001871906]|not specified [RCV005408861] | pathogenic|likely pathogenic|uncertain significance | 1 | 94043347 | 94043347 | Human | 2 | alternate_id |
| 126753474 | CV1036070 | single nucleotide variant | NM_000350.3(ABCA4):c.2932G>A (p.Gly978Ser) | Severe early-childhood-onset retinal dystrophy [RCV001353029]|not provided [RCV001871909] | pathogenic|likely pathogenic | 1 | 94044731 | 94044731 | Human | 2 | alternate_id |
| 126753327 | CV1036071 | single nucleotide variant | NM_000350.3(ABCA4):c.1742C>A (p.Thr581Asn) | Severe early-childhood-onset retinal dystrophy [RCV001352949] | likely pathogenic | 1 | 94063130 | 94063130 | Human | 2 | alternate_id |
| 126753431 | CV1036074 | deletion | NM_000350.3(ABCA4):c.428del (p.Pro143fs) | Severe early-childhood-onset retinal dystrophy [RCV001353005]|not provided [RCV001871908] | pathogenic|likely pathogenic | 1 | 94108591 | 94108591 | Human | 2 | alternate_id |
| 126753384 | CV1036075 | single nucleotide variant | NM_000350.3(ABCA4):c.184C>T (p.Pro62Ser) | Severe early-childhood-onset retinal dystrophy [RCV001352982]|not provided [RCV003490217] | likely pathogenic | 1 | 94111556 | 94111556 | Human | 2 | alternate_id |
| 126917996 | CV1040361 | microsatellite | NM_000350.3(ABCA4):c.2294GTG[1] (p.Gly766del) | Cone-rod dystrophy 3 [RCV005023112]|not provided [RCV001372399] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94056684 | 94056686 | Human | | alternate_id |
| 126908020 | CV1040371 | single nucleotide variant | NM_000350.3(ABCA4):c.320G>A (p.Arg107Gln) | Cone-rod dystrophy 3 [RCV002488138]|not provided [RCV001367497] | likely benign|uncertain significance | 1 | 94108699 | 94108699 | Human | 1 | alternate_id |
| 8645152 | CV104556 | single nucleotide variant | NM_000322.5(PRPH2):c.422A>G (p.Tyr141Cys) | Autosomal recessive bestrophinopathy [RCV001353037]|Cone-rod dystrophy [RCV001250317]|PRPH2-related disorder [RCV001051727]|Patterned dystrophy of the retinal pigment epithelium [RCV001250316]|Patterned macular dystrophy 1 [RCV000161145]|Retinal dystrophy [RCV001074856]|Retinitis pigmentosa 7 [RCV00 5031577]|Retinitis pigmentosa [RCV001723663]|Stargardt disease [RCV001250306]|Vitelliform macular dystrophy 3 [RCV002508140]|not provided [RCV000084969] | pathogenic|likely pathogenic|not provided | 6 | 42721913 | 42721913 | Human | 16 | alternate_id |
| 8645154 | CV104558 | deletion | NM_000322.5(PRPH2):c.441del (p.Gly148fs) | PRPH2-related disorder [RCV001854487]|Retinal dystrophy [RCV004815031]|Stargardt disease [RCV001250322]|maculopathy [RCV001003148]|not provided [RCV000084972] | pathogenic|not provided | 6 | 42721894 | 42721894 | Human | 4 | alternate_id |
| 8645157 | CV104561 | single nucleotide variant | NM_000322.5(PRPH2):c.469G>A (p.Asp157Asn) | PRPH2-related disorder [RCV001378482]|Pigmentary retinal dystrophy [RCV001270171]|Pigmentary retinopathy [RCV000626661]|Retinal dystrophy [RCV001074377]|Retinitis pigmentosa [RCV001250327]|Stargardt disease [RCV001250326]|not provided [RCV000084975] | pathogenic|likely pathogenic|not provided | 6 | 42721866 | 42721866 | Human | 13 | alternate_id |
| 8645177 | CV104582 | single nucleotide variant | NM_000322.5(PRPH2):c.638G>A (p.Cys213Tyr) | PRPH2-related disorder [RCV001052017]|Patterned macular dystrophy 1 [RCV001542667]|Retinal dystrophy [RCV001074371]|Stargardt disease [RCV001250308]|not provided [RCV000085003] | pathogenic|likely pathogenic|not provided | 6 | 42704555 | 42704555 | Human | 6 | alternate_id |
| 8645187 | CV104593 | single nucleotide variant | NM_000322.5(PRPH2):c.715C>T (p.Gln239Ter) | Choroidal dystrophy, central areolar 2 [RCV004760371]|Macular dystrophy [RCV000787668]|PRPH2-related disorder [RCV001386136]|Patterned dystrophy of the retinal pigment epithelium [RCV001250336]|Retinal dystrophy [RCV004815035]|Stargardt disease [RCV001250335]|no t provided [RCV000085015] | pathogenic|likely pathogenic|not provided | 6 | 42704478 | 42704478 | Human | 7 | alternate_id |
| 8645197 | CV104603 | single nucleotide variant | NM_000322.5(PRPH2):c.828+3A>T | Choroideremia [RCV001250345]|Cone-rod dystrophy [RCV001250359]|Doyne honeycomb retinal dystrophy [RCV001250358]|PRPH2-related disorder [RCV001047656]|Patterned dystrophy of the retinal pigment epithelium [RCV001250346]|Patterned macular dystrophy 1 [RCV001542666]|Retinal dystrophy [RCV001073686]|Ret initis pigmentosa [RCV001250357]|Stargardt disease [RCV001250344]|Vitelliform macular dystrophy 2 [RCV001250347]|not provided [RCV000085026] | pathogenic|likely pathogenic|not provided | 6 | 42704362 | 42704362 | Human | 16 | alternate_id |
| 8645199 | CV104605 | single nucleotide variant | NM_000322.5(PRPH2):c.866C>T (p.Ser289Leu) | PRPH2-related disorder [RCV001438086]|Retinal dystrophy [RCV004815038]|Retinitis pigmentosa 7 [RCV005394359]|Retinitis pigmentosa [RCV001161271]|Stargardt disease [RCV001250360]|not provided [RCV000085028] | pathogenic|likely benign|uncertain significance|not provided | 6 | 42698470 | 42698470 | Human | 13 | alternate_id |
| 8645205 | CV104611 | single nucleotide variant | NM_000322.5(PRPH2):c.938C>T (p.Pro313Leu) | Adult-onset foveomacular vitelliform dystrophy [RCV000261808]|Choroidal dystrophy, central areolar 2 [RCV000301680]|Cone-rod dystrophy [RCV000406549]|PRPH2-related disorder [RCV001066591]|Patterned dystrophy of the retinal pigment epithelium [RCV001250366]|Patterned macular dystrophy 1 [RCV000298015 ]|Pigmentary retinal dystrophy [RCV000356624]|Retinal dystrophy [RCV004815041]|Retinitis pigmentosa [RCV000787872]|Stargardt disease [RCV001250365]|not provided [RCV000085034] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 6 | 42698398 | 42698398 | Human | 14 | alternate_id |
| 8645206 | CV104612 | single nucleotide variant | NM_000322.5(PRPH2):c.94A>G (p.Ile32Val) | Optic atrophy [RCV004815042]|PRPH2-related disorder [RCV001462596]|Retinal dystrophy [RCV003888461]|Retinitis pigmentosa 7 [RCV005394360]|Stargardt disease [RCV001250380]|Vitelliform macular dystrophy 3 [RCV001352968]|not provided [RCV000085036]|not specified [R CV001530276] | likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|no classifications from unflagged records|not provided | 6 | 42722241 | 42722241 | Human | 13 | alternate_id |
| 8645507 | CV104916 | deletion | NM_000350.3(ABCA4):c.1025_1038del (p.Asp342fs) | Retinal dystrophy [RCV001075021]|Severe early-childhood-onset retinal dystrophy [RCV000986373]|not provided [RCV000085369] | pathogenic|likely pathogenic|not provided | 1 | 94080539 | 94080552 | Human | 4 | alternate_id |
| 8645514 | CV104923 | single nucleotide variant | NM_000350.3(ABCA4):c.1140T>A (p.Asn380Lys) | ABCA4-related disorder [RCV001096640]|Autosomal recessive retinitis pigmentosa [RCV001257823]|Cone-rod dystrophy 3 [RCV000764205]|Cone-rod dystrophy 3 [RCV005357535]|Retinal dystrophy [RCV001073759]|Severe early-childhood-onset retinal dystrophy [RCV000986372]|not provided [RCV000085376] | pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94079421 | 94079421 | Human | 9 | alternate_id |
| 8645516 | CV104925 | single nucleotide variant | NM_000350.3(ABCA4):c.1222C>T (p.Arg408Ter) | Retinal dystrophy [RCV001074409]|Retinitis pigmentosa 19 [RCV002513925]|Retinitis pigmentosa [RCV003398695]|Severe early-childhood-onset retinal dystrophy [RCV000152707]|Stargardt disease 3 [RCV004558301]|not provided [RCV000085378] | pathogenic|not provided | 1 | 94079339 | 94079339 | Human | 8 | alternate_id |
| 8645517 | CV104926 | single nucleotide variant | NM_000350.3(ABCA4):c.122G>A (p.Trp41Ter) | Retinal dystrophy [RCV004815077]|Severe early-childhood-onset retinal dystrophy [RCV000408553]|not provided [RCV000085379] | pathogenic|not provided | 1 | 94113011 | 94113011 | Human | 4 | alternate_id |
| 8645518 | CV104927 | single nucleotide variant | NM_000350.3(ABCA4):c.1240-14C>T | ABCA4-related disorder [RCV001096639]|Age related macular degeneration 2 [RCV001548785]|Cone-Rod Dystrophy, Recessive [RCV000275590]|Cone-rod dystrophy 3 [RCV001548784]|Macular degeneration [RCV000288568]|Retinitis Pigmentosa, Recessive [RCV000332943]|Retinitis pigmentosa 19 [RCV001548783]|Severe ea rly-childhood-onset retinal dystrophy [RCV001548782]|Stargardt Disease, Recessive [RCV000389891]|not provided [RCV000085380]|not specified [RCV000173677] | benign|not provided | 1 | 94078720 | 94078720 | Human | 10 | alternate_id |
| 8645526 | CV104935 | single nucleotide variant | NM_000350.3(ABCA4):c.1335C>G (p.Ser445Arg) | Retinal dystrophy [RCV000210294]|Severe early-childhood-onset retinal dystrophy [RCV000504649]|Stargardt disease [RCV005406817]|not provided [RCV000085388] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94078611 | 94078611 | Human | 4 | alternate_id |
| 8645533 | CV104942 | single nucleotide variant | NM_000350.3(ABCA4):c.1411G>A (p.Glu471Lys) | ABCA4-related disorder [RCV001102041]|Age related macular degeneration 2 [RCV001808322]|Inborn genetic diseases [RCV000622340]|Retinal dystrophy [RCV001074274]|Severe early-childhood-onset retinal dystrophy [RCV003128228]|Stargardt disease [RCV001002844]|not pro vided [RCV000085395]|not specified [RCV003317086] | likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94077833 | 94077833 | Human | 7 | alternate_id |
| 8645543 | CV104952 | single nucleotide variant | NM_000350.3(ABCA4):c.1609C>T (p.Arg537Cys) | Macular dystrophy [RCV000505043]|Retinal dystrophy [RCV001074843]|Severe early-childhood-onset retinal dystrophy [RCV000408566]|not provided [RCV000085405] | pathogenic|likely pathogenic|not provided | 1 | 94063263 | 94063263 | Human | 6 | alternate_id |
| 8645546 | CV104955 | single nucleotide variant | NM_000350.3(ABCA4):c.161G>A (p.Cys54Tyr) | ABCA4-related disorder [RCV004529882]|Cone-rod dystrophy 3 [RCV005031583]|Retinal dystrophy [RCV004815079]|Severe early-childhood-onset retinal dystrophy [RCV000210980]|Stargardt disease [RCV000826094]|not provided [RCV000085408] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94111579 | 94111579 | Human | 8 | alternate_id |
| 8645547 | CV104956 | single nucleotide variant | NM_000350.3(ABCA4):c.161G>T (p.Cys54Phe) | Severe early-childhood-onset retinal dystrophy [RCV000132585]|not provided [RCV000085409] | pathogenic|not provided | 1 | 94111579 | 94111579 | Human | 2 | alternate_id |
| 8645551 | CV104959 | single nucleotide variant | NM_000350.3(ABCA4):c.1648G>A (p.Gly550Arg) | ABCA4-related disorder [RCV000778263]|Cone-rod dystrophy 3 [RCV000763048]|Cone-rod dystrophy 3 [RCV000782281]|Retinal dystrophy [RCV001074836]|Retinitis pigmentosa 19 [RCV000761253]|Stargardt disease 3 [RCV004558302]|not provided [RCV000085413] | pathogenic|likely pathogenic|not provided | 1 | 94063224 | 94063224 | Human | 9 | alternate_id |
| 8645557 | CV104965 | single nucleotide variant | NM_000350.3(ABCA4):c.1760+2T>G | Cone-rod dystrophy 3 [RCV005031584]|Retinal dystrophy [RCV003888471]|Retinitis pigmentosa 19 [RCV005252751]|Severe early-childhood-onset retinal dystrophy [RCV000132587]|not provided [RCV000085420] | pathogenic|not provided | 1 | 94063110 | 94063110 | Human | 8 | alternate_id |
| 8645561 | CV104969 | single nucleotide variant | NM_000350.3(ABCA4):c.1789C>T (p.Pro597Ser) | Retinal dystrophy [RCV004815080]|Severe early-childhood-onset retinal dystrophy [RCV000408487]|not provided [RCV000085424] | likely pathogenic|not provided | 1 | 94062725 | 94062725 | Human | 4 | alternate_id |
| 8645564 | CV104972 | single nucleotide variant | NM_000350.3(ABCA4):c.179C>T (p.Ala60Val) | Cone-rod dystrophy 3 [RCV000763051]|Retinal dystrophy [RCV001073359]|Severe early-childhood-onset retinal dystrophy [RCV000408452]|Stargardt disease 3 [RCV004558304]|not provided [RCV000085427] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94111561 | 94111561 | Human | 9 | alternate_id |
| 8645568 | CV104976 | single nucleotide variant | NM_000350.3(ABCA4):c.1819G>A (p.Gly607Arg) | Retinal dystrophy [RCV001075859]|Severe early-childhood-onset retinal dystrophy [RCV000408475]|Stargardt disease [RCV000787762]|not provided [RCV000085431] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94062695 | 94062695 | Human | 4 | alternate_id |
| 8645574 | CV104982 | single nucleotide variant | NM_000350.3(ABCA4):c.1878G>A (p.Ala626=) | Cone-rod dystrophy 3 [RCV002498453]|not provided [RCV000085437] | benign|not provided | 1 | 94062636 | 94062636 | Human | 1 | alternate_id |
| 8645577 | CV104985 | single nucleotide variant | NM_000350.3(ABCA4):c.1903C>T (p.Gln635Ter) | Retinal dystrophy [RCV004815083]|Retinitis pigmentosa [RCV005055575]|Severe early-childhood-onset retinal dystrophy [RCV000408491]|not provided [RCV000085440] | pathogenic|likely pathogenic|not provided | 1 | 94062611 | 94062611 | Human | 6 | alternate_id |
| 8645582 | CV104990 | single nucleotide variant | NM_000350.3(ABCA4):c.1927G>A (p.Val643Met) | ABCA4-related disorder [RCV001098279]|Cone-Rod Dystrophy, Recessive [RCV000318324]|Macular degeneration [RCV000260757]|Retinal dystrophy [RCV001075850]|Retinitis Pigmentosa, Recessive [RCV000356519]|Severe early-childhood-onset retinal dystrophy [RCV000986369]|Star an>gardt Disease, Recessive [RCV000353201]|not provided [RCV000085445]|not specified [RCV000174470] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94062587 | 94062587 | Human | 8 | alternate_id |
| 8645583 | CV104991 | single nucleotide variant | NM_000350.3(ABCA4):c.1928T>G (p.Val643Gly) | ABCA4-related disorder [RCV001098278]|Cone-rod dystrophy 3 [RCV004720237]|Cone-rod dystrophy 3 [RCV005364979]|Retinal dystrophy [RCV001074170]|Severe early-childhood-onset retinal dystrophy [RCV000408583]|not provided [RCV000085446] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94062586 | 94062586 | Human | 6 | alternate_id |
| 8645584 | CV104992 | single nucleotide variant | NM_000350.3(ABCA4):c.1933G>A (p.Asp645Asn) | Cone-rod dystrophy 3 [RCV005025146]|Retinal dystrophy [RCV001074983]|Retinitis pigmentosa [RCV004689454]|not provided [RCV000085447] | pathogenic|likely pathogenic|not provided | 1 | 94062581 | 94062581 | Human | 5 | alternate_id |
| 8645585 | CV104993 | single nucleotide variant | NM_000350.3(ABCA4):c.1937+1G>A | Cone dystrophy and rod monochromatism [RCV005417459]|Retinal dystrophy [RCV004815084]|Retinitis pigmentosa 19 [RCV001542645]|See cases [RCV004584346]|Severe early-childhood-onset retinal dystrophy [RCV000408499]|Stargardt disease 3 [RCV004558306]|not provided [R CV000085448] | pathogenic|not provided | 1 | 94062576 | 94062576 | Human | 6 | alternate_id |
| 8645587 | CV104995 | single nucleotide variant | NM_000350.3(ABCA4):c.1938-1G>A | Macular dystrophy [RCV000504968]|Retinitis pigmentosa 19 [RCV000008352]|Severe early-childhood-onset retinal dystrophy [RCV000008351]|not provided [RCV000085450] | pathogenic|likely pathogenic|not provided | 1 | 94060760 | 94060760 | Human | 5 | alternate_id |
| 8645588 | CV104996 | single nucleotide variant | NM_000350.3(ABCA4):c.194G>A (p.Gly65Glu) | Cone-rod dystrophy 3 [RCV002490741]|Retinal dystrophy [RCV001074366]|Severe early-childhood-onset retinal dystrophy [RCV000132588]|not provided [RCV000085451] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94111546 | 94111546 | Human | 8 | alternate_id |
| 8645589 | CV104997 | single nucleotide variant | NM_000350.3(ABCA4):c.1957C>T (p.Arg653Cys) | ABCA4-related disorder [RCV004732662]|Cone-rod dystrophy 3 [RCV000763047]|Retinal dystrophy [RCV001074668]|Severe early-childhood-onset retinal dystrophy [RCV000408546]|not provided [RCV000085452] | pathogenic|likely pathogenic|not provided | 1 | 94060740 | 94060740 | Human | 8 | alternate_id |
| 8645591 | CV104999 | single nucleotide variant | NM_000350.3(ABCA4):c.1A>G (p.Met1Val) | Abnormality of the eye [RCV001814056]|Retinal dystrophy [RCV004815085]|Severe early-childhood-onset retinal dystrophy [RCV000408483]|not provided [RCV000085454] | pathogenic|likely pathogenic|not provided | 1 | 94121045 | 94121045 | Human | 6 | alternate_id |
| 8645592 | CV105000 | deletion | NM_000350.3(ABCA4):c.2005_2006del (p.Met669fs) | Retinal dystrophy [RCV001074028]|Severe early-childhood-onset retinal dystrophy [RCV001353038]|not provided [RCV000085455] | pathogenic|likely pathogenic|not provided | 1 | 94060691 | 94060692 | Human | 4 | alternate_id |
| 8645594 | CV105002 | single nucleotide variant | NM_000350.3(ABCA4):c.203C>T (p.Pro68Leu) | ABCA4-related disorder [RCV004529883]|Abnormal macular morphology [RCV000414796]|Abnormal retinal morphology [RCV000626666]|Age related macular degeneration 2 [RCV001198384]|Cone-rod dystrophy 3 [RCV004796008]|Retinal dystrophy [RCV001074514]|Retinitis pigmentosa [RCV004586547]|not provided [RCV0000 85457] | pathogenic|likely pathogenic|uncertain significance|no classifications from unflagged records|not provided | 1 | 94111537 | 94111537 | Human | 14 | alternate_id |
| 8645595 | CV105003 | single nucleotide variant | NM_000350.3(ABCA4):c.2041C>T (p.Arg681Ter) | ABCA4-related disorder [RCV004732663]|Age related macular degeneration 2 [RCV001195987]|Benign concentric annular macular dystrophy [RCV000210310]|Cone-rod dystrophy 3 [RCV005025147]|Leber congenital amaurosis [RCV000504983]|Retinal dystrophy [RCV001073628]|Severe early-childhood-onset retinal dystr ophy [RCV000408512]|Stargardt disease 3 [RCV004558307]|not provided [RCV000085458] | pathogenic|likely pathogenic|not provided | 1 | 94060656 | 94060656 | Human | 11 | alternate_id |
| 8645601 | CV105009 | single nucleotide variant | NM_000350.3(ABCA4):c.214G>A (p.Gly72Arg) | Age related macular degeneration 2 [RCV002466250]|Retinal dystrophy [RCV004794358]|Severe early-childhood-onset retinal dystrophy [RCV001353042]|Stargardt disease [RCV000787776]|not provided [RCV000085464]|not specified [RCV001000882] | pathogenic|likely pathogenic|not provided | 1 | 94111526 | 94111526 | Human | 6 | alternate_id |
| 8645603 | CV105011 | single nucleotide variant | NM_000350.3(ABCA4):c.223T>G (p.Cys75Gly) | Retinitis pigmentosa [RCV004782054]|Severe early-childhood-onset retinal dystrophy [RCV000504688]|not provided [RCV000085466] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94111517 | 94111517 | Human | 4 | alternate_id |
| 8645604 | CV105012 | single nucleotide variant | NM_000350.3(ABCA4):c.2291G>A (p.Cys764Tyr) | Retinal dystrophy [RCV001074411]|Severe early-childhood-onset retinal dystrophy [RCV000408455]|not provided [RCV000085467] | pathogenic|likely pathogenic|not provided | 1 | 94056692 | 94056692 | Human | 4 | alternate_id |
| 8645606 | CV105014 | single nucleotide variant | NM_000350.3(ABCA4):c.2294G>A (p.Ser765Asn) | ABCA4-related disorder [RCV004724803]|Stargardt disease [RCV001002839]|not provided [RCV000085469] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94056689 | 94056689 | Human | 2 | alternate_id |
| 8645608 | CV105016 | single nucleotide variant | NM_000350.3(ABCA4):c.2300T>A (p.Val767Asp) | ABCA4-related disorder [RCV004732664]|Retinal dystrophy [RCV001074642]|Retinitis pigmentosa [RCV005406818]|Severe early-childhood-onset retinal dystrophy [RCV000408526]|not provided [RCV000085471] | pathogenic|likely pathogenic|not provided | 1 | 94056683 | 94056683 | Human | 6 | alternate_id |
| 8645616 | CV105024 | single nucleotide variant | NM_000350.3(ABCA4):c.2453G>A (p.Gly818Glu) | Cone-rod dystrophy 3 [RCV005252127]|Retinal dystrophy [RCV001075477]|Stargardt disease [RCV000787774]|not provided [RCV000085479] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94055245 | 94055245 | Human | 4 | alternate_id |
| 8645617 | CV105025 | single nucleotide variant | NM_000350.3(ABCA4):c.2461T>A (p.Trp821Arg) | ABCA4-related disorder [RCV004732665]|Cone-rod dystrophy 3 [RCV005025148]|Retinal dystrophy [RCV001075705]|Retinitis pigmentosa [RCV004586548]|not provided [RCV000085480] | pathogenic|not provided | 1 | 94055237 | 94055237 | Human | 10 | alternate_id |
| 8645622 | CV105030 | single nucleotide variant | NM_000350.3(ABCA4):c.2546T>C (p.Val849Ala) | Optic atrophy [RCV004815087]|Retinal dystrophy [RCV001074506]|Severe early-childhood-onset retinal dystrophy [RCV000986366]|not provided [RCV000085485] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94055152 | 94055152 | Human | 6 | alternate_id |
| 8645624 | CV105032 | single nucleotide variant | NM_000350.3(ABCA4):c.2560G>A (p.Ala854Thr) | Cone-rod dystrophy 3 [RCV005025149]|Retinal dystrophy [RCV001075467]|Severe early-childhood-onset retinal dystrophy [RCV000504877]|not provided [RCV000085487] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94055138 | 94055138 | Human | 8 | alternate_id |
| 8645625 | CV105033 | single nucleotide variant | NM_000350.3(ABCA4):c.2564G>A (p.Trp855Ter) | Retinal dystrophy [RCV001073601]|Severe early-childhood-onset retinal dystrophy [RCV000408572]|not provided [RCV000085488] | pathogenic|not provided | 1 | 94055134 | 94055134 | Human | 4 | alternate_id |
| 8645636 | CV105044 | single nucleotide variant | NM_000350.3(ABCA4):c.2701A>G (p.Thr901Ala) | ABCA4-related disorder [RCV001101956]|Cone-rod dystrophy [RCV000787777]|Stargardt disease [RCV002470763]|not provided [RCV000085502] | likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94048910 | 94048910 | Human | 5 | alternate_id |
| 8645643 | CV105051 | single nucleotide variant | NM_000350.3(ABCA4):c.2827C>T (p.Arg943Trp) | ABCA4-related disorder [RCV004529885]|Retinal dystrophy [RCV001074959]|Stargardt disease [RCV003330430]|not provided [RCV000085510] | pathogenic|likely pathogenic|uncertain significance|no classifications from unflagged records|not provided | 1 | 94047010 | 94047010 | Human | 4 | alternate_id |
| 8645646 | CV105054 | single nucleotide variant | NM_000350.3(ABCA4):c.286A>C (p.Asn96His) | Severe early-childhood-onset retinal dystrophy [RCV005400423]|not provided [RCV000085514] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94111454 | 94111454 | Human | 2 | alternate_id |
| 8645647 | CV105055 | single nucleotide variant | NM_000350.3(ABCA4):c.286A>G (p.Asn96Asp) | Cone-rod dystrophy 3 [RCV005025150]|Retinal dystrophy [RCV004815092]|Severe early-childhood-onset retinal dystrophy [RCV000986376]|not provided [RCV000085515] | pathogenic|likely pathogenic|not provided | 1 | 94111454 | 94111454 | Human | 8 | alternate_id |
| 8645654 | CV105062 | single nucleotide variant | NM_000350.3(ABCA4):c.2912C>A (p.Thr971Asn) | Cone-rod dystrophy 3 [RCV005031585]|Severe early-childhood-onset retinal dystrophy [RCV002225080]|not provided [RCV000085522]|not specified [RCV000999861] | pathogenic|likely pathogenic|not provided | 1 | 94046925 | 94046925 | Human | 6 | alternate_id |
| 8645655 | CV105063 | single nucleotide variant | NM_000350.3(ABCA4):c.2915C>A (p.Thr972Asn) | ABCA4-related disorder [RCV004732666]|Cone-rod dystrophy 3 [RCV002498454]|Retinal dystrophy [RCV000504717]|Retinitis pigmentosa [RCV000505078]|not provided [RCV000085523] | pathogenic|likely pathogenic|not provided | 1 | 94046922 | 94046922 | Human | 10 | alternate_id |
| 8645661 | CV105069 | single nucleotide variant | NM_000350.3(ABCA4):c.2966T>C (p.Val989Ala) | ABCA4-related disorder [RCV004732667]|Cone-rod dystrophy 3 [RCV005025151]|Retinal dystrophy [RCV001074424]|Severe early-childhood-onset retinal dystrophy [RCV000504904]|not provided [RCV000085529] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94044697 | 94044697 | Human | 8 | alternate_id |
| 8645662 | CV105070 | duplication | NM_000350.3(ABCA4):c.296dup (p.Asn99fs) | Retinal dystrophy [RCV004815095]|Severe early-childhood-onset retinal dystrophy [RCV000408568]|not provided [RCV000085530] | pathogenic|not provided | 1 | 94111443 | 94111444 | Human | 4 | alternate_id |
| 8645663 | CV105071 | single nucleotide variant | NM_000350.3(ABCA4):c.2971G>C (p.Gly991Arg) | ABCA4-related disorder [RCV004529886]|Age related macular degeneration 2 [RCV002247488]|Cone-rod dystrophy 3 [RCV005025152]|Macular dystrophy [RCV000505091]|Optic atrophy [RCV004815096]|Retinal dystrophy [RCV001073380]|Retinitis pigmentosa 19 [RCV004699118]|Severe early-childhood-onset retinal dystr ophy [RCV003989317]|not provided [RCV000085531] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94044692 | 94044692 | Human | 12 | alternate_id |
| 8645670 | CV105078 | single nucleotide variant | NM_000350.3(ABCA4):c.302+26A>G | Age related macular degeneration 2 [RCV001548793]|Cone-rod dystrophy 3 [RCV001548792]|Retinitis pigmentosa 19 [RCV001548791]|Severe early-childhood-onset retinal dystrophy [RCV001548790]|not provided [RCV000085538]|not specified [RCV000247190] | benign|not provided | 1 | 94111412 | 94111412 | Human | 6 | alternate_id |
| 8645672 | CV105080 | single nucleotide variant | NM_000350.3(ABCA4):c.3041T>G (p.Leu1014Arg) | Severe early-childhood-onset retinal dystrophy [RCV004558308]|not provided [RCV000085540] | pathogenic|likely pathogenic|not provided | 1 | 94044622 | 94044622 | Human | 2 | alternate_id |
| 8645673 | CV105081 | single nucleotide variant | NM_000350.3(ABCA4):c.3050+5G>A | Cone-rod dystrophy 3 [RCV005025153]|Retinal dystrophy [RCV001073618]|Stargardt disease [RCV001002836]|not provided [RCV000085541] | pathogenic|not provided | 1 | 94044608 | 94044608 | Human | 4 | alternate_id |
| 8645675 | CV105083 | single nucleotide variant | NM_000350.3(ABCA4):c.3055A>G (p.Thr1019Ala) | Cone-rod dystrophy 3 [RCV004796009]|not provided [RCV000085543] | pathogenic|not provided | 1 | 94043471 | 94043471 | Human | 1 | alternate_id |
| 8645677 | CV105085 | single nucleotide variant | NM_000350.3(ABCA4):c.3064G>A (p.Glu1022Lys) | ABCA4-related disorder [RCV004529887]|Retinal dystrophy [RCV004815097]|Retinitis pigmentosa [RCV004800282]|Severe early-childhood-onset retinal dystrophy [RCV000408496]|Stargardt disease [RCV003324507]|not provided [RCV000085545] | pathogenic|likely pathogenic|not provided | 1 | 94043462 | 94043462 | Human | 6 | alternate_id |
| 8645678 | CV105086 | single nucleotide variant | NM_000350.3(ABCA4):c.3085C>T (p.Gln1029Ter) | Retinal dystrophy [RCV004815098]|Severe early-childhood-onset retinal dystrophy [RCV000408564]|not provided [RCV000085546] | pathogenic|not provided | 1 | 94043441 | 94043441 | Human | 4 | alternate_id |
| 8645680 | CV105088 | single nucleotide variant | NM_000350.3(ABCA4):c.3149G>A (p.Gly1050Asp) | Cone-rod dystrophy 3 [RCV005025154]|Retinal dystrophy [RCV004815099]|not provided [RCV000085550] | pathogenic|likely pathogenic|not provided | 1 | 94043377 | 94043377 | Human | 3 | alternate_id |
| 8645681 | CV105089 | single nucleotide variant | NM_000350.3(ABCA4):c.3163C>T (p.Arg1055Trp) | Retinal dystrophy [RCV004815100]|Severe early-childhood-onset retinal dystrophy [RCV003992182]|not provided [RCV000085551] | uncertain significance|not provided | 1 | 94043363 | 94043363 | Human | 4 | alternate_id |
| 8645688 | CV105097 | single nucleotide variant | NM_000350.3(ABCA4):c.3212C>T (p.Ser1071Leu) | ABCA4-related disorder [RCV002255094]|Cone-rod dystrophy 3 [RCV005025155]|Cone-rod dystrophy [RCV003324508]|Retinal dystrophy [RCV004815102]|Retinitis pigmentosa [RCV004689455]|not provided [RCV000085559] | pathogenic|likely pathogenic|not provided | 1 | 94042877 | 94042877 | Human | 12 | alternate_id |
| 8645691 | CV105100 | single nucleotide variant | NM_000350.3(ABCA4):c.3259G>A (p.Glu1087Lys) | ABCA4-related disorder [RCV004732669]|Abnormality of the eye [RCV001814057]|Age related macular degeneration 2 [RCV001199228]|Cone-rod dystrophy 3 [RCV002466427]|Cone-rod dystrophy 3 [RCV002498455]|Retinal dystrophy [RCV001075833]|Retinitis pigmentosa 19 [RCV001808323]|not provided [RCV000085562] | pathogenic|not provided | 1 | 94042830 | 94042830 | Human | 10 | alternate_id |
| 8645692 | CV105101 | single nucleotide variant | NM_000350.3(ABCA4):c.3261A>C (p.Glu1087Asp) | Retinal dystrophy [RCV001075184]|Severe early-childhood-onset retinal dystrophy [RCV000408551]|not provided [RCV000085563] | pathogenic|likely pathogenic|not provided | 1 | 94042828 | 94042828 | Human | 4 | alternate_id |
| 8645693 | CV105102 | single nucleotide variant | NM_000350.3(ABCA4):c.3272G>A (p.Gly1091Glu) | Age related macular degeneration 2 [RCV001198727]|Retinal dystrophy [RCV004815104]|Severe early-childhood-onset retinal dystrophy [RCV000408464]|not provided [RCV000085564] | likely pathogenic|uncertain significance|not provided | 1 | 94042817 | 94042817 | Human | 6 | alternate_id |
| 8645697 | CV105106 | single nucleotide variant | NM_000350.3(ABCA4):c.32T>C (p.Leu11Pro) | ABCA4-related disorder [RCV000779010]|Age related macular degeneration 2 [RCV002247489]|Cone-rod dystrophy 3 [RCV005025156]|Cone-rod dystrophy [RCV003324509]|Retinal dystrophy [RCV001074134]|Retinitis pigmentosa [RCV001723665]|Severe early-childhood-onset retinal dystrophy [RCV002051808]|Star ='font-weight:700;'>Stargardt disease [RCV003324510]|not provided [RCV000085568] | pathogenic|likely pathogenic|not provided | 1 | 94121014 | 94121014 | Human | 12 | alternate_id |
| 8645699 | CV105108 | single nucleotide variant | NM_000350.3(ABCA4):c.3323G>A (p.Arg1108His) | Retinal dystrophy [RCV001073697]|Severe early-childhood-onset retinal dystrophy [RCV003992183]|Stargardt disease [RCV004700403]|not provided [RCV000085570] | pathogenic|likely pathogenic|not provided | 1 | 94042766 | 94042766 | Human | 4 | alternate_id |
| 8645700 | CV105109 | single nucleotide variant | NM_000350.3(ABCA4):c.3323G>T (p.Arg1108Leu) | Retinal dystrophy [RCV004815105]|Severe early-childhood-onset retinal dystrophy [RCV000408460]|not provided [RCV000085571] | pathogenic|likely pathogenic|not provided | 1 | 94042766 | 94042766 | Human | 4 | alternate_id |
| 8645704 | CV105113 | single nucleotide variant | NM_000350.3(ABCA4):c.3386G>T (p.Arg1129Leu) | ABCA4-related disorder [RCV004732670]|Age related macular degeneration 2 [RCV001199211]|Cone-rod dystrophy 3 [RCV000763045]|Cone-rod dystrophy 3 [RCV005252752]|Retinal dystrophy [RCV001075726]|Severe early-childhood-onset retinal dystrophy [RCV000408578]|not provided [RCV000085576] | pathogenic|likely pathogenic|not provided | 1 | 94041345 | 94041345 | Human | 8 | alternate_id |
| 8645719 | CV105128 | single nucleotide variant | NM_000350.3(ABCA4):c.3758C>T (p.Thr1253Met) | ABCA4-related disorder [RCV001101851]|Retinal dystrophy [RCV001075720]|Severe early-childhood-onset retinal dystrophy [RCV000408481]|not provided [RCV000085592]|not specified [RCV003317087] | likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94037200 | 94037200 | Human | 4 | alternate_id |
| 8645720 | CV105129 | single nucleotide variant | NM_000350.3(ABCA4):c.3808G>T (p.Glu1270Ter) | Retinal dystrophy [RCV004815107]|Severe early-childhood-onset retinal dystrophy [RCV000408535]|not provided [RCV000085593] | pathogenic|not provided | 1 | 94037150 | 94037150 | Human | 4 | alternate_id |
| 8645723 | CV105132 | single nucleotide variant | NM_000350.3(ABCA4):c.3862+1G>A | Severe early-childhood-onset retinal dystrophy [RCV000986360]|not provided [RCV000085596] | pathogenic|not provided | 1 | 94036739 | 94036739 | Human | 2 | alternate_id |
| 8645725 | CV105134 | single nucleotide variant | NM_000350.3(ABCA4):c.3898C>T (p.Arg1300Ter) | Retinal dystrophy [RCV001073602]|Severe early-childhood-onset retinal dystrophy [RCV001727570]|not provided [RCV000085598] | pathogenic|not provided | 1 | 94032008 | 94032008 | Human | 4 | alternate_id |
| 8645736 | CV105145 | single nucleotide variant | NM_000350.3(ABCA4):c.4195G>A (p.Glu1399Lys) | Retinal dystrophy [RCV003888473]|Severe early-childhood-onset retinal dystrophy [RCV000132591]|not provided [RCV000085609] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|no classifications from unflagged records|not provided | 1 | 94031054 | 94031054 | Human | 4 | alternate_id |
| 8645740 | CV105149 | single nucleotide variant | NM_000350.3(ABCA4):c.4222T>C (p.Trp1408Arg) | Retinal dystrophy [RCV000210333]|Severe early-childhood-onset retinal dystrophy [RCV000408501]|not provided [RCV000085613] | pathogenic|likely pathogenic|uncertain significance|other|not provided | 1 | 94031027 | 94031027 | Human | 4 | alternate_id |
| 8645743 | CV105152 | single nucleotide variant | NM_000350.3(ABCA4):c.4234C>T (p.Gln1412Ter) | Cone-rod dystrophy 3 [RCV002490742]|Retinal dystrophy [RCV001074847]|Retinitis pigmentosa [RCV003155072]|Severe early-childhood-onset retinal dystrophy [RCV000408549]|not provided [RCV000085616] | pathogenic|not provided | 1 | 94031015 | 94031015 | Human | 10 | alternate_id |
| 8645745 | CV105154 | single nucleotide variant | NM_000350.3(ABCA4):c.4253+43G>A | ABCA4-related disorder [RCV004529888]|Age related macular degeneration 2 [RCV001199365]|Cone-rod dystrophy 3 [RCV005357536]|Retinal dystrophy [RCV004815111]|Severe early-childhood-onset retinal dystrophy [RCV001290208]|not provided [RCV000085618] | likely pathogenic|benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94030953 | 94030953 | Human | 8 | alternate_id |
| 8645746 | CV105155 | single nucleotide variant | NM_000350.3(ABCA4):c.4253+4C>T | Inborn genetic diseases [RCV000624755]|Retinal dystrophy [RCV001075880]|Retinitis pigmentosa 19 [RCV005252753]|Severe early-childhood-onset retinal dystrophy [RCV004562247]|Stargardt disease [RCV005417461]|not provided [RCV000085619] | pathogenic|likely pathogenic|not provided | 1 | 94030992 | 94030992 | Human | 6 | alternate_id |
| 8645747 | CV105156 | single nucleotide variant | NM_000350.3(ABCA4):c.4253+5G>T | ABCA4-related disorder [RCV004529889]|Cone-rod dystrophy 3 [RCV005031586]|Retinal dystrophy [RCV001073983]|Severe early-childhood-onset retinal dystrophy [RCV000504676]|not provided [RCV000085620] | pathogenic|likely pathogenic|not provided | 1 | 94030991 | 94030991 | Human | 8 | alternate_id |
| 8645753 | CV105162 | single nucleotide variant | NM_000350.3(ABCA4):c.428C>T (p.Pro143Leu) | Age related macular degeneration 2 [RCV001195926]|Stargardt disease [RCV003330431]|not provided [RCV000085626] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94108591 | 94108591 | Human | 2 | alternate_id |
| 8645757 | CV105166 | single nucleotide variant | NM_000350.3(ABCA4):c.4319T>C (p.Phe1440Ser) | Severe early-childhood-onset retinal dystrophy [RCV000504867]|not provided [RCV000085630] | pathogenic|likely pathogenic|not provided | 1 | 94030461 | 94030461 | Human | 2 | alternate_id |
| 8645758 | CV105167 | single nucleotide variant | NM_000350.3(ABCA4):c.4328G>A (p.Arg1443His) | ABCA4-related disorder [RCV000779005]|Age related macular degeneration 2 [RCV002247490]|Cone-rod dystrophy 3 [RCV005025157]|Retinal dystrophy [RCV001073587]|Severe early-childhood-onset retinal dystrophy [RCV000408447]|Stargardt disease [RCV003324511]|not provid ed [RCV000085631] | pathogenic|likely pathogenic|not provided | 1 | 94030452 | 94030452 | Human | 8 | alternate_id |
| 8645762 | CV105171 | single nucleotide variant | NM_000350.3(ABCA4):c.4436G>A (p.Trp1479Ter) | Severe early-childhood-onset retinal dystrophy [RCV001808324]|Stargardt disease [RCV005055576]|not provided [RCV000085635] | pathogenic|not provided | 1 | 94029548 | 94029548 | Human | 2 | alternate_id |
| 8645763 | CV105172 | single nucleotide variant | NM_000350.3(ABCA4):c.4457C>T (p.Pro1486Leu) | ABCA4-related disorder [RCV004732671]|Age related macular degeneration 2 [RCV001198562]|Cone-rod dystrophy 3 [RCV002498456]|Retinal dystrophy [RCV001074852]|Severe early-childhood-onset retinal dystrophy [RCV000408536]|Stargardt disease [RCV001002829]|not provid ed [RCV000085636] | pathogenic|likely pathogenic|not provided | 1 | 94029527 | 94029527 | Human | 8 | alternate_id |
| 8645764 | CV105173 | single nucleotide variant | NM_000350.3(ABCA4):c.4462T>C (p.Cys1488Arg) | ABCA4-related disorder [RCV004732672]|Cone-rod dystrophy 3 [RCV000763043]|Cone-rod dystrophy 3 [RCV005234981]|Cone-rod dystrophy [RCV005417462]|Retinal dystrophy [RCV001073630]|Retinitis pigmentosa 19 [RCV001808325]|Severe early-childhood-onset retinal dystrophy [RCV000408472]|Star ht:700;'>Stargardt disease [RCV005417463]|not provided [RCV000085637] | pathogenic|likely pathogenic|not provided | 1 | 94029522 | 94029522 | Human | 11 | alternate_id |
| 8645765 | CV105174 | single nucleotide variant | NM_000350.3(ABCA4):c.4463G>A (p.Cys1488Tyr) | Retinal dystrophy [RCV004815113]|Severe early-childhood-onset retinal dystrophy [RCV000408580]|not provided [RCV000085638] | pathogenic|likely pathogenic|not provided | 1 | 94029521 | 94029521 | Human | 4 | alternate_id |
| 8645766 | CV105175 | single nucleotide variant | NM_000350.3(ABCA4):c.4463G>T (p.Cys1488Phe) | Cone-rod dystrophy 3 [RCV005025158]|Severe early-childhood-onset retinal dystrophy [RCV002225081]|not provided [RCV000085639] | pathogenic|likely pathogenic|not provided | 1 | 94029521 | 94029521 | Human | 6 | alternate_id |
| 8645768 | CV105177 | single nucleotide variant | NM_000350.3(ABCA4):c.4469G>A (p.Cys1490Tyr) | ABCA4-related disorder [RCV000779003]|Cone-rod dystrophy 3 [RCV005025159]|Macular dystrophy [RCV000787763]|Retinal dystrophy [RCV000210300]|Retinitis pigmentosa 19 [RCV001542643]|See cases [RCV004584347]|Severe early-childhood-onset retinal dystrophy [RCV000177442]|not provided [RCV000085641] | pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94029515 | 94029515 | Human | 10 | alternate_id |
| 8655064 | CV105181 | duplication | NM_000350.3(ABCA4):c.4537dup (p.Gln1513fs) | Cone-rod dystrophy 3 [RCV001004999]|Cone-rod dystrophy [RCV002267726]|Macular dystrophy [RCV000504962]|Retinal dystrophy [RCV001074410]|Retinitis pigmentosa 19 [RCV000678509]|Retinitis pigmentosa [RCV000504708]|Severe early-childhood-onset retinal dystrophy [RCV000210298]|not provided [RCV000085645] | pathogenic|likely pathogenic|not provided | 1 | 94029446 | 94029447 | Human | 12 | alternate_id |
| 8645772 | CV105182 | single nucleotide variant | NM_000350.3(ABCA4):c.4538A>G (p.Gln1513Arg) | Retinal dystrophy [RCV000505160]|Severe early-childhood-onset retinal dystrophy [RCV001376334]|not provided [RCV000085646] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94029446 | 94029446 | Human | 4 | alternate_id |
| 8645779 | CV105189 | single nucleotide variant | NM_000350.3(ABCA4):c.454C>T (p.Arg152Ter) | Cone-rod dystrophy 3 [RCV002272126]|Retinal dystrophy [RCV001075709]|Severe early-childhood-onset retinal dystrophy [RCV000408527]|not provided [RCV000085653] | pathogenic|likely pathogenic|not provided | 1 | 94103131 | 94103131 | Human | 5 | alternate_id |
| 8645780 | CV105190 | single nucleotide variant | NM_000350.3(ABCA4):c.455G>A (p.Arg152Gln) | ABCA4-related disorder [RCV001100156]|Retinal dystrophy [RCV004815114]|Severe early-childhood-onset retinal dystrophy [RCV000408574]|Stargardt disease [RCV000844929]|not provided [RCV000085654]|not specified [RCV000402682] | likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94103130 | 94103130 | Human | 4 | alternate_id |
| 8645782 | CV105192 | single nucleotide variant | NM_000350.3(ABCA4):c.4577C>T (p.Thr1526Met) | Age related macular degeneration 2 [RCV001542561]|Cone-rod dystrophy 3 [RCV005025160]|Inborn genetic diseases [RCV000623715]|Retinal dystrophy [RCV001075849]|Retinitis pigmentosa 19 [RCV000210286]|Severe early-childhood-onset retinal dystrophy [RCV000177509]|Star >gardt disease [RCV001002827]|not provided [RCV000085656] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94025011 | 94025011 | Human | 9 | alternate_id |
| 8645783 | CV105193 | single nucleotide variant | NM_000350.3(ABCA4):c.4594G>A (p.Asp1532Asn) | ABCA4-related disorder [RCV004529890]|Cone-rod dystrophy 3 [RCV001535669]|Cone-rod dystrophy 3 [RCV005025161]|Retinal dystrophy [RCV001074286]|Retinitis pigmentosa [RCV003235039]|Severe early-childhood-onset retinal dystrophy [RCV000177510]|maculopathy [RCV001002826]|not provided [RCV000085657] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94024994 | 94024994 | Human | 12 | alternate_id |
| 8645784 | CV105194 | single nucleotide variant | NM_000350.3(ABCA4):c.45G>A (p.Trp15Ter) | Retinal dystrophy [RCV001075348]|Severe early-childhood-onset retinal dystrophy [RCV000408591]|not provided [RCV000085658] | pathogenic|not provided | 1 | 94121001 | 94121001 | Human | 4 | alternate_id |
| 8645785 | CV105195 | single nucleotide variant | NM_000350.3(ABCA4):c.4610C>T (p.Thr1537Met) | Cone-rod dystrophy 3 [RCV005025162]|Retinal dystrophy [RCV004815115]|Severe early-childhood-onset retinal dystrophy [RCV000408504]|not provided [RCV000085659]|not specified [RCV001002608] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94024978 | 94024978 | Human | 8 | alternate_id |
| 8645789 | CV105199 | single nucleotide variant | NM_000350.3(ABCA4):c.466A>G (p.Ile156Val) | ABCA4-related disorder [RCV001100155]|Abnormal retinal morphology [RCV000626667]|Cone-rod dystrophy 3 [RCV000764207]|Inborn genetic diseases [RCV000622993]|Retinal dystrophy [RCV004815116]|Severe early-childhood-onset retinal dystrophy [RCV000504910]|not provided [RCV000085663] | likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94103119 | 94103119 | Human | 10 | alternate_id |
| 8645795 | CV105205 | single nucleotide variant | NM_000350.3(ABCA4):c.4748T>C (p.Leu1583Pro) | Severe early-childhood-onset retinal dystrophy [RCV001376269]|not provided [RCV000085669] | pathogenic|likely pathogenic|not provided | 1 | 94021871 | 94021871 | Human | 2 | alternate_id |
| 8645798 | CV105208 | single nucleotide variant | NM_000350.3(ABCA4):c.4773+48C>T | Age related macular degeneration 2 [RCV001549174]|Cone-rod dystrophy 3 [RCV001549173]|Retinitis pigmentosa 19 [RCV001549172]|Severe early-childhood-onset retinal dystrophy [RCV001549171]|not provided [RCV000085672]|not specified [RCV000244871] | benign|not provided | 1 | 94021798 | 94021798 | Human | 6 | alternate_id |
| 8645800 | CV105210 | single nucleotide variant | NM_000350.3(ABCA4):c.4793C>A (p.Ala1598Asp) | ABCA4-related disorder [RCV004732673]|Autosomal recessive retinitis pigmentosa [RCV001257846]|Cone-rod dystrophy 3 [RCV005025163]|Cone-rod dystrophy [RCV005417464]|Retinal dystrophy [RCV001074177]|Retinitis pigmentosa 19 [RCV001808326]|Retinitis pigmentosa [RCV003387758]|Severe early-childhood-onset retinal dystrophy [RCV000408465]|Stargardt disease [RCV001002825]|not provided [RCV000085674] | pathogenic|likely pathogenic|not provided | 1 | 94021695 | 94021695 | Human | 12 | alternate_id |
| 8645801 | CV105211 | single nucleotide variant | NM_000350.3(ABCA4):c.481G>A (p.Glu161Lys) | Retinal dystrophy [RCV004815117]|Severe early-childhood-onset retinal dystrophy [RCV004595918]|not provided [RCV000085675] | likely pathogenic|uncertain significance|not provided | 1 | 94103104 | 94103104 | Human | 4 | alternate_id |
| 8645802 | CV105212 | deletion | NM_000350.3(ABCA4):c.4838del (p.Asp1613fs) | Retinal dystrophy [RCV001074975]|Severe early-childhood-onset retinal dystrophy [RCV000999644]|not provided [RCV000085676] | pathogenic|likely pathogenic|not provided | 1 | 94021650 | 94021650 | Human | 4 | alternate_id |
| 8645809 | CV105219 | single nucleotide variant | NM_000350.3(ABCA4):c.4918C>T (p.Arg1640Trp) | ABCA4-related disorder [RCV004732674]|Cone-rod dystrophy 3 [RCV002505017]|Cone-rod dystrophy 3 [RCV004760372]|Leber congenital amaurosis [RCV000505114]|Retinal dystrophy [RCV000210311]|Severe early-childhood-onset retinal dystrophy [RCV000408519]|Stargardt disea se [RCV000787504]|not provided [RCV000085683] | pathogenic|likely pathogenic|uncertain significance|other|not provided | 1 | 94021340 | 94021340 | Human | 9 | alternate_id |
| 8645810 | CV105220 | single nucleotide variant | NM_000350.3(ABCA4):c.4919G>A (p.Arg1640Gln) | Cone-rod dystrophy 3 [RCV003223338]|Cone-rod dystrophy 3 [RCV005031587]|Retinal dystrophy [RCV000504816]|Severe early-childhood-onset retinal dystrophy [RCV000321118]|Stargardt disease [RCV000787505]|not provided [RCV000085684] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94021339 | 94021339 | Human | 8 | alternate_id |
| 8645811 | CV105221 | single nucleotide variant | NM_000350.3(ABCA4):c.4926C>G (p.Ser1642Arg) | Cone-rod dystrophy 3 [RCV005025164]|Retinal dystrophy [RCV001075879]|Retinitis pigmentosa [RCV000787506]|Severe early-childhood-onset retinal dystrophy [RCV000986355]|not provided [RCV000085685] | likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94021332 | 94021332 | Human | 10 | alternate_id |
| 8645817 | CV105227 | single nucleotide variant | NM_000350.3(ABCA4):c.5018+2T>C | Retinal dystrophy [RCV001074630]|Severe early-childhood-onset retinal dystrophy [RCV000408523]|not provided [RCV000085691] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94021238 | 94021238 | Human | 4 | alternate_id |
| 8645819 | CV105229 | deletion | NM_000350.3(ABCA4):c.5044_5058del (p.Val1682_Val1686del) | Cone-rod dystrophy 3 [RCV002498457]|Cone-rod dystrophy [RCV003324512]|Retinal dystrophy [RCV001073680]|Severe early-childhood-onset retinal dystrophy [RCV000986352]|Stargardt disease [RCV003324513]|not provided [RCV000085693] | pathogenic|not provided | 1 | 94019720 | 94019734 | Human | 11 | alternate_id |
| 8645820 | CV105230 | single nucleotide variant | NM_000350.3(ABCA4):c.5056G>A (p.Val1686Met) | ABCA4-related disorder [RCV001099771]|Cone-rod dystrophy 3 [RCV005025165]|Retinal dystrophy [RCV001073381]|Severe early-childhood-onset retinal dystrophy [RCV000986353]|not provided [RCV000085694] | pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94019722 | 94019722 | Human | 8 | alternate_id |
| 8645821 | CV105231 | single nucleotide variant | NM_000350.3(ABCA4):c.5065T>C (p.Ser1689Pro) | Retinal dystrophy [RCV004815119]|Severe early-childhood-onset retinal dystrophy [RCV000408570]|not provided [RCV000085695] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94019713 | 94019713 | Human | 4 | alternate_id |
| 8645822 | CV105232 | single nucleotide variant | NM_000350.3(ABCA4):c.5077G>A (p.Val1693Ile) | ABCA4-related disorder [RCV004528785]|Retinal dystrophy [RCV001073371]|Severe early-childhood-onset retinal dystrophy [RCV002255285]|Stargardt disease [RCV002470765]|not provided [RCV000085696] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94019701 | 94019701 | Human | 4 | alternate_id |
| 8645823 | CV105233 | single nucleotide variant | NM_000350.3(ABCA4):c.5087G>A (p.Ser1696Asn) | Cone-rod dystrophy 3 [RCV002490743]|Retinal dystrophy [RCV004815120]|Severe early-childhood-onset retinal dystrophy [RCV000408469]|not provided [RCV000085697] | pathogenic|likely pathogenic|not provided | 1 | 94019691 | 94019691 | Human | 8 | alternate_id |
| 8645825 | CV105235 | single nucleotide variant | NM_000350.3(ABCA4):c.5114G>T (p.Arg1705Leu) | Retinal dystrophy [RCV004815121]|Severe early-childhood-onset retinal dystrophy [RCV000408542]|not provided [RCV000085699] | likely pathogenic|not provided | 1 | 94019664 | 94019664 | Human | 4 | alternate_id |
| 8645826 | CV105236 | single nucleotide variant | NM_000350.3(ABCA4):c.514G>A (p.Gly172Ser) | Age related macular degeneration 2 [RCV001196794]|Cone-rod dystrophy 3 [RCV005031588]|Cone-rod dystrophy 3 [RCV005364981]|Retinal dystrophy [RCV001073775]|Severe early-childhood-onset retinal dystrophy [RCV001353027]|Stargardt disease [RCV001449733]|not provided [RCV000085700] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94103071 | 94103071 | Human | 8 | alternate_id |
| 8645828 | CV105238 | deletion | NM_000350.3(ABCA4):c.5161_5162del (p.Thr1721fs) | Retinal dystrophy [RCV001073781]|Severe early-childhood-onset retinal dystrophy [RCV000301420]|not provided [RCV000085702] | pathogenic|not provided | 1 | 94019616 | 94019617 | Human | 4 | alternate_id |
| 8645829 | CV105239 | single nucleotide variant | NM_000350.3(ABCA4):c.5186T>C (p.Leu1729Pro) | Cone-rod dystrophy 3 [RCV005031589]|Retinal dystrophy [RCV001074107]|Retinitis pigmentosa [RCV004689457]|not provided [RCV000085703] | pathogenic|uncertain significance|not provided | 1 | 94019592 | 94019592 | Human | 5 | alternate_id |
| 8645830 | CV105240 | single nucleotide variant | NM_000350.3(ABCA4):c.5196+1G>A | Age related macular degeneration 2 [RCV001197154]|Retinal dystrophy [RCV001074902]|Severe early-childhood-onset retinal dystrophy [RCV000408528]|maculopathy [RCV001002818]|not provided [RCV000085704] | pathogenic|not provided | 1 | 94019581 | 94019581 | Human | 6 | alternate_id |
| 8645834 | CV105244 | single nucleotide variant | NM_000350.3(ABCA4):c.5196+2T>C | Retinal dystrophy [RCV001073647]|Severe early-childhood-onset retinal dystrophy [RCV000408592]|not provided [RCV000085708] | pathogenic|likely pathogenic|not provided | 1 | 94019580 | 94019580 | Human | 4 | alternate_id |
| 8645846 | CV105256 | single nucleotide variant | NM_000350.3(ABCA4):c.5316G>A (p.Trp1772Ter) | ABCA4-related disorder [RCV004529892]|Retinal dystrophy [RCV001074187]|Retinitis pigmentosa [RCV001723668]|Severe early-childhood-onset retinal dystrophy [RCV001352958]|Stargardt disease [RCV000787509]|not provided [RCV000085721] | pathogenic|likely pathogenic|not provided | 1 | 94014687 | 94014687 | Human | 6 | alternate_id |
| 8645850 | CV105260 | single nucleotide variant | NM_000350.3(ABCA4):c.5381C>A (p.Ala1794Asp) | Retinal dystrophy [RCV000504739]|Retinitis pigmentosa [RCV004767070]|Severe early-childhood-onset retinal dystrophy [RCV000677343]|not provided [RCV000085725] | pathogenic|likely pathogenic|not provided | 1 | 94014622 | 94014622 | Human | 6 | alternate_id |
| 8645852 | CV105262 | single nucleotide variant | NM_000350.3(ABCA4):c.5413A>G (p.Asn1805Asp) | Age related macular degeneration 2 [RCV001199290]|Retinal dystrophy [RCV001074166]|Retinitis pigmentosa [RCV004767071]|Severe early-childhood-onset retinal dystrophy [RCV001352967]|not provided [RCV000085727] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94014590 | 94014590 | Human | 8 | alternate_id |
| 8645854 | CV105264 | single nucleotide variant | NM_000350.3(ABCA4):c.5460+1G>A | Autosomal recessive retinitis pigmentosa [RCV001257848]|Retinal dystrophy [RCV004815123]|Retinitis pigmentosa [RCV000791319]|Stargardt disease [RCV001002813]|not provided [RCV000085729] | pathogenic|not provided | 1 | 94014542 | 94014542 | Human | 5 | alternate_id |
| 8645859 | CV105269 | single nucleotide variant | NM_000350.3(ABCA4):c.5512C>G (p.His1838Asp) | Retinal dystrophy [RCV004798774]|Severe early-childhood-onset retinal dystrophy [RCV000408577]|not provided [RCV000085734] | pathogenic|likely pathogenic|not provided | 1 | 94011334 | 94011334 | Human | 4 | alternate_id |
| 8645861 | CV105271 | single nucleotide variant | NM_000350.3(ABCA4):c.5527C>T (p.Arg1843Trp) | Retinal dystrophy [RCV004815124]|Severe early-childhood-onset retinal dystrophy [RCV004562248]|Stargardt disease [RCV005406820]|not provided [RCV000085736] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94011319 | 94011319 | Human | 4 | alternate_id |
| 8645862 | CV105272 | single nucleotide variant | NM_000350.3(ABCA4):c.5537T>C (p.Ile1846Thr) | Cone-rod dystrophy 3 [RCV003152681]|Cone-rod dystrophy 3 [RCV005025166]|Stargardt disease [RCV004689603]|not provided [RCV000085737] | pathogenic|likely pathogenic|not provided | 1 | 94011309 | 94011309 | Human | 2 | alternate_id |
| 8645864 | CV105274 | single nucleotide variant | NM_000350.3(ABCA4):c.5584+6T>C | Retinal dystrophy [RCV004815125]|Severe early-childhood-onset retinal dystrophy [RCV000678512]|Stargardt disease [RCV000787512]|not provided [RCV000085739] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94011256 | 94011256 | Human | 4 | alternate_id |
| 8645868 | CV105278 | single nucleotide variant | NM_000350.3(ABCA4):c.5585-70C>T | Age related macular degeneration 2 [RCV001549166]|Cone-rod dystrophy 3 [RCV001549165]|Retinitis pigmentosa 19 [RCV001549149]|Severe early-childhood-onset retinal dystrophy [RCV001549148]|not provided [RCV000085743] | benign|not provided | 1 | 94010999 | 94010999 | Human | 6 | alternate_id |
| 8645875 | CV105285 | single nucleotide variant | NM_000350.3(ABCA4):c.5682G>C (p.Leu1894=) | ABCA4-related disorder [RCV001096233]|Age related macular degeneration 2 [RCV001549147]|Cone-Rod Dystrophy, Recessive [RCV000318478]|Cone-rod dystrophy 3 [RCV001549146]|Macular degeneration [RCV000376557]|Retinal dystrophy [RCV003888477]|Retinitis Pigmentosa, Recessive [RCV000321911]|Retinitis pigme ntosa 19 [RCV001549145]|Severe early-childhood-onset retinal dystrophy [RCV001549144]|Stargardt Disease, Recessive [RCV000263057]|not provided [RCV000085750]|not specified [RCV000178425] | benign|likely benign|not provided | 1 | 94010832 | 94010832 | Human | 12 | alternate_id |
| 8645877 | CV105287 | single nucleotide variant | NM_000350.3(ABCA4):c.5693G>A (p.Arg1898His) | ABCA4-related disorder [RCV000778998]|Age related macular degeneration 2 [RCV001196150]|Cone-rod dystrophy 3 [RCV002470766]|Inborn genetic diseases [RCV000623966]|Retinal dystrophy [RCV001075015]|Retinitis pigmentosa [RCV000787764]|Severe early-childhood-onset retinal dystrophy [RCV000408593]|Star style='font-weight:700;'>Stargardt disease [RCV000787513]|not provided [RCV000085752] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94010821 | 94010821 | Human | 10 | alternate_id |
| 8645881 | CV105291 | single nucleotide variant | NM_000350.3(ABCA4):c.571-2A>G | Severe early-childhood-onset retinal dystrophy [RCV000008354]|not provided [RCV000085756] | pathogenic|not provided | 1 | 94098993 | 94098993 | Human | 2 | alternate_id |
| 8645883 | CV105293 | single nucleotide variant | NM_000350.3(ABCA4):c.5715-25A>C | Age related macular degeneration 2 [RCV001549143]|Cone-rod dystrophy 3 [RCV001549142]|Retinitis pigmentosa 19 [RCV001549141]|Severe early-childhood-onset retinal dystrophy [RCV001549140]|not provided [RCV000085758]|not specified [RCV000242093] | benign|not provided | 1 | 94008896 | 94008896 | Human | 6 | alternate_id |
| 8645885 | CV105295 | single nucleotide variant | NM_000350.3(ABCA4):c.5761G>A (p.Val1921Met) | Severe early-childhood-onset retinal dystrophy [RCV005234983]|not provided [RCV000085760] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94008825 | 94008825 | Human | 2 | alternate_id |
| 8645886 | CV105296 | single nucleotide variant | NM_000350.3(ABCA4):c.5814A>G (p.Leu1938=) | ABCA4-related disorder [RCV001096230]|Age related macular degeneration 2 [RCV001549139]|Cone-Rod Dystrophy, Recessive [RCV000364498]|Cone-rod dystrophy 3 [RCV001549138]|Macular degeneration [RCV000349633]|Retinal dystrophy [RCV003888478]|Retinitis Pigmentosa, Recessive [RCV000309928]|Retinitis pigme ntosa 19 [RCV001549137]|Severe early-childhood-onset retinal dystrophy [RCV001549136]|Stargardt Disease, Recessive [RCV000402778]|not provided [RCV000085761]|not specified [RCV000211879] | benign|likely benign|not provided | 1 | 94008772 | 94008772 | Human | 12 | alternate_id |
| 8645887 | CV105297 | single nucleotide variant | NM_000350.3(ABCA4):c.5836-11G>A | ABCA4-related disorder [RCV001096229]|Age related macular degeneration 2 [RCV001548899]|Cone-Rod Dystrophy, Recessive [RCV000313494]|Cone-rod dystrophy 3 [RCV001548898]|Macular degeneration [RCV000336246]|Retinitis Pigmentosa, Recessive [RCV000407106]|Retinitis pigmentosa 19 [RCV001548897]|Severe ea rly-childhood-onset retinal dystrophy [RCV001548896]|Stargardt Disease, Recessive [RCV000281163]|not provided [RCV000085763]|not specified [RCV000152715] | benign|likely benign|not provided | 1 | 94008308 | 94008308 | Human | 10 | alternate_id |
| 8645892 | CV105302 | single nucleotide variant | NM_000350.3(ABCA4):c.5843C>T (p.Pro1948Leu) | ABCA4-related disorder [RCV001096228]|Age related macular degeneration 2 [RCV001195781]|Cone-Rod Dystrophy, Recessive [RCV000379050]|Macular degeneration [RCV000284620]|Retinal dystrophy [RCV003888479]|Retinitis Pigmentosa, Recessive [RCV000375640]|Severe early-childhood-onset retinal dystrophy [RCV 004562249]|Stargardt Disease, Recessive [RCV000339604]|not provided [RCV000085768]|not specified [RCV000211880] | benign|likely benign|uncertain significance|not provided | 1 | 94008290 | 94008290 | Human | 10 | alternate_id |
| 8645898 | CV105308 | deletion | NM_000350.3(ABCA4):c.5917del (p.Gly1972_Val1973insTer) | ABCA4-related disorder [RCV003985075]|Age related macular degeneration 2 [RCV000678514]|Autosomal recessive retinitis pigmentosa [RCV001257850]|Retinal dystrophy [RCV000504777]|Retinitis pigmentosa 19 [RCV001542556]|See cases [RCV004584348]|Severe early-childhood-onset retinal dystrophy [RCV00040856 1]|maculopathy [RCV001002810]|not provided [RCV000085776] | pathogenic|not provided | 1 | 94007722 | 94007722 | Human | 8 | alternate_id |
| 8645900 | CV105310 | single nucleotide variant | NM_000350.3(ABCA4):c.5929G>A (p.Gly1977Ser) | Retinal dystrophy [RCV001075771]|Retinitis pigmentosa [RCV001002809]|Severe early-childhood-onset retinal dystrophy [RCV005234984]|Stargardt disease [RCV005055577]|not provided [RCV000085778] | pathogenic|likely pathogenic|not provided | 1 | 94007710 | 94007710 | Human | 6 | alternate_id |
| 8645901 | CV105311 | single nucleotide variant | NM_000350.3(ABCA4):c.5936C>T (p.Thr1979Ile) | Retinal dystrophy [RCV004815129]|Severe early-childhood-onset retinal dystrophy [RCV000408461]|not provided [RCV000085779] | pathogenic|likely pathogenic|not provided | 1 | 94007703 | 94007703 | Human | 4 | alternate_id |
| 8645905 | CV105315 | single nucleotide variant | NM_000350.3(ABCA4):c.6006-16G>A | Age related macular degeneration 2 [RCV001548891]|Cone-rod dystrophy 3 [RCV001548890]|Retinitis pigmentosa 19 [RCV001548889]|Severe early-childhood-onset retinal dystrophy [RCV001548888]|not provided [RCV000085783]|not specified [RCV000211881] | benign|not provided | 1 | 94005598 | 94005598 | Human | 6 | alternate_id |
| 8645907 | CV105317 | single nucleotide variant | NM_000350.3(ABCA4):c.6089G>A (p.Arg2030Gln) | ABCA4-related disorder [RCV004529893]|Age related macular degeneration 2 [RCV001197157]|Cone-rod dystrophy 3 [RCV000763436]|Macular dystrophy [RCV000787517]|Progressive cone dystrophy (without rod involvement) [RCV000787766]|Retinal dystrophy [RCV001074874]|Severe early-childhood-onset retinal dystr ophy [RCV000178545]|Vitreoretinopathy [RCV000787516]|not provided [RCV000085787] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94005499 | 94005499 | Human | 11 | alternate_id |
| 8645908 | CV105318 | single nucleotide variant | NM_000350.3(ABCA4):c.6104T>C (p.Leu2035Pro) | Stargardt disease [RCV003324514]|not provided [RCV000085788] | likely pathogenic|uncertain significance|not provided | 1 | 94005484 | 94005484 | Human | 1 | alternate_id |
| 8645909 | CV105319 | single nucleotide variant | NM_000350.3(ABCA4):c.6112C>T (p.Arg2038Trp) | Retinal dystrophy [RCV001073850]|Severe early-childhood-onset retinal dystrophy [RCV000408458]|not provided [RCV000085789] | pathogenic|not provided | 1 | 94005476 | 94005476 | Human | 4 | alternate_id |
| 8645910 | CV105320 | single nucleotide variant | NM_000350.3(ABCA4):c.6118C>T (p.Arg2040Ter) | ABCA4-related disorder [RCV004732675]|Cone-rod dystrophy 3 [RCV000763435]|Retinal dystrophy [RCV001073783]|Severe early-childhood-onset retinal dystrophy [RCV002283455]|Stargardt disease [RCV000787772]|not provided [RCV000085790] | pathogenic|likely pathogenic|not provided | 1 | 94005470 | 94005470 | Human | 8 | alternate_id |
| 8645912 | CV105322 | single nucleotide variant | NM_000350.3(ABCA4):c.6179T>G (p.Leu2060Arg) | Cone-rod dystrophy 3 [RCV002490744]|not provided [RCV000085792] | pathogenic|not provided | 1 | 94001961 | 94001961 | Human | 1 | alternate_id |
| 8645913 | CV105323 | single nucleotide variant | NM_000350.3(ABCA4):c.618C>G (p.Ser206Arg) | ABCA4-related disorder [RCV001098370]|Cone-rod dystrophy 3 [RCV005357539]|Retinal dystrophy [RCV001074695]|Severe early-childhood-onset retinal dystrophy [RCV000986375]|not provided [RCV000085793]|not specified [RCV000391995] | likely pathogenic|benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94098944 | 94098944 | Human | 6 | alternate_id |
| 8645917 | CV105327 | single nucleotide variant | NM_000350.3(ABCA4):c.6229C>T (p.Arg2077Trp) | Age related macular degeneration 2 [RCV001770079]|Cone-rod dystrophy 3 [RCV001004998]|Cone-rod dystrophy 3 [RCV005357540]|Retinal dystrophy [RCV000504630]|Stargardt disease [RCV000787519]|not provided [RCV000085797] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94001911 | 94001911 | Human | 5 | alternate_id |
| 8645918 | CV105328 | microsatellite | NM_000350.3(ABCA4):c.6238_6239del (p.Ser2080fs) | Retinal dystrophy [RCV001073616]|Severe early-childhood-onset retinal dystrophy [RCV000986345]|not provided [RCV000085798] | pathogenic|likely pathogenic|not provided | 1 | 94001901 | 94001902 | Human | | alternate_id |
| 8645919 | CV105329 | single nucleotide variant | NM_000350.3(ABCA4):c.6249C>T (p.Ile2083=) | ABCA4-related disorder [RCV001101662]|Cone-Rod Dystrophy, Recessive [RCV000383722]|Cone-rod dystrophy 3 [RCV002498459]|Macular degeneration [RCV000289405]|Retinal dystrophy [RCV003888480]|Retinitis Pigmentosa, Recessive [RCV000344433]|Stargardt Disease, Recessiv e [RCV000329139]|not provided [RCV000085799]|not specified [RCV000178562] | benign|likely benign|not provided | 1 | 94001891 | 94001891 | Human | 12 | alternate_id |
| 8645922 | CV105332 | single nucleotide variant | NM_000350.3(ABCA4):c.6282+7G>A | ABCA4-related disorder [RCV001101660]|Cone-Rod Dystrophy, Recessive [RCV000357799]|Cone-rod dystrophy 3 [RCV002490745]|Macular degeneration [RCV000263289]|Retinitis Pigmentosa, Recessive [RCV000318414]|Stargardt Disease, Recessive [RCV000354509]|not provided [RC V000085802]|not specified [RCV000178563] | benign|likely benign|conflicting interpretations of pathogenicity|conflicting data from submitters|not provided | 1 | 94001851 | 94001851 | Human | 10 | alternate_id |
| 8645924 | CV105334 | single nucleotide variant | NM_000350.3(ABCA4):c.6286G>A (p.Glu2096Lys) | Stargardt disease [RCV004800285]|not provided [RCV000085804] | pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94001102 | 94001102 | Human | 1 | alternate_id |
| 8645926 | CV105336 | single nucleotide variant | NM_000350.3(ABCA4):c.6316C>T (p.Arg2106Cys) | ABCA4-related retinopathy [RCV005357541]|Age related macular degeneration 2 [RCV004783742]|Retinal dystrophy [RCV001075529]|Retinitis pigmentosa [RCV005417958]|Severe early-childhood-onset retinal dystrophy [RCV000408484]|Stargardt disease [RCV004017397]|not pro vided [RCV000085806] | pathogenic|likely pathogenic|not provided | 1 | 94001072 | 94001072 | Human | 8 | alternate_id |
| 8645927 | CV105337 | single nucleotide variant | NM_000350.3(ABCA4):c.6320G>A (p.Arg2107His) | ABCA4-related disorder [RCV004528786]|Cone-rod dystrophy 3 [RCV005025167]|Macular dystrophy [RCV000505080]|Optic atrophy [RCV004815130]|Retinal dystrophy [RCV001074412]|Retinitis pigmentosa 19 [RCV005252116]|Severe early-childhood-onset retinal dystrophy [RCV000408534]|Star >Stargardt disease [RCV004017398]|not provided [RCV000085807] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94001068 | 94001068 | Human | 12 | alternate_id |
| 8645929 | CV105339 | single nucleotide variant | NM_000350.3(ABCA4):c.6329G>A (p.Trp2110Ter) | Retinal dystrophy [RCV004815131]|Severe early-childhood-onset retinal dystrophy [RCV000504640]|not provided [RCV000085809] | pathogenic|not provided | 1 | 94001059 | 94001059 | Human | 4 | alternate_id |
| 8645930 | CV105340 | single nucleotide variant | NM_000350.3(ABCA4):c.6339C>G (p.Ile2113Met) | Severe early-childhood-onset retinal dystrophy [RCV004562250]|not provided [RCV000085810] | likely pathogenic|not provided | 1 | 94001049 | 94001049 | Human | 2 | alternate_id |
| 8645931 | CV105341 | single nucleotide variant | NM_000350.3(ABCA4):c.6342G>A (p.Val2114=) | ABCA4-related disorder [RCV004529894]|Cone-rod dystrophy 3 [RCV002490746]|Retinal dystrophy [RCV001073884]|Severe early-childhood-onset retinal dystrophy [RCV000318700]|not provided [RCV000085811] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94001046 | 94001046 | Human | 8 | alternate_id |
| 8645934 | CV105344 | single nucleotide variant | NM_000350.3(ABCA4):c.6383A>G (p.His2128Arg) | Severe early-childhood-onset retinal dystrophy [RCV004562251]|not provided [RCV000085815] | pathogenic|uncertain significance|not provided | 1 | 94001005 | 94001005 | Human | 2 | alternate_id |
| 8645935 | CV105345 | single nucleotide variant | NM_000350.3(ABCA4):c.6386+2C>G | Retinal dystrophy [RCV004815132]|Retinitis pigmentosa 19 [RCV003225930]|Severe early-childhood-onset retinal dystrophy [RCV000408502]|not provided [RCV000085816] | pathogenic|likely pathogenic|not provided | 1 | 94001000 | 94001000 | Human | 5 | alternate_id |
| 8645936 | CV105346 | single nucleotide variant | NM_000350.3(ABCA4):c.6391G>A (p.Glu2131Lys) | Cone-rod dystrophy 3 [RCV005031590]|Retinal dystrophy [RCV001074273]|Stargardt disease [RCV004526616]|not provided [RCV000085817] | pathogenic|likely pathogenic|not provided | 1 | 94000924 | 94000924 | Human | 4 | alternate_id |
| 8645937 | CV105347 | single nucleotide variant | NM_000350.3(ABCA4):c.6415C>T (p.Arg2139Trp) | ABCA4-related disorder [RCV004732676]|Retinal dystrophy [RCV004815133]|Retinitis pigmentosa [RCV005237531]|Severe early-childhood-onset retinal dystrophy [RCV005222752]|not provided [RCV000085818] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94000900 | 94000900 | Human | 6 | alternate_id |
| 8645939 | CV105349 | single nucleotide variant | NM_000350.3(ABCA4):c.6445C>T (p.Arg2149Ter) | ABCA4-related disorder [RCV004724804]|Retinal dystrophy [RCV000505094]|Retinitis pigmentosa 19 [RCV004720238]|Severe early-childhood-onset retinal dystrophy [RCV000132593]|Visual loss [RCV000414922]|not provided [RCV000085820] | pathogenic|likely pathogenic|not provided | 1 | 94000870 | 94000870 | Human | 10 | alternate_id |
| 8645942 | CV105352 | single nucleotide variant | NM_000350.3(ABCA4):c.6449G>A (p.Cys2150Tyr) | Retinal dystrophy [RCV001074378]|Severe early-childhood-onset retinal dystrophy [RCV000408531]|not provided [RCV000085823] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94000866 | 94000866 | Human | 4 | alternate_id |
| 8645947 | CV105357 | single nucleotide variant | NM_000350.3(ABCA4):c.6563T>C (p.Phe2188Ser) | Cone-rod dystrophy 3 [RCV005025168]|Stargardt disease [RCV001002806]|not provided [RCV000085829] | pathogenic|not provided | 1 | 93998027 | 93998027 | Human | 2 | alternate_id |
| 8645950 | CV105360 | single nucleotide variant | NM_000350.3(ABCA4):c.658C>T (p.Arg220Cys) | Cone-rod dystrophy 3 [RCV002498460]|Retinal dystrophy [RCV000504919]|Severe early-childhood-onset retinal dystrophy [RCV002470767]|not provided [RCV000085832] | pathogenic|likely pathogenic|not provided | 1 | 94098904 | 94098904 | Human | 8 | alternate_id |
| 8645952 | CV105362 | single nucleotide variant | NM_000350.3(ABCA4):c.6609C>A (p.Tyr2203Ter) | Retinal dystrophy [RCV003888484]|Severe early-childhood-onset retinal dystrophy [RCV000408488]|not provided [RCV000085834] | pathogenic|not provided | 1 | 93997981 | 93997981 | Human | 4 | alternate_id |
| 8645955 | CV105365 | single nucleotide variant | NM_000350.3(ABCA4):c.6658C>T (p.Gln2220Ter) | ABCA4-related disorder [RCV004529895]|Cone dystrophy [RCV000504742]|Retinal dystrophy [RCV004794359]|Retinitis pigmentosa 19 [RCV001352970]|Severe early-childhood-onset retinal dystrophy [RCV000408450]|not provided [RCV000085837] | pathogenic|likely pathogenic|not provided | 1 | 93997932 | 93997932 | Human | 7 | alternate_id |
| 8645957 | CV105367 | deletion | NM_000350.3(ABCA4):c.666_678del (p.Lys223fs) | Cone-rod dystrophy 3 [RCV005025169]|Retinal dystrophy [RCV001075620]|Retinitis pigmentosa 19 [RCV002513926]|Severe early-childhood-onset retinal dystrophy [RCV001723670]|not provided [RCV000085839] | pathogenic|not provided | 1 | 94098884 | 94098896 | Human | 8 | alternate_id |
| 8645960 | CV105370 | single nucleotide variant | NM_000350.3(ABCA4):c.6686T>C (p.Leu2229Pro) | Retinal dystrophy [RCV001075761]|Retinitis pigmentosa [RCV005417959]|Severe early-childhood-onset retinal dystrophy [RCV004562252]|not provided [RCV000085842] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 93997904 | 93997904 | Human | 6 | alternate_id |
| 8645965 | CV105376 | single nucleotide variant | NM_000350.3(ABCA4):c.6721C>G (p.Leu2241Val) | Retinal dystrophy [RCV001075235]|Severe early-childhood-onset retinal dystrophy [RCV004786366]|Stargardt disease [RCV003324515]|not provided [RCV000085848] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 93997869 | 93997869 | Human | 4 | alternate_id |
| 8645969 | CV105380 | single nucleotide variant | NM_000350.3(ABCA4):c.6730-3T>C | ABCA4-related disorder [RCV001099673]|Cone-Rod Dystrophy, Recessive [RCV000308440]|Cone-rod dystrophy 3 [RCV002490747]|Macular degeneration [RCV000366472]|Retinitis Pigmentosa, Recessive [RCV000272093]|Stargardt Disease, Recessive [RCV000311783]|not provided [RC V000085852]|not specified [RCV000178684] | benign|not provided | 1 | 93996198 | 93996198 | Human | 10 | alternate_id |
| 8645972 | CV105383 | single nucleotide variant | NM_000350.3(ABCA4):c.6764G>T (p.Ser2255Ile) | ABCA4-related disorder [RCV001097882]|Cone-Rod Dystrophy, Recessive [RCV000376116]|Cone-rod dystrophy 3 [RCV002505018]|Macular degeneration [RCV000281600]|Retinal dystrophy [RCV003888485]|Retinitis Pigmentosa, Recessive [RCV000336644]|Stargardt Disease, Recessiv e [RCV000340209]|not provided [RCV000085855]|not specified [RCV000178683] | benign|likely benign|conflicting interpretations of pathogenicity|conflicting data from submitters|not provided | 1 | 93996161 | 93996161 | Human | 12 | alternate_id |
| 8645975 | CV105386 | single nucleotide variant | NM_000350.3(ABCA4):c.70C>T (p.Arg24Cys) | Cone-rod dystrophy 3 [RCV005031591]|not provided [RCV000085858] | pathogenic|likely pathogenic|uncertain significance|not provided | 1 | 94113063 | 94113063 | Human | 1 | alternate_id |
| 8645976 | CV105387 | single nucleotide variant | NM_000350.3(ABCA4):c.71G>A (p.Arg24His) | ABCA4-related disorder [RCV000779009]|Cone-rod dystrophy 3 [RCV004796010]|Retinal dystrophy [RCV001074842]|Retinitis pigmentosa 19 [RCV005252754]|Severe early-childhood-onset retinal dystrophy [RCV005234985]|not provided [RCV000085859] | pathogenic|likely pathogenic|likely benign|uncertain significance|not provided | 1 | 94113062 | 94113062 | Human | 8 | alternate_id |
| 8645983 | CV105394 | single nucleotide variant | NM_000350.3(ABCA4):c.768G>T (p.Val256=) | ABCA4-related disorder [RCV004529896]|Cone-rod dystrophy 3 [RCV000763049]|Cone-rod dystrophy 3 [RCV003224863]|Macular dystrophy [RCV000787525]|Retinal dystrophy [RCV001074394]|Retinitis pigmentosa 19 [RCV000678516]|Retinitis pigmentosa [RCV000787526]|Severe early-childhood-onset retinal dystrophy [R CV000408540]|Stargardt disease [RCV003993802]|not provided [RCV000085866] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|no classifications from unflagged records|not provided | 1 | 94098794 | 94098794 | Human | 12 | alternate_id |
| 8645991 | CV105402 | single nucleotide variant | NM_000350.3(ABCA4):c.926C>G (p.Pro309Arg) | Cone-rod dystrophy 3 [RCV005025170]|Macular dystrophy [RCV000504769]|Retinal dystrophy [RCV001075838]|not provided [RCV000085874] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94080651 | 94080651 | Human | 5 | alternate_id |
| 127237539 | CV1054024 | single nucleotide variant | NM_000350.3(ABCA4):c.5530G>T (p.Gly1844Cys) | Cone-rod dystrophy 3 [RCV002272462]|Severe early-childhood-onset retinal dystrophy [RCV001376249]|not provided [RCV002550231] | pathogenic|uncertain significance | 1 | 94011316 | 94011316 | Human | 3 | alternate_id |
| 127241057 | CV1054025 | single nucleotide variant | NM_000350.3(ABCA4):c.5461-1G>T | Severe early-childhood-onset retinal dystrophy [RCV001376209]|not provided [RCV001379164] | pathogenic|likely pathogenic | 1 | 94011386 | 94011386 | Human | 2 | alternate_id |
| 127238169 | CV1054026 | single nucleotide variant | NM_000350.3(ABCA4):c.3608-35A>G | Severe early-childhood-onset retinal dystrophy [RCV001376528] | uncertain significance | 1 | 94037385 | 94037385 | Human | 2 | alternate_id |
| 127237610 | CV1054027 | indel | NM_000350.3(ABCA4):c.2292_2295delinsAGG (p.Cys764_Ser765delinsTer) | Severe early-childhood-onset retinal dystrophy [RCV001376281] | pathogenic | 1 | 94056688 | 94056691 | Human | | alternate_id |
| 127237734 | CV1054028 | single nucleotide variant | NM_000350.3(ABCA4):c.859-13T>C | Severe early-childhood-onset retinal dystrophy [RCV001376345] | uncertain significance | 1 | 94080731 | 94080731 | Human | 2 | alternate_id |
| 127237878 | CV1054029 | single nucleotide variant | NM_000350.3(ABCA4):c.442+2T>A | Severe early-childhood-onset retinal dystrophy [RCV001376405]|not provided [RCV002550236] | pathogenic|likely pathogenic | 1 | 94108575 | 94108575 | Human | 2 | alternate_id |
| 8645995 | CV105406 | single nucleotide variant | NM_000350.3(ABCA4):c.982G>T (p.Glu328Ter) | Retinal dystrophy [RCV001074202]|Severe early-childhood-onset retinal dystrophy [RCV000986374]|not provided [RCV000085878] | pathogenic|not provided | 1 | 94080595 | 94080595 | Human | 4 | alternate_id |
| 8645996 | CV105407 | single nucleotide variant | NM_000350.3(ABCA4):c.983A>T (p.Glu328Val) | Cone-rod dystrophy 3 [RCV004796011]|not provided [RCV000085879] | pathogenic|likely pathogenic|not provided | 1 | 94080594 | 94080594 | Human | 1 | alternate_id |
| 127251656 | CV1054891 | single nucleotide variant | NM_000350.3(ABCA4):c.3522+1G>A | Cone-rod dystrophy 3 [RCV005023127]|not provided [RCV001378602] | pathogenic|likely pathogenic | 1 | 94041208 | 94041208 | Human | 1 | alternate_id |
| 127245733 | CV1054893 | single nucleotide variant | NM_000350.3(ABCA4):c.3328+1G>A | Severe early-childhood-onset retinal dystrophy [RCV005235576]|not provided [RCV001377471] | likely pathogenic | 1 | 94042760 | 94042760 | Human | 2 | alternate_id |
| 127244854 | CV1058841 | single nucleotide variant | NM_000350.3(ABCA4):c.5114G>A (p.Arg1705Gln) | ABCA4-related disorder [RCV004733282]|Cone-rod dystrophy 3 [RCV005361592]|Severe early-childhood-onset retinal dystrophy [RCV004563873]|not provided [RCV001384258] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94019664 | 94019664 | Human | 4 | alternate_id |
| 127253304 | CV1058847 | single nucleotide variant | NM_000350.3(ABCA4):c.4501G>T (p.Glu1501Ter) | Severe early-childhood-onset retinal dystrophy [RCV004699132]|not provided [RCV001385903] | pathogenic | 1 | 94029483 | 94029483 | Human | 2 | alternate_id |
| 127265089 | CV1058859 | deletion | NM_000350.3(ABCA4):c.2069del (p.Gly690fs) | Retinal dystrophy [RCV004815510]|Severe early-childhood-onset retinal dystrophy [RCV002290699]|not provided [RCV001381380] | pathogenic | 1 | 94060628 | 94060628 | Human | 4 | alternate_id |
| 127256035 | CV1058861 | single nucleotide variant | NM_000350.3(ABCA4):c.1761-2A>G | Cone-rod dystrophy 3 [RCV005038198]|Cone-rod dystrophy 3 [RCV005361594]|Severe early-childhood-onset retinal dystrophy [RCV002225134]|not provided [RCV001386479] | pathogenic|likely pathogenic | 1 | 94062755 | 94062755 | Human | 6 | alternate_id |
| 127233618 | CV1058862 | deletion | NM_000350.3(ABCA4):c.1749_1750del (p.Lys583fs) | Severe early-childhood-onset retinal dystrophy [RCV001391313]|not provided [RCV001383104] | pathogenic | 1 | 94063122 | 94063123 | Human | 2 | alternate_id |
| 127256041 | CV1058863 | deletion | NM_000350.3(ABCA4):c.1561del (p.Val521fs) | Severe early-childhood-onset retinal dystrophy [RCV005235578]|not provided [RCV001386480] | pathogenic|likely pathogenic | 1 | 94063311 | 94063311 | Human | 2 | alternate_id |
| 127272690 | CV1058865 | single nucleotide variant | NM_000350.3(ABCA4):c.1391T>A (p.Leu464Ter) | Severe early-childhood-onset retinal dystrophy [RCV001587394]|not provided [RCV001390541] | pathogenic | 1 | 94077853 | 94077853 | Human | 2 | alternate_id |
| 127239664 | CV1060003 | single nucleotide variant | NM_006017.3(PROM1):c.2023C>T (p.Gln675Ter) | Retinitis pigmentosa 41 [RCV005253830]|Stargardt disease [RCV002466268]|not provided [RCV001383295] | pathogenic | 4 | 15989785 | 15989785 | Human | 2 | alternate_id |
| 8646947 | CV106465 | single nucleotide variant | NM_019098.5(CNGB3):c.80A>G (p.Asn27Ser) | Achromatopsia 3 [RCV000388205]|Achromatopsia [RCV001826781]|Severe early-childhood-onset retinal dystrophy [RCV000331894]|not provided [RCV000086971]|not specified [RCV000242664] | benign|likely benign|uncertain significance|not provided | 8 | 86743548 | 86743548 | Human | 6 | alternate_id |
| 127297710 | CV1131775 | single nucleotide variant | NM_000350.3(ABCA4):c.2383-13C>T | Stargardt disease [RCV005419156]|not provided [RCV001497832] | benign|likely benign|uncertain significance | 1 | 94055328 | 94055328 | Human | 1 | alternate_id |
| 127286286 | CV1161885 | single nucleotide variant | NM_000350.3(ABCA4):c.6308C>A (p.Pro2103His) | Severe early-childhood-onset retinal dystrophy [RCV001526707]|Stargardt disease [RCV002469401]|not provided [RCV002568845] | pathogenic|likely pathogenic|uncertain significance | 1 | 94001080 | 94001080 | Human | 2 | alternate_id |
| 127286284 | CV1161886 | single nucleotide variant | NM_000350.3(ABCA4):c.3415T>G (p.Tyr1139Asp) | Severe early-childhood-onset retinal dystrophy [RCV001526706] | uncertain significance | 1 | 94041316 | 94041316 | Human | 2 | alternate_id |
| 150339569 | CV1174783 | single nucleotide variant | NM_000350.3(ABCA4):c.3287C>T (p.Ser1096Leu) | Retinal dystrophy [RCV003888303]|Severe early-childhood-onset retinal dystrophy [RCV003989695]|not provided [RCV001543576] | pathogenic|likely pathogenic | 1 | 94042802 | 94042802 | Human | 4 | alternate_id |
| 150404740 | CV1178862 | single nucleotide variant | NM_000350.3(ABCA4):c.4352+54A>G | Age related macular degeneration 2 [RCV001549178]|Cone-rod dystrophy 3 [RCV001549177]|Retinitis pigmentosa 19 [RCV001549176]|Severe early-childhood-onset retinal dystrophy [RCV001549175]|not provided [RCV001713032] | benign | 1 | 94030374 | 94030374 | Human | 6 | alternate_id |
| 150404484 | CV1178863 | deletion | NM_000350.3(ABCA4):c.1240-65del | Age related macular degeneration 2 [RCV001548789]|Cone-rod dystrophy 3 [RCV001548788]|Retinitis pigmentosa 19 [RCV001548787]|Severe early-childhood-onset retinal dystrophy [RCV001548786]|not provided [RCV001619970] | benign | 1 | 94078771 | 94078771 | Human | 6 | alternate_id |
| 150453560 | CV1203840 | single nucleotide variant | NM_000350.3(ABCA4):c.758T>A (p.Leu253His) | Severe early-childhood-onset retinal dystrophy [RCV001591788] | likely pathogenic | 1 | 94098804 | 94098804 | Human | 2 | alternate_id |
| 150453590 | CV1203846 | single nucleotide variant | NM_000350.3(ABCA4):c.4774-9G>A | Severe early-childhood-onset retinal dystrophy [RCV001591795] | uncertain significance | 1 | 94021723 | 94021723 | Human | 2 | alternate_id |
| 150453616 | CV1203852 | indel | NM_000350.3(ABCA4):c.4734_4739delinsCC (p.Phe1579fs) | Severe early-childhood-onset retinal dystrophy [RCV001591801] | pathogenic | 1 | 94021880 | 94021885 | Human | | alternate_id |
| 150453656 | CV1203862 | single nucleotide variant | NM_000350.3(ABCA4):c.2744-402G>A | Severe early-childhood-onset retinal dystrophy [RCV001591811] | uncertain significance | 1 | 94047495 | 94047495 | Human | 2 | alternate_id |
| 150453694 | CV1203871 | single nucleotide variant | NM_000350.3(ABCA4):c.3349A>C (p.Thr1117Pro) | Severe early-childhood-onset retinal dystrophy [RCV001591820] | likely pathogenic | 1 | 94041382 | 94041382 | Human | 2 | alternate_id |
| 150453751 | CV1203885 | single nucleotide variant | NM_152443.3(RDH12):c.607A>G (p.Ser203Gly) | Stargardt disease [RCV001591834] | likely pathogenic | 14 | 67727139 | 67727139 | Human | 1 | alternate_id |
| 150454066 | CV1203950 | deletion | NM_000350.3(ABCA4):c.2922_2949del (p.Ile975fs) | Severe early-childhood-onset retinal dystrophy [RCV001591900] | pathogenic | 1 | 94044714 | 94044741 | Human | 2 | alternate_id |
| 150454113 | CV1203962 | single nucleotide variant | NM_000350.3(ABCA4):c.3296C>G (p.Ser1099Ter) | Severe early-childhood-onset retinal dystrophy [RCV001591912]|not provided [RCV003120640] | pathogenic | 1 | 94042793 | 94042793 | Human | 2 | alternate_id |
| 150454138 | CV1203968 | single nucleotide variant | NM_000350.3(ABCA4):c.3263C>G (p.Pro1088Arg) | Severe early-childhood-onset retinal dystrophy [RCV001591918]|not provided [RCV001882714] | likely pathogenic | 1 | 94042826 | 94042826 | Human | 2 | alternate_id |
| 150454175 | CV1203976 | single nucleotide variant | NM_000350.3(ABCA4):c.2873T>A (p.Ile958Asn) | Severe early-childhood-onset retinal dystrophy [RCV001591926] | likely pathogenic | 1 | 94046964 | 94046964 | Human | 2 | alternate_id |
| 150471153 | CV1209488 | single nucleotide variant | NM_000350.3(ABCA4):c.2069G>T (p.Gly690Val) | Stargardt disease [RCV005237938]|not provided [RCV001588599] | likely pathogenic|uncertain significance | 1 | 94060628 | 94060628 | Human | 1 | alternate_id |
| 150481521 | CV1265645 | single nucleotide variant | NM_000350.3(ABCA4):c.5578C>T (p.Arg1860Trp) | Cone-rod dystrophy 3 [RCV005023215]|Stargardt disease [RCV004587194]|not provided [RCV001682640] | pathogenic|likely pathogenic | 1 | 94011268 | 94011268 | Human | 2 | alternate_id |
| 150444803 | CV1288115 | single nucleotide variant | NM_000350.3(ABCA4):c.6299G>A (p.Gly2100Glu) | Severe early-childhood-onset retinal dystrophy [RCV001725798]|not provided [RCV002539754] | likely pathogenic|uncertain significance | 1 | 94001089 | 94001089 | Human | 2 | alternate_id |
| 150528105 | CV1301629 | single nucleotide variant | NM_000350.3(ABCA4):c.6379T>C (p.Ser2127Pro) | Cone-rod dystrophy 3 [RCV002489788]|not provided [RCV001755001] | conflicting interpretations of pathogenicity|uncertain significance | 1 | 94001009 | 94001009 | Human | 1 | alternate_id |
| 150536754 | CV1314258 | duplication | NM_004183.4(BEST1):c.1566_1576dup (p.His526delinsProTer) | Stargardt disease [RCV003389499]|not provided [RCV001780683] | pathogenic|likely pathogenic | 11 | 61962717 | 61962718 | Human | 1 | alternate_id |
| 151348723 | CV1324183 | single nucleotide variant | NM_000350.3(ABCA4):c.3941C>T (p.Pro1314Leu) | Severe early-childhood-onset retinal dystrophy [RCV001808099] | uncertain significance | 1 | 94031965 | 94031965 | Human | 2 | alternate_id |
| 151348780 | CV1324217 | single nucleotide variant | NM_000350.3(ABCA4):c.3814-2A>T | Retinitis pigmentosa 19 [RCV001808133]|Stargardt disease [RCV002468642] | pathogenic | 1 | 94036790 | 94036790 | Human | 2 | alternate_id |
| 151662652 | CV1333365 | single nucleotide variant | NM_000350.3(ABCA4):c.3266C>A (p.Thr1089Asn) | Stargardt disease [RCV001837557] | uncertain significance | 1 | 94042823 | 94042823 | Human | 1 | alternate_id |
| 151712003 | CV1334278 | single nucleotide variant | NM_000350.3(ABCA4):c.1555-2A>C | Stargardt disease [RCV001839464] | likely pathogenic | 1 | 94063319 | 94063319 | Human | 1 | alternate_id |
| 151750468 | CV1334491 | single nucleotide variant | NM_000350.3(ABCA4):c.4128+1G>A | Retinitis pigmentosa [RCV005419221]|Severe early-childhood-onset retinal dystrophy [RCV001840952]|not provided [RCV002292669] | pathogenic | 1 | 94031777 | 94031777 | Human | 4 | alternate_id |
| 151751343 | CV1357213 | single nucleotide variant | NM_000350.3(ABCA4):c.2549A>G (p.Tyr850Cys) | Retinal dystrophy [RCV004815672]|Severe early-childhood-onset retinal dystrophy [RCV004797959]|Stargardt disease [RCV005409042]|not provided [RCV001894361] | likely pathogenic|uncertain significance | 1 | 94055149 | 94055149 | Human | 4 | alternate_id |
| 151882853 | CV1364388 | single nucleotide variant | NM_000350.3(ABCA4):c.2972G>T (p.Gly991Val) | Cone-rod dystrophy 3 [RCV005025516]|not provided [RCV001999928]|not specified [RCV004526889] | pathogenic|likely pathogenic|uncertain significance | 1 | 94044691 | 94044691 | Human | 1 | alternate_id |
| 151737352 | CV1364710 | single nucleotide variant | NM_000350.3(ABCA4):c.4852T>C (p.Trp1618Arg) | Severe early-childhood-onset retinal dystrophy [RCV004565159]|not provided [RCV002021962] | pathogenic|likely pathogenic | 1 | 94021406 | 94021406 | Human | 2 | alternate_id |
| 151830545 | CV1377797 | single nucleotide variant | NM_000350.3(ABCA4):c.6401A>G (p.Glu2134Gly) | Stargardt disease [RCV002469446]|not provided [RCV002014272] | likely pathogenic|uncertain significance | 1 | 94000914 | 94000914 | Human | 1 | alternate_id |
| 151760970 | CV1380292 | single nucleotide variant | NM_000350.3(ABCA4):c.3304G>T (p.Asp1102Tyr) | Cone-rod dystrophy 3 [RCV005025523]|Retinal dystrophy [RCV004816824]|Severe early-childhood-onset retinal dystrophy [RCV002250790]|Stargardt disease [RCV004587272]|not provided [RCV001970179] | pathogenic|likely pathogenic|uncertain significance | 1 | 94042785 | 94042785 | Human | 8 | alternate_id |
| 151838401 | CV1382744 | single nucleotide variant | NM_000350.3(ABCA4):c.5209G>A (p.Val1737Met) | Cone-rod dystrophy 3 [RCV002507835]|not provided [RCV002031532] | uncertain significance | 1 | 94015842 | 94015842 | Human | 1 | alternate_id |
| 151762371 | CV1393592 | single nucleotide variant | NM_000350.3(ABCA4):c.6190G>A (p.Ala2064Thr) | Severe early-childhood-onset retinal dystrophy [RCV005235620]|not provided [RCV001949300] | pathogenic|likely pathogenic | 1 | 94001950 | 94001950 | Human | 2 | alternate_id |
| 151811670 | CV1393622 | single nucleotide variant | NM_000350.3(ABCA4):c.4102C>T (p.Arg1368Cys) | Retinal dystrophy [RCV004816828]|Stargardt disease [RCV003331250]|not provided [RCV001953886] | pathogenic|likely pathogenic | 1 | 94031804 | 94031804 | Human | 3 | alternate_id |
| 8689987 | CV139937 | single nucleotide variant | NM_000350.3(ABCA4):c.5844A>G (p.Pro1948=) | ABCA4-related disorder [RCV001096227]|Age related macular degeneration 2 [RCV001548895]|Cone-Rod Dystrophy, Recessive [RCV000324408]|Cone-rod dystrophy 3 [RCV001548894]|Macular degeneration [RCV000382920]|Retinal dystrophy [RCV003888516]|Retinitis Pigmentosa, Recessive [RCV000269749]|Retinitis pigme ntosa 19 [RCV001548893]|Severe early-childhood-onset retinal dystrophy [RCV001548892]|Stargardt Disease, Recessive [RCV000328383]|not provided [RCV000509128]|not specified [RCV000152704] | benign|likely benign|not provided | 1 | 94008289 | 94008289 | Human | 12 | alternate_id |
| 8689988 | CV139938 | single nucleotide variant | NM_000350.3(ABCA4):c.6069T>C (p.Ile2023=) | ABCA4-related disorder [RCV001101664]|Age related macular degeneration 2 [RCV001548887]|Cone-Rod Dystrophy, Recessive [RCV000296912]|Cone-rod dystrophy 3 [RCV001548886]|Macular degeneration [RCV000355311]|Retinal dystrophy [RCV003888517]|Retinitis Pigmentosa, Recessive [RCV000404512]|Retinitis pigme ntosa 19 [RCV001548779]|Severe early-childhood-onset retinal dystrophy [RCV001548778]|Stargardt Disease, Recessive [RCV000300456]|not provided [RCV000509567]|not specified [RCV000178546] | benign|not provided | 1 | 94005519 | 94005519 | Human | 12 | alternate_id |
| 151837256 | CV1416897 | single nucleotide variant | NM_000350.3(ABCA4):c.4327C>T (p.Arg1443Cys) | Cone-rod dystrophy 3 [RCV005025567]|Retinal dystrophy [RCV004816862]|not provided [RCV002014925] | pathogenic|likely pathogenic|uncertain significance | 1 | 94030453 | 94030453 | Human | 3 | alternate_id |
| 151774700 | CV1419981 | single nucleotide variant | NM_000350.3(ABCA4):c.6560A>G (p.Gln2187Arg) | Cone-rod dystrophy 3 [RCV002486550]|not provided [RCV002009180] | uncertain significance | 1 | 93998030 | 93998030 | Human | 1 | alternate_id |
| 151737382 | CV1422312 | deletion | NM_000350.3(ABCA4):c.6181_6184del (p.Thr2061fs) | Cone-rod dystrophy 3 [RCV004596498]|Stargardt disease [RCV003331240]|not provided [RCV001984876] | pathogenic | 1 | 94001956 | 94001959 | Human | 2 | alternate_id |
| 151834000 | CV1428877 | single nucleotide variant | NM_000350.3(ABCA4):c.6446G>C (p.Arg2149Pro) | Stargardt disease [RCV002468652]|not provided [RCV001993991] | likely pathogenic|uncertain significance | 1 | 94000869 | 94000869 | Human | 1 | alternate_id |
| 151715861 | CV1441744 | single nucleotide variant | NM_000350.3(ABCA4):c.4352+61G>A | Severe early-childhood-onset retinal dystrophy [RCV004565162]|not provided [RCV002002915] | pathogenic|likely pathogenic | 1 | 94030367 | 94030367 | Human | 2 | alternate_id |
| 151866725 | CV1447460 | microsatellite | NM_000350.3(ABCA4):c.2741_2742del (p.His914fs) | Stargardt disease [RCV002469422]|not provided [RCV001924697] | pathogenic | 1 | 94048869 | 94048870 | Human | | alternate_id |
| 151732226 | CV1454510 | deletion | NM_000350.3(ABCA4):c.2807del (p.Lys936fs) | Stargardt disease [RCV002469432]|not provided [RCV001967237] | pathogenic | 1 | 94047030 | 94047030 | Human | 1 | alternate_id |
| 151739473 | CV1454827 | single nucleotide variant | NM_000350.3(ABCA4):c.5714+1G>A | Cone-rod dystrophy 3 [RCV005032010]|not provided [RCV001946958] | pathogenic | 1 | 94010799 | 94010799 | Human | 1 | alternate_id |
| 151837756 | CV1468145 | deletion | NM_000350.3(ABCA4):c.5453del (p.Asn1818fs) | Severe early-childhood-onset retinal dystrophy [RCV002290820]|not provided [RCV001956369] | pathogenic|likely pathogenic | 1 | 94014550 | 94014550 | Human | 2 | alternate_id |
| 151872746 | CV1480726 | single nucleotide variant | NM_006017.3(PROM1):c.1579-3T>G | Stargardt disease [RCV002466273]|not provided [RCV001906702] | pathogenic|uncertain significance | 4 | 15998491 | 15998491 | Human | 1 | alternate_id |
| 151888510 | CV1481420 | single nucleotide variant | NM_000350.3(ABCA4):c.4720G>T (p.Glu1574Ter) | Cone-rod dystrophy [RCV003324576]|Stargardt disease [RCV003324577]|not provided [RCV001963229] | pathogenic | 1 | 94021899 | 94021899 | Human | 4 | alternate_id |
| 151766442 | CV1485952 | deletion | NM_000350.3(ABCA4):c.2908del (p.Thr970fs) | Stargardt disease [RCV002469415]|not provided [RCV002044821] | pathogenic | 1 | 94046929 | 94046929 | Human | 1 | alternate_id |
| 151739675 | CV1492346 | single nucleotide variant | NM_000350.3(ABCA4):c.2522A>C (p.Gln841Pro) | Stargardt disease [RCV004801062]|not provided [RCV002042109] | pathogenic|likely pathogenic|uncertain significance | 1 | 94055176 | 94055176 | Human | 1 | alternate_id |
| 151740554 | CV1492453 | single nucleotide variant | NM_000350.3(ABCA4):c.53G>A (p.Arg18Gln) | Stargardt disease [RCV004699498]|not provided [RCV002042187] | pathogenic | 1 | 94120993 | 94120993 | Human | 1 | alternate_id |
| 151797988 | CV1512957 | single nucleotide variant | NM_006017.3(PROM1):c.1424T>A (p.Val475Asp) | Stargardt disease [RCV002466272]|not provided [RCV001866864] | pathogenic|likely pathogenic|uncertain significance | 4 | 16006568 | 16006568 | Human | 1 | alternate_id |
| 8555440 | CV15142 | deletion | NM_001029883.3(PCARE):c.947del (p.Asn316fs) | Retinitis pigmentosa 54 [RCV000000123]|Stargardt disease [RCV002466389]|not provided [RCV001043046] | pathogenic | 2 | 29073315 | 29073315 | Human | 2 | alternate_id |
| 152045684 | CV1670319 | single nucleotide variant | NM_000350.3(ABCA4):c.2347C>T (p.Gln783Ter) | Severe early-childhood-onset retinal dystrophy [RCV002225171] | pathogenic | 1 | 94056636 | 94056636 | Human | 2 | alternate_id |
| 152045989 | CV1670367 | deletion | NM_000350.3(ABCA4):c.2653+2del | Severe early-childhood-onset retinal dystrophy [RCV002225219]|not provided [RCV003669254] | likely pathogenic|uncertain significance | 1 | 94051631 | 94051631 | Human | 2 | alternate_id |
| 152999111 | CV1679551 | deletion | NM_000350.3(ABCA4):c.3540del (p.Ser1181fs) | Severe early-childhood-onset retinal dystrophy [RCV002250940] | likely pathogenic | 1 | 94040110 | 94040110 | Human | 2 | alternate_id |
| 153000400 | CV1685438 | single nucleotide variant | NM_000350.3(ABCA4):c.6698A>T (p.Glu2233Val) | Severe early-childhood-onset retinal dystrophy [RCV002259425] | likely pathogenic | 1 | 93997892 | 93997892 | Human | 2 | alternate_id |
| 153302898 | CV1689691 | single nucleotide variant | NM_000350.3(ABCA4):c.2099G>T (p.Trp700Leu) | Severe early-childhood-onset retinal dystrophy [RCV002267680] | uncertain significance | 1 | 94060598 | 94060598 | Human | 2 | alternate_id |
| 155800140 | CV1694322 | single nucleotide variant | NM_000350.3(ABCA4):c.5278C>A (p.Leu1760Ile) | Severe early-childhood-onset retinal dystrophy [RCV002466301] | uncertain significance | 1 | 94015773 | 94015773 | Human | 2 | alternate_id |
| 155643360 | CV1707804 | single nucleotide variant | NM_000350.3(ABCA4):c.2105T>C (p.Leu702Pro) | Severe early-childhood-onset retinal dystrophy [RCV002289265]|not provided [RCV003101666] | pathogenic|uncertain significance | 1 | 94060592 | 94060592 | Human | 2 | alternate_id |
| 329356848 | CV1708460 | single nucleotide variant | NM_000350.3(ABCA4):c.5460+2T>C | Severe early-childhood-onset retinal dystrophy [RCV003164452] | pathogenic | 1 | 94014541 | 94014541 | Human | 2 | alternate_id |
| 329356664 | CV1708471 | single nucleotide variant | NM_000350.3(ABCA4):c.2327A>G (p.His776Arg) | Severe early-childhood-onset retinal dystrophy [RCV003164463] | uncertain significance | 1 | 94056656 | 94056656 | Human | 2 | alternate_id |
| 155710527 | CV1770782 | single nucleotide variant | NM_000350.3(ABCA4):c.5113C>G (p.Arg1705Gly) | Severe early-childhood-onset retinal dystrophy [RCV002302857] | likely pathogenic | 1 | 94019665 | 94019665 | Human | 2 | alternate_id |
| 155665751 | CV1773340 | single nucleotide variant | NM_000350.3(ABCA4):c.5498T>G (p.Leu1833Arg) | Severe early-childhood-onset retinal dystrophy [RCV004565260]|not provided [RCV002297052] | likely pathogenic|uncertain significance | 1 | 94011348 | 94011348 | Human | 2 | alternate_id |
| 8595898 | CV17779 | single nucleotide variant | NM_004183.4(BEST1):c.422G>A (p.Arg141His) | Autosomal recessive bestrophinopathy [RCV000002863]|BEST1-related disorder [RCV004532276]|BEST1-related dominant retinopathy [RCV005364864]|Retinal dystrophy [RCV001075875]|Stargardt disease [RCV000787541]|Vitelliform macular dystrophy 2 [RCV000002862]|not provi ded [RCV000086135] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity|not provided | 11 | 61955892 | 61955892 | Human | 7 | alternate_id |
| 155794925 | CV1860123 | deletion | NM_198506.5(LRIT3):c.59_61del (p.Leu20del) | Stargardt disease [RCV002466764] | pathogenic | 4 | 109848259 | 109848261 | Human | 1 | alternate_id |
| 155800973 | CV1860975 | single nucleotide variant | NM_000350.3(ABCA4):c.768+1G>A | Stargardt disease [RCV002468686] | pathogenic | 1 | 94098793 | 94098793 | Human | 1 | alternate_id |
| 155794724 | CV1860976 | deletion | NM_000350.3:c.1876_1999del | Stargardt disease [RCV002468687] | pathogenic | | | | Human | 1 | alternate_id |
| 155794725 | CV1860977 | deletion | NM_000350.3(ABCA4):c.2522_2530del (p.Gln841_Met843del) | Stargardt disease [RCV002468688] | likely pathogenic | 1 | 94055168 | 94055176 | Human | 1 | alternate_id |
| 155794726 | CV1860978 | deletion | NM_000350.3(ABCA4):c.3898del (p.Arg1300fs) | Stargardt disease [RCV002468689] | pathogenic | 1 | 94032008 | 94032008 | Human | 1 | alternate_id |
| 155794916 | CV1861194 | single nucleotide variant | NM_000350.3(ABCA4):c.3608-1G>A | Stargardt disease [RCV002468911] | pathogenic | 1 | 94037351 | 94037351 | Human | 1 | alternate_id |
| 155794918 | CV1861196 | single nucleotide variant | NM_000350.3(ABCA4):c.4313C>A (p.Pro1438Gln) | Stargardt disease [RCV002468913] | likely pathogenic | 1 | 94030467 | 94030467 | Human | 1 | alternate_id |
| 155794919 | CV1861197 | single nucleotide variant | NM_000350.3(ABCA4):c.689G>T (p.Cys230Phe) | Stargardt disease [RCV002468914] | likely pathogenic | 1 | 94098873 | 94098873 | Human | 1 | alternate_id |
| 155800366 | CV1861652 | single nucleotide variant | NM_000350.3(ABCA4):c.2453G>C (p.Gly818Ala) | Stargardt disease [RCV002469936] | pathogenic | 1 | 94055245 | 94055245 | Human | 1 | alternate_id |
| 155800369 | CV1861657 | duplication | NM_000350.3(ABCA4):c.4243dup (p.Thr1415fs) | Stargardt disease [RCV002469939] | pathogenic | 1 | 94031005 | 94031006 | Human | 1 | alternate_id |
| 155798551 | CV1862058 | single nucleotide variant | NM_000350.3(ABCA4):c.1508T>C (p.Phe503Ser) | Severe early-childhood-onset retinal dystrophy [RCV002471461] | likely pathogenic | 1 | 94077736 | 94077736 | Human | 2 | alternate_id |
| 155799131 | CV1862353 | single nucleotide variant | NM_000350.3(ABCA4):c.1254T>A (p.Phe418Leu) | Stargardt disease [RCV002471759] | uncertain significance | 1 | 94078692 | 94078692 | Human | 1 | alternate_id |
| 155799132 | CV1862354 | single nucleotide variant | NM_000350.3(ABCA4):c.443-2A>G | Stargardt disease [RCV002471760] | likely pathogenic | 1 | 94103144 | 94103144 | Human | 1 | alternate_id |
| 155796569 | CV1862925 | single nucleotide variant | NM_000350.3(ABCA4):c.5905G>A (p.Gly1969Ser) | Severe early-childhood-onset retinal dystrophy [RCV002470199] | uncertain significance | 1 | 94007734 | 94007734 | Human | 2 | alternate_id |
| 155797358 | CV1863291 | single nucleotide variant | NM_000350.3(ABCA4):c.173A>T (p.Asn58Ile) | Severe early-childhood-onset retinal dystrophy [RCV002470565] | uncertain significance | 1 | 94111567 | 94111567 | Human | 2 | alternate_id |
| 10041403 | CV186769 | single nucleotide variant | NM_019098.5(CNGB3):c.644-1G>C | Achromatopsia 3 [RCV000169108]|Achromatopsia 3 [RCV001535671]|Achromatopsia [RCV001002980]|CNGB3-related disorder [RCV004732735]|not provided [RCV000814009] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 8 | 86667134 | 86667134 | Human | 4 | alternate_id |
| 10045050 | CV188789 | microsatellite | NM_000350.3(ABCA4):c.5391_5392del (p.Cys1797_Ala1798insTer) | Autosomal recessive retinitis pigmentosa [RCV001257847]|Severe early-childhood-onset retinal dystrophy [RCV003989477]|not provided [RCV000171154] | pathogenic|likely pathogenic|no classifications from unflagged records | 1 | 94014611 | 94014612 | Human | | alternate_id |
| 10049331 | CV190248 | single nucleotide variant | NM_000322.5(PRPH2):c.271T>A (p.Tyr91Asn) | PRPH2-related disorder [RCV001232080]|Patterned dystrophy of the retinal pigment epithelium [RCV001250295]|Stargardt disease [RCV001250296]|not provided [RCV000173108] | uncertain significance | 6 | 42722064 | 42722064 | Human | 2 | alternate_id |
| 10050638 | CV192224 | single nucleotide variant | NM_000322.5(PRPH2):c.725A>G (p.Glu242Gly) | PRPH2-related disorder [RCV001463523]|Stargardt disease [RCV001250337]|Usher syndrome [RCV003389460]|not provided [RCV000175581] | likely pathogenic|likely benign|uncertain significance | 6 | 42704468 | 42704468 | Human | 3 | alternate_id |
| 156158808 | CV1928430 | single nucleotide variant | NM_000350.3(ABCA4):c.6289C>T (p.Pro2097Ser) | Stargardt disease [RCV005419575]|not provided [RCV002664166] | pathogenic | 1 | 94001099 | 94001099 | Human | 1 | alternate_id |
| 156311307 | CV1928467 | single nucleotide variant | NM_000350.3(ABCA4):c.2T>C (p.Met1Thr) | Stargardt disease [RCV003324587]|not provided [RCV002648183] | pathogenic|likely pathogenic | 1 | 94121044 | 94121044 | Human | 1 | alternate_id |
| 10052024 | CV194216 | single nucleotide variant | NM_000350.3(ABCA4):c.5549T>C (p.Leu1850Pro) | Retinal dystrophy [RCV004816288]|Severe early-childhood-onset retinal dystrophy [RCV000296428]|not provided [RCV000790718] | pathogenic|likely pathogenic|uncertain significance | 1 | 94011297 | 94011297 | Human | 4 | alternate_id |
| 10049004 | CV195380 | deletion | NM_130837.3(OPA1):c.800_801del (p.Lys267fs) | Autosomal dominant optic atrophy classic form [RCV002288784]|Inborn genetic diseases [RCV000623100]|Optic atrophy [RCV004816301]|Stargardt disease [RCV003389462]|not provided [RCV000517030] | pathogenic | 3 | 193631621 | 193631622 | Human | 6 | alternate_id |
| 10049150 | CV195881 | single nucleotide variant | NM_000350.3(ABCA4):c.880C>T (p.Gln294Ter) | Cone-rod dystrophy 3 [RCV005025288]|Retinitis pigmentosa 19 [RCV005252791]|not provided [RCV000180146] | pathogenic | 1 | 94080697 | 94080697 | Human | 2 | alternate_id |
| 8558559 | CV20266 | single nucleotide variant | NM_019098.5(CNGB3):c.1405T>G (p.Tyr469Asp) | Achromatopsia 3 [RCV000497748]|Achromatopsia [RCV001276134]|Severe early-childhood-onset retinal dystrophy [RCV000005538]|not provided [RCV000881356]|not specified [RCV000378015] | pathogenic|likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86628994 | 86628994 | Human | 6 | alternate_id |
| 155954677 | CV2033327 | single nucleotide variant | NM_000350.3(ABCA4):c.3308T>G (p.Leu1103Arg) | Severe early-childhood-onset retinal dystrophy [RCV004559966]|not provided [RCV002730866] | pathogenic | 1 | 94042781 | 94042781 | Human | 2 | alternate_id |
| 156348626 | CV2061968 | single nucleotide variant | NM_000350.3(ABCA4):c.1901T>C (p.Leu634Pro) | Severe early-childhood-onset retinal dystrophy [RCV003445179]|not provided [RCV002811614] | uncertain significance | 1 | 94062613 | 94062613 | Human | 2 | alternate_id |
| 155954586 | CV2086876 | single nucleotide variant | NM_000350.3(ABCA4):c.6397T>C (p.Cys2133Arg) | Severe early-childhood-onset retinal dystrophy [RCV004565630]|not provided [RCV002862529] | pathogenic|likely pathogenic | 1 | 94000918 | 94000918 | Human | 2 | alternate_id |
| 10409059 | CV209342 | single nucleotide variant | NM_000350.3(ABCA4):c.1964T>G (p.Phe655Cys) | Cone-rod dystrophy 3 [RCV000194199]|Cone-rod dystrophy 3 [RCV002485297]|Retinal dystrophy [RCV001075570]|Severe early-childhood-onset retinal dystrophy [RCV000408459]|not provided [RCV001071977] | pathogenic|likely pathogenic | 1 | 94060733 | 94060733 | Human | 8 | alternate_id |
| 10409123 | CV209475 | single nucleotide variant | NM_003036.4(SKI):c.1528G>A (p.Ala510Thr) | Familial thoracic aortic aneurysm and aortic dissection [RCV002399731]|SKI-related disorder [RCV003907725]|Shprintzen-Goldberg syndrome [RCV000638898]|not provided [RCV003456375]|not specified [RCV000195482] | pathogenic|likely benign|uncertain significance | 1 | 2304346 | 2304346 | Human | 5 | alternate_id |
| 10410228 | CV209875 | single nucleotide variant | NM_001105206.3(LAMA4):c.3122C>G (p.Ala1041Gly) | Cardiovascular phenotype [RCV004020372]|Dilated cardiomyopathy 1JJ [RCV001371398]|not provided [RCV000197744] | pathogenic|uncertain significance | 6 | 112139280 | 112139280 | Human | 3 | alternate_id |
| 156155618 | CV2100504 | single nucleotide variant | NM_000350.3(ABCA4):c.4254-5T>A | Stargardt disease [RCV005239521]|not provided [RCV002872475] | likely pathogenic|uncertain significance | 1 | 94030531 | 94030531 | Human | 1 | alternate_id |
| 156085507 | CV2138485 | single nucleotide variant | NM_000350.3(ABCA4):c.302+4A>G | Cone-rod dystrophy 3 [RCV004796749]|not provided [RCV002979411] | likely pathogenic|uncertain significance | 1 | 94111434 | 94111434 | Human | 1 | alternate_id |
| 156308934 | CV2163863 | single nucleotide variant | NM_000350.3(ABCA4):c.4558G>C (p.Glu1520Gln) | Severe early-childhood-onset retinal dystrophy [RCV004565656]|not provided [RCV003045921] | likely pathogenic | 1 | 94025030 | 94025030 | Human | 2 | alternate_id |
| 10766753 | CV217189 | single nucleotide variant | NM_000350.3(ABCA4):c.1645G>A (p.Ala549Thr) | Severe early-childhood-onset retinal dystrophy [RCV000203500]|not provided [RCV002517367] | likely pathogenic|uncertain significance | 1 | 94063227 | 94063227 | Human | 2 | alternate_id |
| 11051482 | CV226523 | deletion | NM_000350.3(ABCA4):c.2713del (p.Glu905fs) | ABCA4-related disorder [RCV000785052]|Retinal dystrophy [RCV000210324]|Severe early-childhood-onset retinal dystrophy [RCV004556765]|not provided [RCV001853370] | pathogenic|likely pathogenic | 1 | 94048898 | 94048898 | Human | 4 | alternate_id |
| 26910060 | CV227508 | single nucleotide variant | NM_000350.3(ABCA4):c.302+68C>T | Retinal dystrophy [RCV001074350]|Severe early-childhood-onset retinal dystrophy [RCV001376346] | uncertain significance | 1 | 94111370 | 94111370 | Human | 4 | alternate_id |
| 11598653 | CV227509 | single nucleotide variant | NM_000350.3(ABCA4):c.4539+2028C>T | ABCA4-related disorder [RCV004529387]|Retinal dystrophy [RCV001074348]|Severe early-childhood-onset retinal dystrophy [RCV000408506]|not provided [RCV001380975] | pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94027417 | 94027417 | Human | 4 | alternate_id |
| 11087588 | CV227510 | deletion | NM_000350.3(ABCA4):c.6148-698_6670del | Severe early-childhood-onset retinal dystrophy [RCV000210994] | likely pathogenic | 1 | 93997920 | 94002690 | Human | 2 | alternate_id |
| 8560171 | CV22919 | single nucleotide variant | NM_000350.3(ABCA4):c.2791G>A (p.Val931Met) | ABCA4-related disorder [RCV004732538]|Cone-rod dystrophy 3 [RCV005025030]|Retinal dystrophy [RCV001073603]|Retinitis pigmentosa 19 [RCV001807722]|Severe early-childhood-onset retinal dystrophy [RCV000008330]|Stargardt disease [RCV001002838]|not provided [RCV0000 85506]|not specified [RCV002247267] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94047046 | 94047046 | Human | 8 | alternate_id |
| 8560172 | CV22920 | single nucleotide variant | NM_000350.3(ABCA4):c.3083C>T (p.Ala1028Val) | Severe early-childhood-onset retinal dystrophy [RCV000008331]|not provided [RCV001040974] | pathogenic|uncertain significance | 1 | 94043443 | 94043443 | Human | 2 | alternate_id |
| 8560173 | CV22921 | single nucleotide variant | NM_000350.3(ABCA4):c.6079C>T (p.Leu2027Phe) | Age related macular degeneration 2 [RCV002247268]|Cone-rod dystrophy 3 [RCV000008333]|Cone-rod dystrophy 3 [RCV000763438]|Retinal dystrophy [RCV001074885]|Severe early-childhood-onset retinal dystrophy [RCV000008332]|Stargardt disease [RCV000826132]|not provided [RCV000085785] | pathogenic|likely pathogenic|not provided | 1 | 94005509 | 94005509 | Human | 8 | alternate_id |
| 8560174 | CV22922 | single nucleotide variant | NM_000350.3(ABCA4):c.2565G>A (p.Trp855Ter) | Severe early-childhood-onset retinal dystrophy [RCV000008334]|not provided [RCV000085489] | pathogenic|not provided | 1 | 94055133 | 94055133 | Human | 2 | alternate_id |
| 8560177 | CV22925 | single nucleotide variant | NM_000350.3(ABCA4):c.3106G>A (p.Glu1036Lys) | Cone-rod dystrophy 3 [RCV004795382]|Severe early-childhood-onset retinal dystrophy [RCV000008337]|Stargardt disease [RCV003398468]|not provided [RCV000085548] | pathogenic|likely pathogenic|not provided | 1 | 94043420 | 94043420 | Human | 6 | alternate_id |
| 8654645 | CV22926 | insertion | NM_000350.2(ABCA4):c.3210_3211insGT (p.Ser1071Valfs) | Severe early-childhood-onset retinal dystrophy [RCV000008338]|not provided [RCV000085558] | pathogenic|not provided | 1 | 94042878 | 94042879 | Human | 2 | alternate_id |
| 8560178 | CV22927 | single nucleotide variant | NM_000350.3(ABCA4):c.5882G>A (p.Gly1961Glu) | ABCA4-related disorder [RCV000273328]|ABCA4-related retinopathy [RCV003324710]|Age related macular degeneration 2 [RCV000678513]|Cone dystrophy [RCV005417422]|Cone-rod dystrophy 3 [RCV000008341]|Cone-rod dystrophy 3 [RCV001254602]|Cone-rod dystrophy 3 [RCV005031424]|Inborn genetic diseases [RCV00062 4210]|MACULAR DEGENERATION, AGE-RELATED, 2, SUSCEPTIBILITY TO [RCV000008339]|Macular dystrophy [RCV000504952]|Retinal dystrophy [RCV000505149]|Retinitis pigmentosa 19 [RCV001542557]|Retinitis pigmentosa [RCV002247269]|See cases [RCV004584319]|Severe early-childhood-onset retinal dystrophy [RCV000008340]|Stargardt disease [RCV000787514]|Syndromic retinitis pigmentosa [RCV005417423]|not provided [RCV000078670]|not specified [RCV001731281] | pathogenic|likely pathogenic|risk factor|benign|conflicting interpretations of pathogenicity|uncertain significance|low penetrance|no classifications from unflagged records|not provided | 1 | 94008251 | 94008251 | Human | 15 | alternate_id |
| 8560182 | CV22931 | single nucleotide variant | NM_000350.3(ABCA4):c.5908C>T (p.Leu1970Phe) | ABCA4-related disorder [RCV000778995]|Retinal dystrophy [RCV001073250]|Severe early-childhood-onset retinal dystrophy [RCV000408598]|Stargardt disease [RCV000008346]|Vitreoretinopathy [RCV000787515]|not provided [RCV000085773]|not specified [RCV000259062] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94007731 | 94007731 | Human | 5 | alternate_id |
| 8560183 | CV22932 | single nucleotide variant | NM_000350.3(ABCA4):c.5912T>G (p.Leu1971Arg) | Stargardt disease [RCV000008347]|not provided [RCV000085774] | pathogenic|not provided | 1 | 94007727 | 94007727 | Human | 1 | alternate_id |
| 8560184 | CV22933 | single nucleotide variant | NM_000350.3(ABCA4):c.3113C>T (p.Ala1038Val) | ABCA4-related disorder [RCV000778259]|Age related macular degeneration 2 [RCV001196125]|Cone-rod dystrophy 3 [RCV000008350]|Cone-rod dystrophy 3 [RCV000763046]|Cone-rod dystrophy 3 [RCV005357097]|Macular dystrophy [RCV000787495]|Optic atrophy [RCV004814860]|Retinal dystrophy [RCV000505109]|Retinitis pigmentosa [RCV000787494]|Severe early-childhood-onset retinal dystrophy [RCV000008348]|Stargardt disease [RCV000787493]|not provided [RCV000085549]|not specified [RCV001000014] | pathogenic|likely pathogenic|risk factor|conflicting interpretations of pathogenicity|not provided | 1 | 94043413 | 94043413 | Human | 14 | alternate_id |
| 8560186 | CV22935 | single nucleotide variant | NM_000350.3(ABCA4):c.1018T>G (p.Tyr340Asp) | Severe early-childhood-onset retinal dystrophy [RCV000008353]|not provided [RCV000085368] | pathogenic|not provided | 1 | 94080559 | 94080559 | Human | 2 | alternate_id |
| 8560189 | CV22938 | single nucleotide variant | NM_000350.3(ABCA4):c.52C>T (p.Arg18Trp) | Retinal dystrophy [RCV001075717]|Severe early-childhood-onset retinal dystrophy [RCV000008356]|Stargardt disease 3 [RCV004558241]|not provided [RCV000085719] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94120994 | 94120994 | Human | 5 | alternate_id |
| 8560190 | CV22939 | single nucleotide variant | NM_000350.3(ABCA4):c.1715G>A (p.Arg572Gln) | Cone-rod dystrophy 3 [RCV005031425]|Retinal dystrophy [RCV001074326]|Severe early-childhood-onset retinal dystrophy [RCV000008357]|not provided [RCV000085416] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94063157 | 94063157 | Human | 8 | alternate_id |
| 8645548 | CV22940 | single nucleotide variant | NM_000350.3(ABCA4):c.1622T>C (p.Leu541Pro) | ABCA4-related disorder [RCV004528784]|Age related macular degeneration 2 [RCV001196126]|Macular dystrophy [RCV000787482]|Retinal dystrophy [RCV000505133]|Retinitis pigmentosa [RCV000504750]|Severe early-childhood-onset retinal dystrophy [RCV000408513]|Stargardt disease [RCV000787481]|not provided [RCV000085410]|not specified [RCV001002385] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94063250 | 94063250 | Human | 10 | alternate_id |
| 8560192 | CV22942 | single nucleotide variant | NM_000350.3(ABCA4):c.3602T>G (p.Leu1201Arg) | ABCA4-related disorder [RCV001096421]|Cone-Rod Dystrophy, Recessive [RCV000343774]|Cone-rod dystrophy 3 [RCV000008361]|Macular degeneration [RCV000401597]|Retinal dystrophy [RCV004814861]|Retinitis Pigmentosa, Recessive [RCV000340328]|Severe early-childhood-onset retinal dystrophy [RCV000408567]|... (more) an style='font-weight:700;'>Stargardt Disease, Recessive [RCV000308786]|not provided [RCV000085583]|not specified [RCV000176456] | pathogenic|likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|no classifications from unflagged records|not provided | 1 | 94040048 | 94040048 | Human | 9 | alternate_id |
| 8560193 | CV22943 | single nucleotide variant | NM_000350.3(ABCA4):c.4139C>T (p.Pro1380Leu) | ABCA4-related disorder [RCV000778258]|Cone-rod dystrophy 3 [RCV000763044]|Cone-rod dystrophy 3 [RCV004786246]|MACULAR DEGENERATION, AGE-RELATED, 2, SUSCEPTIBILITY TO [RCV000023139]|Mandibulofacial dysostosis with mental deficiency [RCV000454310]|Retinal dystrophy [RCV001075868]|Severe early-childhoo d-onset retinal dystrophy [RCV000008362]|Stargardt disease [RCV000787498]|not provided [RCV000078666] | pathogenic|likely pathogenic|risk factor|conflicting interpretations of pathogenicity|not provided | 1 | 94031110 | 94031110 | Human | 9 | alternate_id |
| 8560194 | CV22944 | deletion | NM_000350.3(ABCA4):c.2888del (p.Gly963fs) | Cone-rod dystrophy 3 [RCV000008363]|Severe early-childhood-onset retinal dystrophy [RCV000986365]|Stargardt disease 3 [RCV004558242]|not provided [RCV000085520] | pathogenic|not provided | 1 | 94046949 | 94046949 | Human | 4 | alternate_id |
| 8560196 | CV22946 | single nucleotide variant | NM_000350.3(ABCA4):c.6088C>T (p.Arg2030Ter) | ABCA4-related disorder [RCV004528093]|ABCA4-related retinopathy [RCV002512903]|Cone-rod dystrophy 3 [RCV000763437]|Leber congenital amaurosis 14 [RCV003447472]|Retinal dystrophy [RCV000504794]|Retinal dystrophy, early-onset severe [RCV000008365]|Retinitis pigmentosa 19 [RCV001542555]|Severe early-ch ildhood-onset retinal dystrophy [RCV000505162]|Stargardt disease [RCV000787773]|not provided [RCV000085786] | pathogenic|likely pathogenic|not provided | 1 | 94005500 | 94005500 | Human | 10 | alternate_id |
| 8560198 | CV22948 | single nucleotide variant | NM_000350.3(ABCA4):c.5285C>A (p.Ala1762Asp) | Cone-rod dystrophy 3 [RCV000008367]|Severe early-childhood-onset retinal dystrophy [RCV000008368] | pathogenic | 1 | 94015766 | 94015766 | Human | 3 | alternate_id |
| 8560200 | CV22950 | single nucleotide variant | NM_000350.3(ABCA4):c.5819T>C (p.Leu1940Pro) | Cone-rod dystrophy 3 [RCV000008372]|Severe early-childhood-onset retinal dystrophy [RCV000008371]|Stargardt disease [RCV000008370]|not provided [RCV000085762] | pathogenic|likely pathogenic|not provided | 1 | 94008767 | 94008767 | Human | 3 | alternate_id |
| 8560201 | CV22951 | single nucleotide variant | NM_000350.3(ABCA4):c.5338C>G (p.Pro1780Ala) | Cone-rod dystrophy 3 [RCV005025031]|Optic atrophy [RCV004814862]|Retinal dystrophy [RCV001073346]|Severe early-childhood-onset retinal dystrophy [RCV000008373]|not provided [RCV000994036]|not specified [RCV003317029] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94014665 | 94014665 | Human | 10 | alternate_id |
| 11664709 | CV237631 | single nucleotide variant | NM_000350.3(ABCA4):c.6713A>G (p.Gln2238Arg) | Retinal dystrophy [RCV004816436]|Severe early-childhood-onset retinal dystrophy [RCV000408503] | likely pathogenic | 1 | 93997877 | 93997877 | Human | 4 | alternate_id |
| 11664724 | CV237632 | single nucleotide variant | NM_000350.3(ABCA4):c.6647C>T (p.Ala2216Val) | Cone-rod dystrophy 3 [RCV004783767]|Retinal dystrophy [RCV004816435]|Severe early-childhood-onset retinal dystrophy [RCV000408559]|not provided [RCV001378637] | pathogenic|likely pathogenic|uncertain significance|no classifications from unflagged records | 1 | 93997943 | 93997943 | Human | 8 | alternate_id |
| 11664747 | CV237633 | single nucleotide variant | NM_000350.3(ABCA4):c.6515A>G (p.Lys2172Arg) | Retinal dystrophy [RCV004816434]|Severe early-childhood-onset retinal dystrophy [RCV000408595]|not provided [RCV001854788] | likely pathogenic|uncertain significance | 1 | 93998075 | 93998075 | Human | 4 | alternate_id |
| 11664748 | CV237634 | single nucleotide variant | NM_000350.3(ABCA4):c.6326T>C (p.Leu2109Pro) | Retinal dystrophy [RCV004816433]|Severe early-childhood-onset retinal dystrophy [RCV000408599]|not provided [RCV001055307] | pathogenic|likely pathogenic|uncertain significance | 1 | 94001062 | 94001062 | Human | 4 | alternate_id |
| 11664727 | CV237635 | indel | NM_000350.3(ABCA4):c.6283-3_6283-2delinsAG | Severe early-childhood-onset retinal dystrophy [RCV000408569] | pathogenic | 1 | 94001107 | 94001108 | Human | | alternate_id |
| 11664695 | CV237637 | single nucleotide variant | NM_000350.3(ABCA4):c.6077T>C (p.Leu2026Pro) | Cone-rod dystrophy 3 [RCV000763439]|Retinal dystrophy [RCV004816431]|Severe early-childhood-onset retinal dystrophy [RCV000408446]|not provided [RCV000480932] | pathogenic|likely pathogenic | 1 | 94005511 | 94005511 | Human | 8 | alternate_id |
| 11664723 | CV237638 | single nucleotide variant | NM_000350.3(ABCA4):c.5973G>C (p.Val1991=) | Retinal dystrophy [RCV004816430]|Severe early-childhood-onset retinal dystrophy [RCV000408558] | uncertain significance | 1 | 94007666 | 94007666 | Human | 4 | alternate_id |
| 11598681 | CV237639 | single nucleotide variant | NM_000350.3(ABCA4):c.5942C>G (p.Thr1981Arg) | Age related macular degeneration 2 [RCV001197194]|Retinal dystrophy [RCV004816429]|Severe early-childhood-onset retinal dystrophy [RCV000408493] | likely pathogenic | 1 | 94007697 | 94007697 | Human | 6 | alternate_id |
| 11664706 | CV237640 | single nucleotide variant | NM_000350.3(ABCA4):c.5909T>C (p.Leu1970Pro) | Retinal dystrophy [RCV004816428]|Severe early-childhood-onset retinal dystrophy [RCV000408495] | likely pathogenic | 1 | 94007730 | 94007730 | Human | 4 | alternate_id |
| 11598654 | CV237641 | single nucleotide variant | NM_000350.3(ABCA4):c.5881G>A (p.Gly1961Arg) | ABCA4-related disorder [RCV000778996]|Retinal dystrophy [RCV004816427]|Severe early-childhood-onset retinal dystrophy [RCV000408510]|not provided [RCV001229952] | pathogenic|likely pathogenic | 1 | 94008252 | 94008252 | Human | 4 | alternate_id |
| 11598648 | CV237643 | single nucleotide variant | NM_000350.3(ABCA4):c.5714+4C>T | Retinal dystrophy [RCV004816425]|Severe early-childhood-onset retinal dystrophy [RCV000408476]|not provided [RCV001366507] | uncertain significance | 1 | 94010796 | 94010796 | Human | 4 | alternate_id |
| 11664716 | CV237644 | single nucleotide variant | NM_000350.3(ABCA4):c.5656G>A (p.Gly1886Arg) | Retinal dystrophy [RCV004816424]|Severe early-childhood-onset retinal dystrophy [RCV000408529] | likely pathogenic | 1 | 94010858 | 94010858 | Human | 4 | alternate_id |
| 11664726 | CV237646 | single nucleotide variant | NM_000350.3(ABCA4):c.5558C>A (p.Ala1853Asp) | Retinal dystrophy [RCV004816422]|Severe early-childhood-onset retinal dystrophy [RCV000408565] | likely pathogenic | 1 | 94011288 | 94011288 | Human | 4 | alternate_id |
| 11664740 | CV237647 | single nucleotide variant | NM_000350.3(ABCA4):c.5513A>G (p.His1838Arg) | Retinal dystrophy [RCV004816421]|Severe early-childhood-onset retinal dystrophy [RCV000408470]|not provided [RCV001854787] | pathogenic|likely pathogenic | 1 | 94011333 | 94011333 | Human | 4 | alternate_id |
| 11598655 | CV237648 | single nucleotide variant | NM_000350.3(ABCA4):c.5512C>A (p.His1838Asn) | Retinal dystrophy [RCV004816420]|Severe early-childhood-onset retinal dystrophy [RCV000408514]|not provided [RCV003556287] | pathogenic|likely pathogenic | 1 | 94011334 | 94011334 | Human | 4 | alternate_id |
| 11598643 | CV237649 | single nucleotide variant | NM_000350.3(ABCA4):c.5478C>T (p.Asn1826=) | Inborn genetic diseases [RCV004629171]|Retinal dystrophy [RCV004816419]|Severe early-childhood-onset retinal dystrophy [RCV000408453]|not provided [RCV001854786] | likely benign|uncertain significance | 1 | 94011368 | 94011368 | Human | 5 | alternate_id |
| 11598666 | CV237651 | single nucleotide variant | NM_000350.3(ABCA4):c.5318C>T (p.Ala1773Val) | ABCA4-related disorder [RCV004732802]|Cone-rod dystrophy 3 [RCV002485455]|Retinal dystrophy [RCV001074401]|Retinitis pigmentosa 19 [RCV005252827]|Severe early-childhood-onset retinal dystrophy [RCV000408555]|Stargardt disease [RCV000826133]|not provided [RCV0004 41041] | pathogenic|likely pathogenic | 1 | 94014685 | 94014685 | Human | 8 | alternate_id |
| 11664711 | CV237652 | single nucleotide variant | NM_000350.3(ABCA4):c.5312+1G>A | Age related macular degeneration 2 [RCV001196916]|Cone-rod dystrophy [RCV002267732]|Retinal dystrophy [RCV001073541]|Severe early-childhood-onset retinal dystrophy [RCV000408509]|Stargardt disease [RCV005418025]|not provided [RCV001383600] | pathogenic | 1 | 94015738 | 94015738 | Human | 9 | alternate_id |
| 11664725 | CV237653 | single nucleotide variant | NM_000350.3(ABCA4):c.5196+1056A>G | Age related macular degeneration 2 [RCV002247669]|Retinal dystrophy [RCV001074079]|Severe early-childhood-onset retinal dystrophy [RCV000408562]|not provided [RCV001091511] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94018526 | 94018526 | Human | 6 | alternate_id |
| 11664704 | CV237654 | single nucleotide variant | NM_000350.3(ABCA4):c.5196+1013A>G | Severe early-childhood-onset retinal dystrophy [RCV000408490] | uncertain significance | 1 | 94018569 | 94018569 | Human | 2 | alternate_id |
| 11664701 | CV237655 | single nucleotide variant | NM_000350.3(ABCA4):c.5189G>A (p.Trp1730Ter) | Retinal dystrophy [RCV001075418]|Severe early-childhood-onset retinal dystrophy [RCV000408479]|Stargardt disease [RCV001002819] | pathogenic|likely pathogenic | 1 | 94019589 | 94019589 | Human | 4 | alternate_id |
| 11598684 | CV237657 | single nucleotide variant | NM_000350.3(ABCA4):c.5137C>A (p.Gln1713Lys) | ABCA4-related retinopathy [RCV005361363]|Retinal dystrophy [RCV004816417]|Retinitis pigmentosa [RCV005238751]|Severe early-childhood-onset retinal dystrophy [RCV000408584]|not provided [RCV001854785] | pathogenic|likely pathogenic|uncertain significance | 1 | 94019641 | 94019641 | Human | 6 | alternate_id |
| 11664699 | CV237658 | single nucleotide variant | NM_000350.3(ABCA4):c.4979C>T (p.Pro1660Leu) | Retinal dystrophy [RCV004816416]|Severe early-childhood-onset retinal dystrophy [RCV000408473]|Stargardt disease [RCV001002822]|not provided [RCV005090154] | pathogenic|likely pathogenic | 1 | 94021279 | 94021279 | Human | 4 | alternate_id |
| 11598665 | CV237659 | single nucleotide variant | NM_000350.3(ABCA4):c.4773+3A>G | Cone-rod dystrophy 3 [RCV005025377]|Retinal dystrophy [RCV000787761]|Severe early-childhood-onset retinal dystrophy [RCV000408554]|not provided [RCV000425309] | pathogenic|uncertain significance | 1 | 94021843 | 94021843 | Human | 8 | alternate_id |
| 11598642 | CV237660 | single nucleotide variant | NM_000350.3(ABCA4):c.4739T>C (p.Leu1580Ser) | Retinal dystrophy [RCV004816415]|Severe early-childhood-onset retinal dystrophy [RCV000408448]|Stargardt disease [RCV005418024]|not provided [RCV000761665] | likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94021880 | 94021880 | Human | 4 | alternate_id |
| 11664703 | CV237661 | deletion | NM_000350.3(ABCA4):c.4640del (p.Lys1547fs) | Retinal dystrophy [RCV004816414]|Severe early-childhood-onset retinal dystrophy [RCV000408489] | pathogenic | 1 | 94023413 | 94023413 | Human | 4 | alternate_id |
| 11664745 | CV237662 | single nucleotide variant | NM_000350.3(ABCA4):c.4635C>T (p.Ser1545=) | Retinal dystrophy [RCV004816413]|Severe early-childhood-onset retinal dystrophy [RCV000408590] | uncertain significance | 1 | 94023418 | 94023418 | Human | 4 | alternate_id |
| 11664720 | CV237664 | single nucleotide variant | NM_000350.3(ABCA4):c.4540-2036C>A | Severe early-childhood-onset retinal dystrophy [RCV000408541]|not specified [RCV000607126] | likely benign|uncertain significance | 1 | 94027084 | 94027084 | Human | 2 | alternate_id |
| 11598685 | CV237665 | single nucleotide variant | NM_000350.3(ABCA4):c.4519G>A (p.Gly1507Arg) | ABCA4-related disorder [RCV004732801]|Cone-rod dystrophy 3 [RCV005031808]|Retinal dystrophy [RCV001074181]|Severe early-childhood-onset retinal dystrophy [RCV000408586]|Stargardt disease [RCV003401161]|not provided [RCV001380976] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94029465 | 94029465 | Human | 8 | alternate_id |
| 11664702 | CV237666 | single nucleotide variant | NM_000350.3(ABCA4):c.4354G>T (p.Glu1452Ter) | Retinal dystrophy [RCV004816412]|Severe early-childhood-onset retinal dystrophy [RCV000408486]|not provided [RCV002519761] | pathogenic | 1 | 94029630 | 94029630 | Human | 4 | alternate_id |
| 11598669 | CV237667 | single nucleotide variant | NM_000350.3(ABCA4):c.4352+1G>A | Retinal dystrophy [RCV003888652]|Severe early-childhood-onset retinal dystrophy [RCV000408571]|Stargardt disease [RCV005418023]|not provided [RCV001854784] | pathogenic|likely pathogenic | 1 | 94030427 | 94030427 | Human | 4 | alternate_id |
| 11664713 | CV237668 | single nucleotide variant | NM_000350.3(ABCA4):c.4347G>T (p.Trp1449Cys) | Retinal dystrophy [RCV004816411]|Severe early-childhood-onset retinal dystrophy [RCV000408520] | likely pathogenic | 1 | 94030433 | 94030433 | Human | 4 | alternate_id |
| 11664712 | CV237669 | single nucleotide variant | NM_000350.3(ABCA4):c.4254-1G>C | Retinal dystrophy [RCV004816410]|Severe early-childhood-onset retinal dystrophy [RCV000408511]|not provided [RCV001543439] | pathogenic|likely pathogenic | 1 | 94030527 | 94030527 | Human | 4 | alternate_id |
| 11598645 | CV237670 | single nucleotide variant | NM_000350.3(ABCA4):c.4253+5G>A | Cone-rod dystrophy 3 [RCV005025376]|Retinal dystrophy [RCV000504972]|Retinitis pigmentosa [RCV004526649]|Severe early-childhood-onset retinal dystrophy [RCV000408462]|Stargardt disease [RCV000515660]|not provided [RCV001854783] | pathogenic|likely pathogenic | 1 | 94030991 | 94030991 | Human | 10 | alternate_id |
| 11598664 | CV237671 | single nucleotide variant | NM_000350.3(ABCA4):c.4195G>T (p.Glu1399Ter) | ABCA4-related disorder [RCV000778257]|Retinal dystrophy [RCV004816409]|Severe early-childhood-onset retinal dystrophy [RCV000408552] | pathogenic|likely pathogenic | 1 | 94031054 | 94031054 | Human | 4 | alternate_id |
| 11598652 | CV237672 | single nucleotide variant | NM_000350.3(ABCA4):c.4140G>A (p.Pro1380=) | Retinal dystrophy [RCV004816408]|Severe early-childhood-onset retinal dystrophy [RCV000408505]|not provided [RCV001240711] | likely benign|uncertain significance | 1 | 94031109 | 94031109 | Human | 4 | alternate_id |
| 11598662 | CV237674 | single nucleotide variant | NM_000350.3(ABCA4):c.3871C>T (p.Gln1291Ter) | Age related macular degeneration 2 [RCV001198725]|Retinal dystrophy [RCV004816406]|Severe early-childhood-onset retinal dystrophy [RCV000408545]|not provided [RCV001092801] | pathogenic | 1 | 94032035 | 94032035 | Human | 6 | alternate_id |
| 11664707 | CV237675 | single nucleotide variant | NM_000350.3(ABCA4):c.3815T>C (p.Ile1272Thr) | Retinal dystrophy [RCV004816405]|Severe early-childhood-onset retinal dystrophy [RCV000408497] | likely pathogenic | 1 | 94036787 | 94036787 | Human | 4 | alternate_id |
| 11664719 | CV237677 | duplication | NM_000350.3(ABCA4):c.3529_3532dup (p.Ser1178fs) | Retinal dystrophy [RCV004816403]|Severe early-childhood-onset retinal dystrophy [RCV000408539]|not provided [RCV001854782] | pathogenic | 1 | 94040117 | 94040118 | Human | 4 | alternate_id |
| 11598646 | CV237678 | single nucleotide variant | NM_000350.3(ABCA4):c.3482G>A (p.Arg1161His) | Autosomal recessive retinitis pigmentosa [RCV001257844]|Cone-rod dystrophy 3 [RCV005025375]|Cone-rod dystrophy [RCV002267731]|Retinal dystrophy [RCV004816402]|Severe early-childhood-onset retinal dystrophy [RCV000408467]|Stargardt disease [RCV003330593]|not prov ided [RCV000761669] | pathogenic|likely pathogenic | 1 | 94041249 | 94041249 | Human | 12 | alternate_id |
| 11598657 | CV237680 | single nucleotide variant | NM_000350.3(ABCA4):c.3292C>T (p.Arg1098Cys) | Age related macular degeneration 2 [RCV001196593]|Cone-rod dystrophy 3 [RCV004796121]|Retinal dystrophy [RCV001074682]|Severe early-childhood-onset retinal dystrophy [RCV000408518]|not provided [RCV000478178] | pathogenic|likely pathogenic | 1 | 94042797 | 94042797 | Human | 8 | alternate_id |
| 11664696 | CV237682 | deletion | NM_000350.3(ABCA4):c.3093del (p.Gly1032fs) | Cone-rod dystrophy 3 [RCV000449544]|Retinal dystrophy [RCV004816400]|Severe early-childhood-onset retinal dystrophy [RCV000408456]|not provided [RCV001543589] | pathogenic | 1 | 94043433 | 94043433 | Human | 5 | alternate_id |
| 11664749 | CV237683 | single nucleotide variant | NM_000350.3(ABCA4):c.2940G>C (p.Leu980Phe) | Retinal dystrophy [RCV004816399]|Retinitis pigmentosa 19 [RCV005252826]|Severe early-childhood-onset retinal dystrophy [RCV000408600] | uncertain significance | 1 | 94044723 | 94044723 | Human | 5 | alternate_id |
| 11664721 | CV237684 | single nucleotide variant | NM_000350.3(ABCA4):c.2919-10T>C | ABCA4-related disorder [RCV001099947]|Retinal dystrophy [RCV004816398]|Severe early-childhood-onset retinal dystrophy [RCV000408547]|not provided [RCV003556286] | likely pathogenic|uncertain significance | 1 | 94044754 | 94044754 | Human | 4 | alternate_id |
| 11598647 | CV237687 | single nucleotide variant | NM_000350.3(ABCA4):c.2692G>T (p.Glu898Ter) | Retinal dystrophy [RCV004816395]|Severe early-childhood-onset retinal dystrophy [RCV000408471] | pathogenic | 1 | 94048919 | 94048919 | Human | 4 | alternate_id |
| 11598659 | CV237688 | single nucleotide variant | NM_000350.3(ABCA4):c.2609C>T (p.Pro870Leu) | ABCA4-related disorder [RCV004532828]|Retinal dystrophy [RCV001074708]|Severe early-childhood-onset retinal dystrophy [RCV000408530]|Stargardt disease [RCV005406968]|not provided [RCV000490201] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94051677 | 94051677 | Human | 4 | alternate_id |
| 11598668 | CV237689 | single nucleotide variant | NM_000350.3(ABCA4):c.2160+1G>T | Retinal dystrophy [RCV001075206]|Retinitis pigmentosa 19 [RCV001352989]|Severe early-childhood-onset retinal dystrophy [RCV000408563]|not provided [RCV001854780] | pathogenic|likely pathogenic | 1 | 94060536 | 94060536 | Human | 5 | alternate_id |
| 11598667 | CV237690 | single nucleotide variant | NM_000350.3(ABCA4):c.1918C>G (p.Pro640Ala) | Retinal dystrophy [RCV004816394]|Severe early-childhood-onset retinal dystrophy [RCV000408560] | likely pathogenic | 1 | 94062596 | 94062596 | Human | 4 | alternate_id |
| 11664746 | CV237691 | single nucleotide variant | NM_000350.3(ABCA4):c.1891G>A (p.Gly631Arg) | Retinal dystrophy [RCV004816393]|Severe early-childhood-onset retinal dystrophy [RCV000408594]|not provided [RCV005090153] | pathogenic|likely pathogenic | 1 | 94062623 | 94062623 | Human | 4 | alternate_id |
| 11598661 | CV237692 | single nucleotide variant | NM_000350.3(ABCA4):c.1822T>A (p.Phe608Ile) | ABCA4-related disorder [RCV004732800]|Cone-rod dystrophy 3 [RCV001723810]|Retinal dystrophy [RCV001074552]|Retinitis pigmentosa [RCV004782319]|Severe early-childhood-onset retinal dystrophy [RCV000408543]|not provided [RCV001090315] | pathogenic|likely pathogenic | 1 | 94062692 | 94062692 | Human | 7 | alternate_id |
| 11664717 | CV237693 | single nucleotide variant | NM_000350.3(ABCA4):c.1793T>G (p.Val598Gly) | Retinal dystrophy [RCV004816392]|Severe early-childhood-onset retinal dystrophy [RCV000408533] | uncertain significance | 1 | 94062721 | 94062721 | Human | 4 | alternate_id |
| 11664728 | CV237694 | single nucleotide variant | NM_000350.3(ABCA4):c.1719G>A (p.Met573Ile) | Retinal dystrophy [RCV004816391]|Severe early-childhood-onset retinal dystrophy [RCV000408573]|Stargardt disease [RCV000787483] | likely pathogenic | 1 | 94063153 | 94063153 | Human | 4 | alternate_id |
| 11578838 | CV237695 | single nucleotide variant | NM_000350.3(ABCA4):c.1692A>G (p.Pro564=) | ABCA4-related disorder [RCV001100049]|Cone-Rod Dystrophy, Recessive [RCV000339859]|Inborn genetic diseases [RCV003258709]|Macular degeneration [RCV000325173]|Retinal dystrophy [RCV004816390]|Retinitis Pigmentosa, Recessive [RCV000382014]|Severe early-childhood-onset retinal dystrophy [RCV000408477]| Stargardt Disease, Recessive [RCV000290027]|not provided [RCV001441278] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94063180 | 94063180 | Human | 9 | alternate_id |
| 11579236 | CV237696 | single nucleotide variant | NM_000350.3(ABCA4):c.1614C>T (p.Ala538=) | ABCA4-related disorder [RCV001100053]|Cone-Rod Dystrophy, Recessive [RCV000298675]|Inborn genetic diseases [RCV004020725]|Macular degeneration [RCV000312006]|Retinal dystrophy [RCV003888651]|Retinitis Pigmentosa, Recessive [RCV000337235]|Severe early-childhood-onset retinal dystrophy [RCV000408457]| Stargardt Disease, Recessive [RCV000391529]|not provided [RCV001522285] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94063258 | 94063258 | Human | 9 | alternate_id |
| 11664715 | CV237697 | single nucleotide variant | NM_000350.3(ABCA4):c.1584C>A (p.Tyr528Ter) | Retinal dystrophy [RCV004816389]|Severe early-childhood-onset retinal dystrophy [RCV000408522]|not provided [RCV005090152] | pathogenic | 1 | 94063288 | 94063288 | Human | 4 | alternate_id |
| 11664722 | CV237698 | single nucleotide variant | NM_000350.3(ABCA4):c.1357-2A>G | Retinal dystrophy [RCV004816388]|Severe early-childhood-onset retinal dystrophy [RCV000408557]|not provided [RCV005090151] | pathogenic|likely pathogenic | 1 | 94077889 | 94077889 | Human | 4 | alternate_id |
| 11664705 | CV237699 | single nucleotide variant | NM_000350.3(ABCA4):c.1293G>A (p.Trp431Ter) | Age related macular degeneration 2 [RCV001198958]|Retinal dystrophy [RCV004816387]|Severe early-childhood-onset retinal dystrophy [RCV000408492]|not provided [RCV001091615] | pathogenic | 1 | 94078653 | 94078653 | Human | 6 | alternate_id |
| 11598644 | CV237700 | single nucleotide variant | NM_000350.3(ABCA4):c.1239+1G>C | Retinal dystrophy [RCV004816386]|Retinitis pigmentosa [RCV005237763]|Severe early-childhood-onset retinal dystrophy [RCV000408454]|not provided [RCV001091616] | pathogenic | 1 | 94079321 | 94079321 | Human | 6 | alternate_id |
| 11598650 | CV237701 | single nucleotide variant | NM_000350.3(ABCA4):c.1086T>A (p.Tyr362Ter) | Cone-rod dystrophy 3 [RCV005025373]|Retinal dystrophy [RCV001074163]|Severe early-childhood-onset retinal dystrophy [RCV000408494]|not provided [RCV000414174] | pathogenic | 1 | 94080491 | 94080491 | Human | 8 | alternate_id |
| 11664718 | CV237702 | single nucleotide variant | NM_000350.3(ABCA4):c.1009T>C (p.Phe337Leu) | Cone-rod dystrophy 3 [RCV002478825]|Retinal dystrophy [RCV004816385]|Severe early-childhood-onset retinal dystrophy [RCV000408537] | uncertain significance | 1 | 94080568 | 94080568 | Human | 8 | alternate_id |
| 11664714 | CV237705 | single nucleotide variant | NM_000350.3(ABCA4):c.206G>A (p.Trp69Ter) | Retinal dystrophy [RCV004816383]|Severe early-childhood-onset retinal dystrophy [RCV000408521] | pathogenic | 1 | 94111534 | 94111534 | Human | 4 | alternate_id |
| 11598658 | CV237706 | single nucleotide variant | NM_000350.3(ABCA4):c.180G>C (p.Ala60=) | Retinal dystrophy [RCV004816382]|Severe early-childhood-onset retinal dystrophy [RCV000408524] | uncertain significance | 1 | 94111560 | 94111560 | Human | 4 | alternate_id |
| 11664708 | CV237707 | single nucleotide variant | NM_000350.3(ABCA4):c.160+2T>C | Retinal dystrophy [RCV004816381]|Severe early-childhood-onset retinal dystrophy [RCV000408498] | pathogenic | 1 | 94112971 | 94112971 | Human | 4 | alternate_id |
| 11664698 | CV237708 | single nucleotide variant | NM_000350.3(ABCA4):c.160T>G (p.Cys54Gly) | Cone-rod dystrophy 3 [RCV002485454]|Retinal dystrophy [RCV004816380]|Severe early-childhood-onset retinal dystrophy [RCV000408466] | likely pathogenic | 1 | 94112973 | 94112973 | Human | 8 | alternate_id |
| 11664710 | CV237709 | single nucleotide variant | NM_000350.3(ABCA4):c.86T>G (p.Leu29Arg) | Retinal dystrophy [RCV004816379]|Severe early-childhood-onset retinal dystrophy [RCV000408508] | likely pathogenic | 1 | 94113047 | 94113047 | Human | 4 | alternate_id |
| 11598683 | CV237710 | single nucleotide variant | NM_000350.3(ABCA4):c.67-1G>C | Retinal dystrophy [RCV004816378]|Severe early-childhood-onset retinal dystrophy [RCV000408582]|not provided [RCV001091620] | pathogenic | 1 | 94113067 | 94113067 | Human | 4 | alternate_id |
| 156204630 | CV2401436 | deletion | NM_000350.3(ABCA4):c.5637del (p.Phe1880fs) | Retinitis pigmentosa 19 [RCV002789986]|Retinitis pigmentosa [RCV005419588]|Severe early-childhood-onset retinal dystrophy [RCV003229942] | pathogenic|likely pathogenic | 1 | 94010877 | 94010877 | Human | 5 | alternate_id |
| 11346816 | CV242589 | single nucleotide variant | NM_018127.7(ELAC2):c.1458T>C (p.Leu486=) | Combined oxidative phosphorylation defect type 17 [RCV001493371]|not provided [RCV005411256] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity | 17 | 12998474 | 12998474 | Human | 9 | alternate_id |
| 11543427 | CV250030 | single nucleotide variant | NM_000350.3(ABCA4):c.5836-43C>A | Age related macular degeneration 2 [RCV001549135]|Cone-rod dystrophy 3 [RCV001549134]|Retinitis pigmentosa 19 [RCV001548901]|Severe early-childhood-onset retinal dystrophy [RCV001548900]|not provided [RCV001541669]|not specified [RCV000242440] | benign | 1 | 94008340 | 94008340 | Human | 6 | alternate_id |
| 11548999 | CV250031 | deletion | NM_000350.3(ABCA4):c.4774-17_4774-16del | Age related macular degeneration 2 [RCV001549170]|Cone-Rod Dystrophy, Recessive [RCV000272427]|Cone-rod dystrophy 3 [RCV001549169]|Macular degeneration [RCV000331033]|Retinitis Pigmentosa, Recessive [RCV000324962]|Retinitis pigmentosa 19 [RCV001549168]|Severe early-childhood-onset retinal dystrophy [RCV001549167]|Stargardt Disease, Recessive [RCV000364584]|not provided [RCV001518238]|not specified [RCV000249840] | benign | 1 | 94021730 | 94021731 | Human | 10 | alternate_id |
| 11547664 | CV253180 | single nucleotide variant | NM_019098.5(CNGB3):c.1781+10A>T | Achromatopsia 3 [RCV000284921]|Achromatopsia [RCV001833279]|Severe early-childhood-onset retinal dystrophy [RCV000339899]|not provided [RCV001516848]|not specified [RCV000248063] | benign|likely benign | 8 | 86604083 | 86604083 | Human | 6 | alternate_id |
| 11545138 | CV253181 | single nucleotide variant | NM_019098.5(CNGB3):c.1397T>C (p.Met466Thr) | Achromatopsia 3 [RCV000498988]|Achromatopsia [RCV001272738]|Severe early-childhood-onset retinal dystrophy [RCV001162414]|not provided [RCV000961874]|not specified [RCV000244737] | benign|uncertain significance | 8 | 86629002 | 86629002 | Human | 6 | alternate_id |
| 11552417 | CV253182 | single nucleotide variant | NM_019098.5(CNGB3):c.1356G>A (p.Gln452=) | Achromatopsia 3 [RCV000276714]|Achromatopsia [RCV001833278]|Severe early-childhood-onset retinal dystrophy [RCV000370896]|not provided [RCV001510372]|not specified [RCV000254349] | benign|likely benign | 8 | 86629043 | 86629043 | Human | 6 | alternate_id |
| 11543811 | CV253184 | single nucleotide variant | NM_019098.5(CNGB3):c.919A>G (p.Ile307Val) | Achromatopsia 3 [RCV000286399]|Achromatopsia [RCV001272487]|Severe early-childhood-onset retinal dystrophy [RCV000376272]|not provided [RCV001510548]|not specified [RCV000242961] | benign|likely benign | 8 | 86647872 | 86647872 | Human | 6 | alternate_id |
| 11549655 | CV253186 | single nucleotide variant | NM_019098.5(CNGB3):c.702T>G (p.Cys234Trp) | Achromatopsia 3 [RCV000988079]|Achromatopsia [RCV001833281]|Severe early-childhood-onset retinal dystrophy [RCV000364988]|not provided [RCV001522473]|not specified [RCV000250693] | benign | 8 | 86667075 | 86667075 | Human | 6 | alternate_id |
| 11547114 | CV253187 | single nucleotide variant | NM_019098.5(CNGB3):c.608G>A (p.Arg203Gln) | Achromatopsia 3 [RCV000372970]|Achromatopsia [RCV001833280]|Severe early-childhood-onset retinal dystrophy [RCV000316050]|not provided [RCV001522474]|not specified [RCV000247338] | benign|likely benign | 8 | 86668054 | 86668054 | Human | 6 | alternate_id |
| 11543357 | CV253188 | single nucleotide variant | NM_019098.5(CNGB3):c.354G>T (p.Pro118=) | Achromatopsia 3 [RCV001161027]|Achromatopsia [RCV001272491]|Severe early-childhood-onset retinal dystrophy [RCV001161026]|not provided [RCV000961891]|not specified [RCV000242350] | benign|likely benign | 8 | 86671083 | 86671083 | Human | 6 | alternate_id |
| 11545415 | CV253190 | single nucleotide variant | NM_019098.5(CNGB3):c.211+13T>G | Achromatopsia 3 [RCV000357426]|Severe early-childhood-onset retinal dystrophy [RCV000274434]|not provided [RCV001513345]|not specified [RCV000245103] | benign|likely benign | 8 | 86739642 | 86739642 | Human | 3 | alternate_id |
| 11560243 | CV259680 | single nucleotide variant | NM_000350.3(ABCA4):c.1906C>T (p.Gln636Ter) | Cone-rod dystrophy 3 [RCV005025404]|Retinal dystrophy [RCV001075471]|Retinitis pigmentosa 19 [RCV002518745]|Severe early-childhood-onset retinal dystrophy [RCV000504776]|not provided [RCV000256006] | pathogenic | 1 | 94062608 | 94062608 | Human | 8 | alternate_id |
| 11558123 | CV259682 | single nucleotide variant | NM_000350.3(ABCA4):c.838A>T (p.Met280Leu) | ABCA4-related disorder [RCV004542963]|Cone-rod dystrophy 3 [RCV000764206]|not provided [RCV000255612] | likely benign|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94083372 | 94083372 | Human | 6 | alternate_id |
| 11560045 | CV259684 | single nucleotide variant | NM_000350.3(ABCA4):c.655A>T (p.Arg219Ter) | Cone-rod dystrophy 3 [RCV005025403]|Retinal dystrophy [RCV001075801]|not provided [RCV000255556] | pathogenic | 1 | 94098907 | 94098907 | Human | 3 | alternate_id |
| 11558254 | CV260778 | single nucleotide variant | NM_000350.3(ABCA4):c.5333T>A (p.Met1778Lys) | Cone-rod dystrophy 3 [RCV000256375]|Severe early-childhood-onset retinal dystrophy [RCV004563295]|not provided [RCV001859496] | pathogenic|likely pathogenic | 1 | 94014670 | 94014670 | Human | 3 | alternate_id |
| 11639540 | CV265376 | single nucleotide variant | NM_000443.4(ABCB4):c.2800G>A (p.Ala934Thr) | ABCB4-related disorder [RCV004529459]|Cholestasis, intrahepatic, of pregnancy, 3 [RCV001164952]|Progressive familial intrahepatic cholestasis type 1 [RCV000987905]|Progressive familial intrahepatic cholestasis type 3 [RCV001164953]|See cases [RCV002252078]|Severe early-childhood-onset retinal dystro phy [RCV003989517]|not provided [RCV000413855]|not specified [RCV000322710] | likely pathogenic|benign|conflicting interpretations of pathogenicity|uncertain significance | 7 | 87412017 | 87412017 | Human | 5 | alternate_id |
| 11637902 | CV266497 | single nucleotide variant | NM_000350.3(ABCA4):c.6113G>A (p.Arg2038Gln) | Cone-rod dystrophy 3 [RCV005031851]|Severe early-childhood-onset retinal dystrophy [RCV002250614]|not provided [RCV000291561] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94005475 | 94005475 | Human | 6 | alternate_id |
| 401735285 | CV2672019 | single nucleotide variant | NM_000350.3(ABCA4):c.4897G>A (p.Val1633Met) | Severe early-childhood-onset retinal dystrophy [RCV003238174] | uncertain significance | 1 | 94021361 | 94021361 | Human | 2 | alternate_id |
| 11637433 | CV267810 | deletion | NM_000350.3(ABCA4):c.6729+5_6729+19del | Age related macular degeneration 2 [RCV001542553]|Cone-rod dystrophy 3 [RCV000416441]|Cone-rod dystrophy 3 [RCV002480011]|Retinal dystrophy [RCV001074704]|Retinitis pigmentosa 19 [RCV000678515]|Retinitis pigmentosa [RCV000504933]|not provided [RCV000497773] | pathogenic|likely pathogenic|uncertain significance | 1 | 93997842 | 93997856 | Human | 7 | alternate_id |
| 11577705 | CV268056 | single nucleotide variant | NM_019098.5(CNGB3):c.670C>T (p.Leu224Phe) | Achromatopsia 3 [RCV000265676]|Severe early-childhood-onset retinal dystrophy [RCV000302120]|not provided [RCV000312509] | uncertain significance | 8 | 86667107 | 86667107 | Human | 3 | alternate_id |
| 11635937 | CV268061 | single nucleotide variant | NM_019098.5(CNGB3):c.1833C>T (p.His611=) | Achromatopsia 3 [RCV001164345]|Achromatopsia [RCV001272479]|Severe early-childhood-onset retinal dystrophy [RCV001164346]|not provided [RCV000259449] | likely benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86579201 | 86579201 | Human | 6 | alternate_id |
| 11639176 | CV271072 | single nucleotide variant | NM_000350.3(ABCA4):c.2819C>G (p.Pro940Arg) | ABCA4-related disorder [RCV001101951]|Cone-rod dystrophy 3 [RCV002487242]|Cone-rod dystrophy 3 [RCV004786655]|Retinal dystrophy [RCV001075267]|not provided [RCV000316390] | uncertain significance | 1 | 94047018 | 94047018 | Human | 8 | alternate_id |
| 11643206 | CV272562 | single nucleotide variant | NM_000350.3(ABCA4):c.1343T>A (p.Met448Lys) | Cone-rod dystrophy 3 [RCV005025431]|Retinal dystrophy [RCV004816512]|Stargardt disease [RCV004586668]|not provided [RCV000388365] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94078603 | 94078603 | Human | 4 | alternate_id |
| 11580297 | CV272578 | single nucleotide variant | NM_000350.3(ABCA4):c.2023G>A (p.Val675Ile) | Cone-rod dystrophy 3 [RCV005025432]|Retinal dystrophy [RCV001074658]|Severe early-childhood-onset retinal dystrophy [RCV000329208]|Stargardt disease 3 [RCV004558613]|not provided [RCV000478104] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94060674 | 94060674 | Human | 9 | alternate_id |
| 11643914 | CV272971 | single nucleotide variant | NM_019098.5(CNGB3):c.912C>T (p.Val304=) | Achromatopsia 3 [RCV001159528]|Achromatopsia [RCV001828257]|Severe early-childhood-onset retinal dystrophy [RCV001159529]|not provided [RCV000892241]|not specified [RCV000401931] | benign|likely benign|uncertain significance | 8 | 86647879 | 86647879 | Human | 6 | alternate_id |
| 11582292 | CV273547 | single nucleotide variant | NM_000350.3(ABCA4):c.3056C>T (p.Thr1019Met) | Cone-rod dystrophy 3 [RCV005025438]|Retinal dystrophy [RCV001074386]|Retinitis pigmentosa 19 [RCV005252863]|Severe early-childhood-onset retinal dystrophy [RCV004558614]|Stargardt disease [RCV001002835]|not provided [RCV000412846] | pathogenic|likely pathogenic | 1 | 94043470 | 94043470 | Human | 8 | alternate_id |
| 401829074 | CV2743578 | single nucleotide variant | NM_000350.3(ABCA4):c.769-784C>T | ABCA4-related disorder [RCV004529625]|Optic atrophy [RCV004818325]|Retinal dystrophy [RCV004818324]|Stargardt disease [RCV005406664]|not provided [RCV003326754] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94084225 | 94084225 | Human | 6 | alternate_id |
| 11638731 | CV275240 | single nucleotide variant | NM_019098.5(CNGB3):c.1510A>G (p.Thr504Ala) | Achromatopsia 3 [RCV001160803]|Achromatopsia [RCV001276130]|Severe early-childhood-onset retinal dystrophy [RCV001160802]|not provided [RCV000308981] | benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86626051 | 86626051 | Human | 6 | alternate_id |
| 401855365 | CV2752887 | duplication | NM_000350.3(ABCA4):c.5371dup (p.Ala1791fs) | Severe early-childhood-onset retinal dystrophy [RCV003337941]|not provided [RCV003679189] | pathogenic|likely pathogenic | 1 | 94014631 | 94014632 | Human | 2 | alternate_id |
| 401928113 | CV2795523 | deletion | NM_000350.3(ABCA4):c.3732del (p.Ser1245fs) | Severe early-childhood-onset retinal dystrophy [RCV003389568] | pathogenic | 1 | 94037226 | 94037226 | Human | 2 | alternate_id |
| 401928308 | CV2795539 | single nucleotide variant | NM_000350.3(ABCA4):c.1820G>T (p.Gly607Val) | Severe early-childhood-onset retinal dystrophy [RCV003389584] | likely pathogenic | 1 | 94062694 | 94062694 | Human | 2 | alternate_id |
| 401928152 | CV2795548 | single nucleotide variant | NM_000350.3(ABCA4):c.4540-1573C>T | Severe early-childhood-onset retinal dystrophy [RCV003389592] | uncertain significance | 1 | 94026621 | 94026621 | Human | 2 | alternate_id |
| 401927924 | CV2795549 | single nucleotide variant | NM_000350.3(ABCA4):c.5714+103A>G | Severe early-childhood-onset retinal dystrophy [RCV003389593] | uncertain significance | 1 | 94010697 | 94010697 | Human | 2 | alternate_id |
| 401927949 | CV2795552 | single nucleotide variant | NM_000350.3(ABCA4):c.4192G>A (p.Gly1398Ser) | Severe early-childhood-onset retinal dystrophy [RCV003389596] | likely pathogenic | 1 | 94031057 | 94031057 | Human | 2 | alternate_id |
| 401928015 | CV2795560 | single nucleotide variant | NM_000350.3(ABCA4):c.570+1818G>T | Severe early-childhood-onset retinal dystrophy [RCV003389604] | uncertain significance | 1 | 94101197 | 94101197 | Human | 2 | alternate_id |
| 11581818 | CV281365 | single nucleotide variant | NM_000350.3(ABCA4):c.3385C>T (p.Arg1129Cys) | Retinal dystrophy [RCV004816524]|Severe early-childhood-onset retinal dystrophy [RCV005235252]|not provided [RCV000413704] | pathogenic|likely pathogenic|uncertain significance|no classifications from unflagged records | 1 | 94041346 | 94041346 | Human | 4 | alternate_id |
| 8563540 | CV28206 | single nucleotide variant | NM_000322.5(PRPH2):c.515G>A (p.Arg172Gln) | Choroidal dystrophy, central areolar 2 [RCV000014053]|Macular dystrophy [RCV000787664]|PRPH2-related disorder [RCV001054658]|Patterned dystrophy of the retinal pigment epithelium [RCV001250353]|Retinal dystrophy [RCV001074392]|Retinitis pigmentosa 7 [RCV005234784]|Retinitis pigmentosa [RCV000787663] |Stargardt disease [RCV001250367]|Vitelliform macular dystrophy 3 [RCV001799605]|not provided [RCV000084982] | pathogenic|likely pathogenic|not provided | 6 | 42721820 | 42721820 | Human | 11 | alternate_id |
| 8563543 | CV28209 | single nucleotide variant | NM_000322.5(PRPH2):c.514C>T (p.Arg172Trp) | Choroidal dystrophy, central areolar 2 [RCV000014056]|Cone-rod dystrophy [RCV001250350]|PRPH2-related disorder [RCV001049315]|Patterned dystrophy of the retinal pigment epithelium [RCV001250349]|Patterned macular dystrophy 1 [RCV001352972]|Retinal dystrophy [RCV003887869]|Retinitis pigmentosa 7 [RCV 002466402]|Retinitis pigmentosa [RCV001250348]|Stargardt disease [RCV001250352]|Vitelliform macular dystrophy 2 [RCV001250351]|maculopathy [RCV001003147]|not provided [RCV000084981] | pathogenic|likely pathogenic|not provided | 6 | 42721821 | 42721821 | Human | 14 | alternate_id |
| 8563546 | CV28212 | single nucleotide variant | NM_000322.5(PRPH2):c.629C>G (p.Pro210Arg) | PRPH2-related disorder [RCV000322776]|Patterned dystrophy of the retinal pigment epithelium [RCV001250287]|Retinal dystrophy [RCV001074849]|Stargardt disease [RCV001250286]|Vitelliform macular dystrophy 2 [RCV001250288]|Vitelliform macular dystrophy 3 [RCV002508 119]|not provided [RCV000084997] | pathogenic|likely pathogenic|uncertain significance|not provided | 6 | 42704564 | 42704564 | Human | 7 | alternate_id |
| 8563550 | CV28216 | deletion | NM_000322.5(PRPH2):c.113del (p.Gly38fs) | PRPH2-related disorder [RCV001851844]|Retinal dystrophy [RCV001074733]|Stargardt disease [RCV001250275]|Vitelliform macular dystrophy 3 [RCV002508122]|not provided [RCV000084953] | pathogenic|not provided | 6 | 42722222 | 42722222 | Human | 5 | alternate_id |
| 8563551 | CV28217 | microsatellite | NM_000322.5(PRPH2):c.458AGA[1] (p.Lys154del) | Cone-rod dystrophy [RCV001250325]|PRPH2-related disorder [RCV001379857]|Patterned macular dystrophy 1 [RCV000149467]|Retinal dystrophy [RCV004814902]|Retinitis pigmentosa 7 [RCV000014064]|Stargardt disease [RCV001250324]|not provided [RCV000084974] | pathogenic|likely pathogenic|not provided | 6 | 42721872 | 42721874 | Human | | alternate_id |
| 8563552 | CV28218 | single nucleotide variant | NM_000322.5(PRPH2):c.136C>T (p.Arg46Ter) | Choroidal dystrophy, central areolar 2 [RCV003987319]|PRPH2-related disorder [RCV001039794]|Patterned dystrophy of the retinal pigment epithelium [RCV001250291]|Patterned macular dystrophy 1 [RCV000987699]|Retinal dystrophy [RCV001075450]|Retinitis pigmentosa 7 [RCV000014067]|Star t:700;'>Stargardt disease [RCV001250276]|not provided [RCV000084955] | pathogenic|likely pathogenic|not provided | 6 | 42722199 | 42722199 | Human | 8 | alternate_id |
| 8563556 | CV28222 | single nucleotide variant | NM_000322.5(PRPH2):c.424C>T (p.Arg142Trp) | Choroidal dystrophy, central areolar 2 [RCV000014071]|Cone dystrophy [RCV000678606]|PRPH2-related disorder [RCV001061048]|Patterned dystrophy of the retinal pigment epithelium [RCV001250319]|Patterned macular dystrophy 1 [RCV001353001]|Progressive cone dystrophy (without rod involvement) [RCV0007876 61]|Retinal dystrophy [RCV001075677]|Retinitis pigmentosa [RCV001250320]|Stargardt disease [RCV001250318]|maculopathy [RCV001003149]|not provided [RCV000084971] | pathogenic|likely pathogenic|no classifications from unflagged records|not provided | 6 | 42721911 | 42721911 | Human | 11 | alternate_id |
| 401944454 | CV2831393 | single nucleotide variant | NM_000350.3(ABCA4):c.2424C>G (p.Tyr808Ter) | Cone-rod dystrophy 3 [RCV005036807]|Severe early-childhood-onset retinal dystrophy [RCV003445397]|not provided [RCV003553940] | pathogenic | 1 | 94055274 | 94055274 | Human | 6 | alternate_id |
| 11579110 | CV283291 | single nucleotide variant | NM_000350.3(ABCA4):c.1319A>G (p.Tyr440Cys) | ABCA4-related disorder [RCV001102042]|Cone-Rod Dystrophy, Recessive [RCV000387710]|Cone-rod dystrophy 3 [RCV005429014]|Macular degeneration [RCV000343633]|Retinal dystrophy [RCV004816525]|Retinitis Pigmentosa, Recessive [RCV000295678]|Stargardt Disease, Recessiv e [RCV000330893]|not provided [RCV000523526] | likely pathogenic|uncertain significance|not provided | 1 | 94078627 | 94078627 | Human | 10 | alternate_id |
| 11578656 | CV283437 | single nucleotide variant | NM_000350.3(ABCA4):c.1522C>T (p.Arg508Cys) | Cone-rod dystrophy 3 [RCV005252868]|Macular degeneration [RCV000286324]|Retinal dystrophy [RCV001073691]|Retinitis Pigmentosa, Recessive [RCV000378419]|Retinitis pigmentosa [RCV003323503]|Severe early-childhood-onset retinal dystrophy [RCV001590914]|not provided [RCV001303441] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94077722 | 94077722 | Human | 9 | alternate_id |
| 405027975 | CV2853301 | single nucleotide variant | NM_000350.3(ABCA4):c.6454G>A (p.Gly2152Ser) | Severe early-childhood-onset retinal dystrophy [RCV003494496] | likely pathogenic | 1 | 94000861 | 94000861 | Human | 2 | alternate_id |
| 405158883 | CV2898244 | single nucleotide variant | NM_000350.3(ABCA4):c.6479+1G>C | Severe early-childhood-onset retinal dystrophy [RCV005235721]|not provided [RCV003562249] | pathogenic|likely pathogenic | 1 | 94000835 | 94000835 | Human | 2 | alternate_id |
| 405159618 | CV2898282 | single nucleotide variant | NM_000350.3(ABCA4):c.559C>T (p.Arg187Cys) | Cone-rod dystrophy 3 [RCV005036878]|not provided [RCV003562273] | likely pathogenic | 1 | 94103026 | 94103026 | Human | 1 | alternate_id |
| 405093263 | CV2947162 | single nucleotide variant | NM_000350.3(ABCA4):c.5486T>C (p.Leu1829Pro) | Cone-rod dystrophy 3 [RCV004796834]|not provided [RCV003665440] | pathogenic|uncertain significance | 1 | 94011360 | 94011360 | Human | 1 | alternate_id |
| 405077525 | CV3008184 | duplication | NM_000350.3(ABCA4):c.6705dup (p.Val2236fs) | Cone-rod dystrophy 3 [RCV005030190]|not provided [RCV003716878] | pathogenic|likely pathogenic | 1 | 93997884 | 93997885 | Human | 1 | alternate_id |
| 11608576 | CV305952 | single nucleotide variant | NM_019098.4(CNGB3):c.*1639C>A | Achromatopsia 3 [RCV000402102]|Severe early-childhood-onset retinal dystrophy [RCV000356615]|not provided [RCV004712636] | benign | 8 | 86574165 | 86574165 | Human | 3 | alternate_id |
| 11606176 | CV305953 | single nucleotide variant | NM_019098.5(CNGB3):c.*1371G>T | Achromatopsia 3 [RCV000378267]|Severe early-childhood-onset retinal dystrophy [RCV000328305] | uncertain significance | 8 | 86574433 | 86574433 | Human | 3 | alternate_id |
| 11606762 | CV305957 | single nucleotide variant | NM_019098.5(CNGB3):c.*1183T>C | Achromatopsia 3 [RCV000335315]|Severe early-childhood-onset retinal dystrophy [RCV000375939] | uncertain significance | 8 | 86574621 | 86574621 | Human | 3 | alternate_id |
| 11607225 | CV305964 | single nucleotide variant | NM_019098.5(CNGB3):c.*84C>T | Achromatopsia 3 [RCV000399337]|Severe early-childhood-onset retinal dystrophy [RCV000340724] | uncertain significance | 8 | 86575720 | 86575720 | Human | 3 | alternate_id |
| 11604063 | CV305970 | single nucleotide variant | NM_019098.5(CNGB3):c.*51C>T | Achromatopsia 3 [RCV000305713]|Severe early-childhood-onset retinal dystrophy [RCV000360498] | uncertain significance | 8 | 86575753 | 86575753 | Human | 3 | alternate_id |
| 11598966 | CV305971 | single nucleotide variant | NM_019098.5(CNGB3):c.2308G>T (p.Val770Phe) | Achromatopsia 3 [RCV000356702]|Retinal dystrophy [RCV004816625]|Severe early-childhood-onset retinal dystrophy [RCV000261883]|not provided [RCV001034257] | likely benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86575926 | 86575926 | Human | 5 | alternate_id |
| 11603570 | CV305972 | single nucleotide variant | NM_019098.5(CNGB3):c.1531G>A (p.Ala511Thr) | Achromatopsia 3 [RCV000301489]|Achromatopsia [RCV001276129]|Severe early-childhood-onset retinal dystrophy [RCV000356262]|not provided [RCV000931567] | likely benign|uncertain significance | 8 | 86626030 | 86626030 | Human | 6 | alternate_id |
| 11602403 | CV305985 | single nucleotide variant | NM_019098.4(CNGB3):c.-32T>C | Achromatopsia 3 [RCV000290745]|Severe early-childhood-onset retinal dystrophy [RCV000382884] | uncertain significance | 8 | 86743659 | 86743659 | Human | 3 | alternate_id |
| 407451574 | CV3081078 | deletion | NM_000350.3(ABCA4):c.5569_5570del (p.Val1857fs) | Severe early-childhood-onset retinal dystrophy [RCV004691594]|not provided [RCV005101427] | pathogenic|likely pathogenic | 1 | 94011276 | 94011277 | Human | 2 | alternate_id |
| 407451669 | CV3081089 | deletion | NM_000350.3(ABCA4):c.2203del (p.Leu735fs) | Severe early-childhood-onset retinal dystrophy [RCV004691605] | likely pathogenic | 1 | 94056780 | 94056780 | Human | 2 | alternate_id |
| 11599017 | CV309029 | single nucleotide variant | NM_022726.4(ELOVL4):c.351T>A (p.Asn117Lys) | ELOVL4-related disorder [RCV004737455]|Inborn genetic diseases [RCV002524509]|Spinocerebellar ataxia type 34 [RCV000765894]|Stargardt disease 3 [RCV000262008]|not provided [RCV000595647] | likely benign|conflicting interpretations of pathogenicity|uncertain significance | 6 | 79924970 | 79924970 | Human | 4 | alternate_id |
| 11600827 | CV309991 | single nucleotide variant | NM_019098.5(CNGB3):c.*1470G>C | Achromatopsia 3 [RCV000313249]|Severe early-childhood-onset retinal dystrophy [RCV000276887] | uncertain significance | 8 | 86574334 | 86574334 | Human | 3 | alternate_id |
| 11645894 | CV309997 | single nucleotide variant | NM_019098.5(CNGB3):c.*731C>T | Achromatopsia 3 [RCV000357675]|Severe early-childhood-onset retinal dystrophy [RCV000267694] | uncertain significance | 8 | 86575073 | 86575073 | Human | 3 | alternate_id |
| 11598700 | CV310004 | single nucleotide variant | NM_019098.5(CNGB3):c.*389A>C | Achromatopsia 3 [RCV000259273]|Severe early-childhood-onset retinal dystrophy [RCV000319178] | benign|likely benign | 8 | 86575415 | 86575415 | Human | 3 | alternate_id |
| 11604504 | CV310005 | single nucleotide variant | NM_019098.5(CNGB3):c.*125G>C | Achromatopsia 3 [RCV000310278]|Severe early-childhood-onset retinal dystrophy [RCV000398127] | likely benign|uncertain significance | 8 | 86575679 | 86575679 | Human | 3 | alternate_id |
| 11606868 | CV310008 | single nucleotide variant | NM_019098.5(CNGB3):c.1534A>G (p.Ile512Val) | Achromatopsia 3 [RCV000336568]|Achromatopsia [RCV001833481]|Severe early-childhood-onset retinal dystrophy [RCV000394987]|not provided [RCV000487572]|not specified [RCV001700999] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86626027 | 86626027 | Human | 6 | alternate_id |
| 11650562 | CV310011 | single nucleotide variant | NM_019098.5(CNGB3):c.773T>C (p.Ile258Thr) | Achromatopsia 3 [RCV000348660]|Severe early-childhood-onset retinal dystrophy [RCV000293482] | uncertain significance | 8 | 86667004 | 86667004 | Human | 3 | alternate_id |
| 11604838 | CV310012 | single nucleotide variant | NM_019098.5(CNGB3):c.739G>A (p.Ala247Thr) | Achromatopsia 3 [RCV000313538]|Achromatopsia [RCV001828365]|Severe early-childhood-onset retinal dystrophy [RCV000394090]|not provided [RCV001220465] | uncertain significance | 8 | 86667038 | 86667038 | Human | 6 | alternate_id |
| 11607583 | CV310016 | single nucleotide variant | NM_019098.5(CNGB3):c.738C>T (p.Thr246=) | Achromatopsia 3 [RCV000345096]|Severe early-childhood-onset retinal dystrophy [RCV000390143]|not provided [RCV001489377] | likely benign|uncertain significance | 8 | 86667039 | 86667039 | Human | 3 | alternate_id |
| 11599838 | CV315302 | single nucleotide variant | NM_019098.5(CNGB3):c.*1459C>T | Achromatopsia 3 [RCV000268759]|Severe early-childhood-onset retinal dystrophy [RCV000363365] | uncertain significance | 8 | 86574345 | 86574345 | Human | 3 | alternate_id |
| 11645382 | CV315315 | single nucleotide variant | NM_019098.5(CNGB3):c.*1368T>C | Achromatopsia 3 [RCV000324660]|Severe early-childhood-onset retinal dystrophy [RCV000264854] | uncertain significance | 8 | 86574436 | 86574436 | Human | 3 | alternate_id |
| 11658743 | CV315316 | single nucleotide variant | NM_019098.5(CNGB3):c.*798A>C | Achromatopsia 3 [RCV000399193]|Severe early-childhood-onset retinal dystrophy [RCV000351306]|not provided [RCV004696091] | uncertain significance | 8 | 86575006 | 86575006 | Human | 3 | alternate_id |
| 11604194 | CV315319 | single nucleotide variant | NM_019098.5(CNGB3):c.*778T>C | Achromatopsia 3 [RCV000307150]|Severe early-childhood-onset retinal dystrophy [RCV000366427] | benign|likely benign | 8 | 86575026 | 86575026 | Human | 3 | alternate_id |
| 11602782 | CV315320 | single nucleotide variant | NM_019098.5(CNGB3):c.*379T>G | Achromatopsia 3 [RCV000374155]|Severe early-childhood-onset retinal dystrophy [RCV000293703] | uncertain significance | 8 | 86575425 | 86575425 | Human | 3 | alternate_id |
| 11607902 | CV315321 | single nucleotide variant | NM_019098.5(CNGB3):c.*293T>C | Achromatopsia 3 [RCV000389094]|Severe early-childhood-onset retinal dystrophy [RCV000348561] | uncertain significance | 8 | 86575511 | 86575511 | Human | 3 | alternate_id |
| 11600811 | CV315322 | single nucleotide variant | NM_019098.5(CNGB3):c.2248C>T (p.Pro750Ser) | Achromatopsia 3 [RCV000277134]|Severe early-childhood-onset retinal dystrophy [RCV000332145]|not provided [RCV001239882] | likely benign|uncertain significance | 8 | 86575986 | 86575986 | Human | 3 | alternate_id |
| 11601847 | CV315324 | single nucleotide variant | NM_019098.5(CNGB3):c.1714C>G (p.Leu572Val) | Achromatopsia 3 [RCV000394996]|Severe early-childhood-onset retinal dystrophy [RCV000286042] | uncertain significance | 8 | 86604160 | 86604160 | Human | 3 | alternate_id |
| 11599704 | CV315330 | single nucleotide variant | NM_019098.5(CNGB3):c.624C>T (p.Asn208=) | Achromatopsia 3 [RCV000267952]|Severe early-childhood-onset retinal dystrophy [RCV000361581]|not provided [RCV000927857] | likely benign|uncertain significance | 8 | 86668038 | 86668038 | Human | 3 | alternate_id |
| 11606245 | CV315332 | single nucleotide variant | NM_019098.4(CNGB3):c.-36T>G | Achromatopsia 3 [RCV000376943]|Severe early-childhood-onset retinal dystrophy [RCV000329394]|not provided [RCV001653741] | benign|likely benign | 8 | 86743663 | 86743663 | Human | 3 | alternate_id |
| 11651117 | CV315403 | single nucleotide variant | NM_019098.4(CNGB3):c.*1701C>T | Achromatopsia 3 [RCV000297130]|Severe early-childhood-onset retinal dystrophy [RCV000398362] | uncertain significance | 8 | 86574103 | 86574103 | Human | 3 | alternate_id |
| 11604744 | CV315407 | single nucleotide variant | NM_019098.4(CNGB3):c.*1638G>A | Achromatopsia 3 [RCV000312215]|Severe early-childhood-onset retinal dystrophy [RCV000366928]|not provided [RCV004712637] | benign|likely benign | 8 | 86574166 | 86574166 | Human | 3 | alternate_id |
| 11601215 | CV315408 | single nucleotide variant | NM_019098.5(CNGB3):c.*1303G>A | Achromatopsia 3 [RCV000280351]|Severe early-childhood-onset retinal dystrophy [RCV000379480]|not provided [RCV004712638] | benign|likely benign | 8 | 86574501 | 86574501 | Human | 3 | alternate_id |
| 11648283 | CV315410 | single nucleotide variant | NM_019098.5(CNGB3):c.*1093C>T | Achromatopsia 3 [RCV000350006]|Severe early-childhood-onset retinal dystrophy [RCV000281044] | uncertain significance | 8 | 86574711 | 86574711 | Human | 3 | alternate_id |
| 11600100 | CV315413 | single nucleotide variant | NM_019098.5(CNGB3):c.*735A>G | Achromatopsia 3 [RCV000271226]|Severe early-childhood-onset retinal dystrophy [RCV000302975]|not provided [RCV004712639] | benign|likely benign | 8 | 86575069 | 86575069 | Human | 3 | alternate_id |
| 11605693 | CV315416 | single nucleotide variant | NM_019098.5(CNGB3):c.*621G>A | Achromatopsia 3 [RCV000372583]|Severe early-childhood-onset retinal dystrophy [RCV000322621] | likely benign|uncertain significance | 8 | 86575183 | 86575183 | Human | 3 | alternate_id |
| 11650755 | CV315435 | single nucleotide variant | NM_019098.5(CNGB3):c.*206G>A | Achromatopsia 3 [RCV000295002]|Severe early-childhood-onset retinal dystrophy [RCV000345303] | uncertain significance | 8 | 86575598 | 86575598 | Human | 3 | alternate_id |
| 11603168 | CV315436 | single nucleotide variant | NM_019098.5(CNGB3):c.2420C>G (p.Ala807Gly) | Achromatopsia 3 [RCV000399992]|Achromatopsia [RCV001833480]|Retinal dystrophy [RCV004816624]|Severe early-childhood-onset retinal dystrophy [RCV000297206]|not provided [RCV000762525]|not specified [RCV000608300] | benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86575814 | 86575814 | Human | 8 | alternate_id |
| 11606164 | CV315445 | single nucleotide variant | NM_019098.5(CNGB3):c.1815T>G (p.Thr605=) | Achromatopsia 3 [RCV000328479]|Achromatopsia [RCV001828363]|Severe early-childhood-onset retinal dystrophy [RCV000383096]|not provided [RCV000980205] | pathogenic|benign|likely benign|uncertain significance | 8 | 86579219 | 86579219 | Human | 6 | alternate_id |
| 11604635 | CV315446 | single nucleotide variant | NM_019098.5(CNGB3):c.1498A>G (p.Lys500Glu) | Achromatopsia 3 [RCV000398277]|Severe early-childhood-onset retinal dystrophy [RCV000311516] | uncertain significance | 8 | 86626063 | 86626063 | Human | 3 | alternate_id |
| 11655600 | CV315450 | single nucleotide variant | NM_019098.5(CNGB3):c.1160A>G (p.Tyr387Cys) | Achromatopsia 3 [RCV000327065]|Achromatopsia [RCV001828364]|Severe early-childhood-onset retinal dystrophy [RCV000363049]|not provided [RCV001346392] | uncertain significance | 8 | 86643769 | 86643769 | Human | 6 | alternate_id |
| 11605712 | CV315454 | single nucleotide variant | NM_019098.5(CNGB3):c.913G>A (p.Ala305Thr) | Achromatopsia 3 [RCV000322833]|Achromatopsia [RCV001272747]|Retinal dystrophy [RCV004816626]|Severe early-childhood-onset retinal dystrophy [RCV000372778]|not provided [RCV000762528] | conflicting interpretations of pathogenicity|uncertain significance | 8 | 86647878 | 86647878 | Human | 8 | alternate_id |
| 11599012 | CV315455 | single nucleotide variant | NM_019098.5(CNGB3):c.595G>A (p.Glu199Lys) | Achromatopsia 3 [RCV000261965]|Achromatopsia [RCV001272490]|Severe early-childhood-onset retinal dystrophy [RCV000319376]|not provided [RCV000947120] | benign|likely benign | 8 | 86668067 | 86668067 | Human | 6 | alternate_id |
| 11608090 | CV315456 | single nucleotide variant | NM_019098.5(CNGB3):c.494-11T>C | Achromatopsia 3 [RCV000389093]|Severe early-childhood-onset retinal dystrophy [RCV000350722]|not provided [RCV001499322] | benign|likely benign | 8 | 86668179 | 86668179 | Human | 3 | alternate_id |
| 11604500 | CV315461 | single nucleotide variant | NM_019098.5(CNGB3):c.331C>G (p.Pro111Ala) | Achromatopsia 3 [RCV000397541]|Severe early-childhood-onset retinal dystrophy [RCV000309960]|not provided [RCV001090383] | uncertain significance | 8 | 86726538 | 86726538 | Human | 3 | alternate_id |
| 11604089 | CV315462 | single nucleotide variant | NM_019098.5(CNGB3):c.212-3T>C | Achromatopsia 3 [RCV000306056]|Achromatopsia [RCV001272755]|Severe early-childhood-onset retinal dystrophy [RCV000353793]|not provided [RCV000897140] | benign|likely benign|uncertain significance | 8 | 86726660 | 86726660 | Human | 6 | alternate_id |
| 11600890 | CV315470 | single nucleotide variant | NM_019098.5(CNGB3):c.43G>C (p.Gly15Arg) | Achromatopsia 3 [RCV000277976]|Achromatopsia [RCV001272756]|Severe early-childhood-onset retinal dystrophy [RCV000325972]|not provided [RCV000900243] | likely benign|uncertain significance | 8 | 86743585 | 86743585 | Human | 6 | alternate_id |
| 405711505 | CV3225879 | single nucleotide variant | NM_000350.3(ABCA4):c.6044G>T (p.Gly2015Val) | Severe early-childhood-onset retinal dystrophy [RCV003990938] | likely pathogenic | 1 | 94005544 | 94005544 | Human | 2 | alternate_id |
| 405853390 | CV3392721 | single nucleotide variant | NM_000350.3(ABCA4):c.5351T>C (p.Leu1784Pro) | Cone-rod dystrophy 3 [RCV005023562]|Stargardt disease [RCV004526446] | pathogenic | 1 | 94014652 | 94014652 | Human | 2 | alternate_id |
| 405853402 | CV3392733 | deletion | NM_000350.3(ABCA4):c.2055del (p.Thr685_Leu686insTer) | Cone-rod dystrophy 3 [RCV005023563]|Retinitis pigmentosa [RCV004526458] | pathogenic | 1 | 94060642 | 94060642 | Human | 3 | alternate_id |
| 405867325 | CV3394300 | single nucleotide variant | NM_000350.3(ABCA4):c.1230A>G (p.Ile410Met) | Severe early-childhood-onset retinal dystrophy [RCV004566417] | pathogenic | 1 | 94079331 | 94079331 | Human | 2 | alternate_id |
| 405867443 | CV3397753 | deletion | NM_000350.3(ABCA4):c.4804del (p.Ile1602fs) | Severe early-childhood-onset retinal dystrophy [RCV004566504] | likely pathogenic | 1 | 94021684 | 94021684 | Human | 2 | alternate_id |
| 405867444 | CV3397754 | single nucleotide variant | NM_000350.3(ABCA4):c.5335T>C (p.Tyr1779His) | Severe early-childhood-onset retinal dystrophy [RCV004566505] | likely pathogenic | 1 | 94014668 | 94014668 | Human | 2 | alternate_id |
| 405867445 | CV3397755 | single nucleotide variant | NM_000350.3(ABCA4):c.6394G>T (p.Glu2132Ter) | Severe early-childhood-onset retinal dystrophy [RCV004566506] | likely pathogenic | 1 | 94000921 | 94000921 | Human | 2 | alternate_id |
| 405867446 | CV3397756 | single nucleotide variant | NM_000350.3(ABCA4):c.6282+3A>T | Severe early-childhood-onset retinal dystrophy [RCV004566507] | uncertain significance | 1 | 94001855 | 94001855 | Human | 2 | alternate_id |
| 405867626 | CV3397944 | single nucleotide variant | NM_000350.3(ABCA4):c.6220G>T (p.Gly2074Cys) | Severe early-childhood-onset retinal dystrophy [RCV004574944] | pathogenic | 1 | 94001920 | 94001920 | Human | 2 | alternate_id |
| 596924323 | CV3407844 | single nucleotide variant | NM_000350.3(ABCA4):c.1017G>A (p.Trp339Ter) | Retinal dystrophy [RCV004814304]|Retinitis pigmentosa [RCV005059570]|Severe early-childhood-onset retinal dystrophy [RCV004776461] | pathogenic|likely pathogenic | 1 | 94080560 | 94080560 | Human | 6 | alternate_id |
| 407427610 | CV3410760 | single nucleotide variant | NM_000350.3(ABCA4):c.2654-2A>C | Cone-rod dystrophy 3 [RCV004586407] | likely pathogenic | 1 | 94048959 | 94048959 | Human | 1 | alternate_id |
| 408393926 | CV3526284 | single nucleotide variant | NM_000350.3(ABCA4):c.6083C>G (p.Thr2028Arg) | Severe early-childhood-onset retinal dystrophy [RCV004771716] | uncertain significance | 1 | 94005505 | 94005505 | Human | 2 | alternate_id |
| 596922073 | CV3529602 | single nucleotide variant | NM_000350.3(ABCA4):c.4539+1G>C | Severe early-childhood-onset retinal dystrophy [RCV004776478] | likely pathogenic | 1 | 94029444 | 94029444 | Human | 2 | alternate_id |
| 596922082 | CV3529611 | single nucleotide variant | NM_000350.3(ABCA4):c.1597C>T (p.Gln533Ter) | Severe early-childhood-onset retinal dystrophy [RCV004776487] | likely pathogenic | 1 | 94063275 | 94063275 | Human | 2 | alternate_id |
| 596927709 | CV3541090 | duplication | NM_000350.3(ABCA4):c.2063dup (p.Asn688fs) | Cone-rod dystrophy 3 [RCV004796960] | pathogenic | 1 | 94060633 | 94060634 | Human | 1 | alternate_id |
| 596927457 | CV3541091 | single nucleotide variant | NM_000350.3(ABCA4):c.5461-6T>G | Cone-rod dystrophy 3 [RCV004796961] | likely pathogenic | 1 | 94011391 | 94011391 | Human | 1 | alternate_id |
| 596928409 | CV3541483 | single nucleotide variant | NM_000350.3(ABCA4):c.1835A>C (p.Gln612Pro) | Cone-rod dystrophy 3 [RCV004797355] | likely pathogenic | 1 | 94062679 | 94062679 | Human | 1 | alternate_id |
| 596941165 | CV3542398 | single nucleotide variant | NM_000350.3(ABCA4):c.1838A>G (p.Asp613Gly) | Severe early-childhood-onset retinal dystrophy [RCV004797668] | uncertain significance | 1 | 94062676 | 94062676 | Human | 2 | alternate_id |
| 596946239 | CV3550501 | single nucleotide variant | NM_000350.3(ABCA4):c.4693A>T (p.Lys1565Ter) | Severe early-childhood-onset retinal dystrophy [RCV004819042] | pathogenic | 1 | 94021926 | 94021926 | Human | 2 | alternate_id |
| 597648033 | CV3551576 | single nucleotide variant | NM_000350.3(ABCA4):c.1019A>G (p.Tyr340Cys) | Severe early-childhood-onset retinal dystrophy [RCV004819953] | likely pathogenic | 1 | 94080558 | 94080558 | Human | 2 | alternate_id |
| 12742651 | CV359265 | single nucleotide variant | NM_000350.3(ABCA4):c.1988G>A (p.Trp663Ter) | Cone-rod dystrophy 3 [RCV005027469]|Retinal dystrophy [RCV004816637]|Retinitis pigmentosa 19 [RCV001353030]|not provided [RCV000414150] | pathogenic|likely pathogenic | 1 | 94060709 | 94060709 | Human | 4 | alternate_id |
| 12742355 | CV359278 | duplication | NM_000350.3(ABCA4):c.3210_3211dup (p.Ser1071fs) | ABCA4-related disorder [RCV004732866]|Bietti crystalline corneoretinal dystrophy [RCV000787775]|Retinal dystrophy [RCV001073604]|Severe early-childhood-onset retinal dystrophy [RCV000504931]|not provided [RCV000413475] | pathogenic|likely pathogenic | 1 | 94042877 | 94042878 | Human | 5 | alternate_id |
| 12742397 | CV359518 | duplication | NM_006017.3(PROM1):c.1354dup (p.Tyr452fs) | Autosomal recessive retinitis pigmentosa [RCV001257789]|Cone-rod dystrophy 12 [RCV000761312]|Cone-rod dystrophy 2 [RCV001255712]|PROM1-related disorder [RCV000779436]|Retinal dystrophy [RCV000505153]|Retinitis pigmentosa 41 [RCV000987422]|Retinitis pigmentosa [RCV001003127]|Star 700;'>Stargardt disease [RCV002467446]|not provided [RCV000413568] | pathogenic|likely pathogenic | 4 | 16006637 | 16006638 | Human | 11 | alternate_id |
| 12743162 | CV361623 | single nucleotide variant | NM_000350.3(ABCA4):c.370C>T (p.Arg124Cys) | Cone-rod dystrophy 3 [RCV000764208]|not provided [RCV000416105] | conflicting interpretations of pathogenicity|uncertain significance | 1 | 94108649 | 94108649 | Human | 1 | alternate_id |
| 12849931 | CV365228 | single nucleotide variant | NM_000350.3(ABCA4):c.5898+1G>A | Retinal dystrophy [RCV001075185]|Retinitis pigmentosa [RCV001723980]|Stargardt disease [RCV005055959]|not provided [RCV000438611] | pathogenic | 1 | 94008234 | 94008234 | Human | 5 | alternate_id |
| 12849617 | CV365431 | single nucleotide variant | NM_000350.3(ABCA4):c.6317G>A (p.Arg2106His) | Cone-rod dystrophy 3 [RCV005027484]|Retinal dystrophy [RCV001074499]|Retinitis pigmentosa [RCV004586705]|not provided [RCV000432926] | pathogenic|likely pathogenic | 1 | 94001071 | 94001071 | Human | 5 | alternate_id |
| 12850212 | CV365433 | single nucleotide variant | NM_000350.3(ABCA4):c.4363T>C (p.Cys1455Arg) | ABCA4-related disorder [RCV000779004]|Cone-rod dystrophy 3 [RCV005027483]|Retinal dystrophy [RCV001075739]|Severe early-childhood-onset retinal dystrophy [RCV000505057]|not provided [RCV000443223] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94029621 | 94029621 | Human | 8 | alternate_id |
| 12848963 | CV365522 | single nucleotide variant | NM_000350.3(ABCA4):c.5572T>A (p.Tyr1858Asn) | Age related macular degeneration 2 [RCV003224874]|Cone-rod dystrophy 3 [RCV002480281]|Retinal dystrophy [RCV004816654]|Severe early-childhood-onset retinal dystrophy [RCV002289547]|not provided [RCV000421632] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94011274 | 94011274 | Human | 8 | alternate_id |
| 12849391 | CV365528 | single nucleotide variant | NM_000350.3(ABCA4):c.1531C>T (p.Arg511Cys) | ABCA4-related disorder [RCV000779006]|Cone-rod dystrophy 3 [RCV002272229]|Cone-rod dystrophy 3 [RCV004819223]|Cone-rod dystrophy 3 [RCV005355712]|Retinal dystrophy [RCV001074731]|Retinitis pigmentosa 19 [RCV002250625]|Severe early-childhood-onset retinal dystrophy [RCV005235274]|not provided [RCV000 429156] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94077713 | 94077713 | Human | 8 | alternate_id |
| 597672882 | CV3703344 | deletion | NM_000350.3(ABCA4):c.3510del (p.Gly1172fs) | Severe early-childhood-onset retinal dystrophy [RCV004823547] | pathogenic | 1 | 94041221 | 94041221 | Human | 2 | alternate_id |
| 617153909 | CV3703412 | single nucleotide variant | NM_006915.3(RP2):c.44C>G (p.Ser15Trp) | Stargardt disease [RCV005419807] | uncertain significance | X | 46837144 | 46837144 | Human | 1 | alternate_id |
| 617153481 | CV3703441 | single nucleotide variant | NM_000350.3(ABCA4):c.5329A>G (p.Met1777Val) | Cone dystrophy and rod monochromatism [RCV005419838]|Stargardt disease [RCV005419837] | likely pathogenic|uncertain significance | 1 | 94014674 | 94014674 | Human | 2 | alternate_id |
| 597681165 | CV3724008 | single nucleotide variant | NM_000350.3(ABCA4):c.3169G>T (p.Glu1057Ter) | Cone-rod dystrophy 3 [RCV005031088] | likely pathogenic | 1 | 94043357 | 94043357 | Human | 1 | alternate_id |
| 597682771 | CV3724230 | single nucleotide variant | NM_000350.3(ABCA4):c.302+2T>G | Cone-rod dystrophy 3 [RCV005031254] | likely pathogenic | 1 | 94111436 | 94111436 | Human | 1 | alternate_id |
| 597680124 | CV3727285 | single nucleotide variant | NM_000350.3(ABCA4):c.6209C>G (p.Thr2070Arg) | Cone-rod dystrophy 3 [RCV005030957]|not provided [RCV005112815] | pathogenic|likely pathogenic | 1 | 94001931 | 94001931 | Human | 1 | alternate_id |
| 597680431 | CV3727297 | single nucleotide variant | NM_000350.3(ABCA4):c.6006-1G>A | Cone-rod dystrophy 3 [RCV005030970] | likely pathogenic | 1 | 94005583 | 94005583 | Human | 1 | alternate_id |
| 597711642 | CV3727364 | single nucleotide variant | NM_000350.3(ABCA4):c.4871G>A (p.Trp1624Ter) | Cone-rod dystrophy 3 [RCV005034891] | likely pathogenic | 1 | 94021387 | 94021387 | Human | 1 | alternate_id |
| 597832833 | CV3762143 | single nucleotide variant | NM_000350.3(ABCA4):c.1918C>A (p.Pro640Thr) | Severe early-childhood-onset retinal dystrophy [RCV005087561] | likely pathogenic | 1 | 94062596 | 94062596 | Human | 2 | alternate_id |
| 597972637 | CV3790433 | duplication | NM_000350.3(ABCA4):c.3326dup (p.Gly1110fs) | Severe early-childhood-onset retinal dystrophy [RCV005254993]|not provided [RCV005142856] | pathogenic|likely pathogenic | 1 | 94042762 | 94042763 | Human | 2 | alternate_id |
| 598124431 | CV3883526 | single nucleotide variant | NM_000350.3(ABCA4):c.1712T>G (p.Ile571Ser) | Severe early-childhood-onset retinal dystrophy [RCV005235887] | likely pathogenic | 1 | 94063160 | 94063160 | Human | 2 | alternate_id |
| 598124432 | CV3883527 | single nucleotide variant | NM_000350.3(ABCA4):c.3224C>A (p.Ala1075Asp) | Severe early-childhood-onset retinal dystrophy [RCV005235888] | likely pathogenic | 1 | 94042865 | 94042865 | Human | 2 | alternate_id |
| 598124436 | CV3883529 | single nucleotide variant | NM_000350.3(ABCA4):c.4127A>C (p.Gln1376Pro) | Severe early-childhood-onset retinal dystrophy [RCV005235890] | likely pathogenic | 1 | 94031779 | 94031779 | Human | 2 | alternate_id |
| 598124437 | CV3883530 | deletion | NM_000350.3(ABCA4):c.4149del (p.Phe1383fs) | Severe early-childhood-onset retinal dystrophy [RCV005235891] | likely pathogenic | 1 | 94031100 | 94031100 | Human | 2 | alternate_id |
| 598218810 | CV3891713 | single nucleotide variant | NM_000350.3(ABCA4):c.859-25A>G | Severe early-childhood-onset retinal dystrophy [RCV005252556] | pathogenic | 1 | 94080743 | 94080743 | Human | 2 | alternate_id |
| 598220518 | CV3891812 | single nucleotide variant | NM_000350.3(ABCA4):c.67-2A>T | Cone-rod dystrophy 3 [RCV005253150] | pathogenic | 1 | 94113068 | 94113068 | Human | 1 | alternate_id |
| 8568196 | CV39173 | single nucleotide variant | NM_000350.3(ABCA4):c.2461T>C (p.Trp821Arg) | Severe early-childhood-onset retinal dystrophy [RCV000023140] | pathogenic | 1 | 94055237 | 94055237 | Human | 2 | alternate_id |
| 8568197 | CV39174 | single nucleotide variant | NM_000350.3(ABCA4):c.3364G>A (p.Glu1122Lys) | Retinal dystrophy [RCV001073572]|Retinitis pigmentosa [RCV000504768]|Severe early-childhood-onset retinal dystrophy [RCV000023141]|not provided [RCV000085574] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94041367 | 94041367 | Human | 6 | alternate_id |
| 616932970 | CV4009541 | deletion | NM_000350.3(ABCA4):c.3081del (p.Phe1026_Tyr1027insTer) | Severe early-childhood-onset retinal dystrophy [RCV005402713] | pathogenic | 1 | 94043445 | 94043445 | Human | 2 | alternate_id |
| 12895478 | CV405251 | single nucleotide variant | NM_000350.3(ABCA4):c.5932A>G (p.Lys1978Glu) | Age related macular degeneration 2 [RCV002248696]|Retinal dystrophy [RCV000504970]|Severe early-childhood-onset retinal dystrophy [RCV002250633]|not provided [RCV000486602] | pathogenic|likely pathogenic | 1 | 94007707 | 94007707 | Human | 6 | alternate_id |
| 12893799 | CV405254 | single nucleotide variant | NM_000350.3(ABCA4):c.4326C>A (p.Asn1442Lys) | Retinal dystrophy [RCV001073593]|Retinitis pigmentosa [RCV005239062]|Stargardt disease [RCV000787780]|not provided [RCV000480271] | pathogenic|likely pathogenic | 1 | 94030454 | 94030454 | Human | 5 | alternate_id |
| 12893744 | CV406402 | single nucleotide variant | NM_001371596.2(MFSD8):c.1361T>C (p.Met454Thr) | Cone-rod dystrophy [RCV005418155]|Inborn genetic diseases [RCV002313243]|Macular dystrophy with central cone involvement [RCV001542748]|Neuronal ceroid lipofuscinosis 7 [RCV000805545]|Neuronal ceroid lipofuscinosis 7 [RCV005027540]|Neuronal ceroid lipofuscinosis [RCV001805096]|Retinal dystrophy [RCV 000505174]|Retinitis pigmentosa [RCV000504782]|Severe early-childhood-onset retinal dystrophy [RCV000505013]|not provided [RCV000480079] | pathogenic|likely pathogenic|uncertain significance | 4 | 127920826 | 127920826 | Human | 12 | alternate_id |
| 12893473 | CV406868 | single nucleotide variant | NM_000322.5(PRPH2):c.748T>A (p.Cys250Ser) | PRPH2-related disorder [RCV002525801]|Stargardt disease [RCV001250338]|not provided [RCV000479139] | pathogenic|likely pathogenic | 6 | 42704445 | 42704445 | Human | 2 | alternate_id |
| 12895463 | CV406870 | single nucleotide variant | NM_000322.5(PRPH2):c.425G>A (p.Arg142Gln) | PRPH2-related disorder [RCV001302351]|Stargardt disease [RCV001250321]|not provided [RCV000486555] | likely pathogenic|uncertain significance | 6 | 42721910 | 42721910 | Human | 2 | alternate_id |
| 12899665 | CV407456 | single nucleotide variant | NM_019098.5(CNGB3):c.1492T>A (p.Leu498Met) | Achromatopsia 3 [RCV000764781]|Achromatopsia [RCV001276131]|CNGB3-related disorder [RCV004535518]|not provided [RCV000480707] | benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86626069 | 86626069 | Human | 3 | alternate_id |
| 12905541 | CV413234 | single nucleotide variant | NM_000350.3(ABCA4):c.6816+2T>A | Retinal dystrophy [RCV004816698]|Stargardt disease [RCV001199629]|not provided [RCV000487635] | pathogenic|likely pathogenic | 1 | 93996107 | 93996107 | Human | 3 | alternate_id |
| 12905922 | CV413236 | single nucleotide variant | NM_000350.3(ABCA4):c.2875A>T (p.Thr959Ser) | ABCA4-related disorder [RCV001099950]|Isolated macular dystrophy [RCV001199608]|Retinitis pigmentosa [RCV005418162]|Severe early-childhood-onset retinal dystrophy [RCV005248064]|not provided [RCV000488184] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94046962 | 94046962 | Human | 4 | alternate_id |
| 12905572 | CV413712 | single nucleotide variant | NM_000322.5(PRPH2):c.653C>T (p.Ser218Leu) | Isolated macular dystrophy [RCV001199528]|PRPH2-related disorder [RCV002526003]|Stargardt disease [RCV001199524]|not provided [RCV000487688] | pathogenic|likely pathogenic|uncertain significance | 6 | 42704540 | 42704540 | Human | 2 | alternate_id |
| 12906790 | CV414812 | single nucleotide variant | NM_000350.3(ABCA4):c.4873C>T (p.His1625Tyr) | Cone-rod dystrophy 3 [RCV005027567]|Retinitis pigmentosa 19 [RCV001353028]|Severe early-childhood-onset retinal dystrophy [RCV005252923]|not provided [RCV000489654] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94021385 | 94021385 | Human | 6 | alternate_id |
| 13211709 | CV425388 | single nucleotide variant | NM_000350.3(ABCA4):c.5327C>T (p.Pro1776Leu) | Stargardt disease [RCV003324528]|not provided [RCV000497807] | pathogenic|likely pathogenic | 1 | 94014676 | 94014676 | Human | 1 | alternate_id |
| 13212902 | CV426740 | microsatellite | NM_000350.3(ABCA4):c.1621_1622del (p.Leu541fs) | Severe early-childhood-onset retinal dystrophy [RCV000498003] | pathogenic|likely pathogenic | 1 | 94063250 | 94063251 | Human | | alternate_id |
| 13216999 | CV428632 | single nucleotide variant | NM_022726.4(ELOVL4):c.512T>C (p.Ile171Thr) | Spinocerebellar ataxia type 34 [RCV000504460]|Spinocerebellar ataxia type 34 [RCV005034041]|not provided [RCV001662494] | pathogenic|likely pathogenic | 6 | 79921654 | 79921654 | Human | 1 | alternate_id |
| 13434933 | CV431613 | single nucleotide variant | NM_000350.3(ABCA4):c.6098T>G (p.Leu2033Arg) | Retinal dystrophy [RCV000504619]|Stargardt disease [RCV000787518]|not provided [RCV003558424] | pathogenic|likely pathogenic | 1 | 94005490 | 94005490 | Human | 3 | alternate_id |
| 13435129 | CV431614 | single nucleotide variant | NM_000350.3(ABCA4):c.6098T>C (p.Leu2033Pro) | Retinal dystrophy [RCV004817733]|Severe early-childhood-onset retinal dystrophy [RCV000504985] | likely pathogenic | 1 | 94005490 | 94005490 | Human | 4 | alternate_id |
| 13435203 | CV431615 | single nucleotide variant | NM_000350.3(ABCA4):c.5516T>C (p.Phe1839Ser) | Severe early-childhood-onset retinal dystrophy [RCV000505135] | likely pathogenic | 1 | 94011330 | 94011330 | Human | 2 | alternate_id |
| 13435108 | CV431616 | single nucleotide variant | NM_000350.3(ABCA4):c.5463G>A (p.Thr1821=) | Severe early-childhood-onset retinal dystrophy [RCV000504940]|not provided [RCV001037052] | likely pathogenic|uncertain significance | 1 | 94011383 | 94011383 | Human | 2 | alternate_id |
| 13434950 | CV431618 | single nucleotide variant | NM_000350.3(ABCA4):c.5196+1137G>A | Cone-rod dystrophy [RCV003324531]|Macular dystrophy [RCV000787507]|Retinal dystrophy [RCV000504651]|Retinitis pigmentosa 19 [RCV001542560]|Severe early-childhood-onset retinal dystrophy [RCV000504847]|Stargardt disease [RCV000787508]|not provided [RCV001388591] | pathogenic|likely pathogenic | 1 | 94018445 | 94018445 | Human | 10 | alternate_id |
| 13435054 | CV431619 | single nucleotide variant | NM_000350.3(ABCA4):c.5088C>G (p.Ser1696Arg) | Severe early-childhood-onset retinal dystrophy [RCV000504832] | likely pathogenic | 1 | 94019690 | 94019690 | Human | 2 | alternate_id |
| 13435034 | CV431621 | single nucleotide variant | NM_000350.3(ABCA4):c.4727T>G (p.Leu1576Arg) | Severe early-childhood-onset retinal dystrophy [RCV000504799]|not provided [RCV002524408] | likely pathogenic | 1 | 94021892 | 94021892 | Human | 2 | alternate_id |
| 13434956 | CV431623 | single nucleotide variant | NM_000350.3(ABCA4):c.4129-1G>A | Severe early-childhood-onset retinal dystrophy [RCV000504663] | likely pathogenic | 1 | 94031121 | 94031121 | Human | 2 | alternate_id |
| 13435194 | CV431625 | single nucleotide variant | NM_000350.3(ABCA4):c.3259G>T (p.Glu1087Ter) | Congenital stationary night blindness [RCV000505122]|Severe early-childhood-onset retinal dystrophy [RCV005407661] | pathogenic | 1 | 94042830 | 94042830 | Human | 4 | alternate_id |
| 13435098 | CV431626 | single nucleotide variant | NM_000350.3(ABCA4):c.3081T>G (p.Tyr1027Ter) | Retinal dystrophy [RCV004794397]|Severe early-childhood-onset retinal dystrophy [RCV000504918]|not provided [RCV003558422] | pathogenic | 1 | 94043445 | 94043445 | Human | 4 | alternate_id |
| 13435078 | CV431627 | single nucleotide variant | NM_000350.3(ABCA4):c.2918+1060G>T | Severe early-childhood-onset retinal dystrophy [RCV000504881] | likely pathogenic|likely benign | 1 | 94045859 | 94045859 | Human | 2 | alternate_id |
| 13435085 | CV431628 | single nucleotide variant | NM_000350.3(ABCA4):c.2813T>C (p.Phe938Ser) | Cone-rod dystrophy 3 [RCV005034047]|Cone-rod dystrophy 3 [RCV005356025]|Retinal dystrophy [RCV000504891]|not provided [RCV001047033] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94047024 | 94047024 | Human | 3 | alternate_id |
| 13435206 | CV431634 | deletion | NM_000350.3(ABCA4):c.885del (p.Leu296fs) | Progressive cone dystrophy (without rod involvement) [RCV000787781]|Retinal dystrophy [RCV000505141]|Retinitis pigmentosa 19 [RCV004546511]|Severe early-childhood-onset retinal dystrophy [RCV005235366]|Stargardt disease [RCV000787527]|not provided [RCV001857213] | pathogenic|likely pathogenic | 1 | 94080692 | 94080692 | Human | 5 | alternate_id |
| 13435050 | CV431694 | single nucleotide variant | NM_000322.5(PRPH2):c.623G>A (p.Gly208Asp) | Choroidal dystrophy, central areolar 2 [RCV004787813]|Macular dystrophy [RCV000504827]|PRPH2-related disorder [RCV001051123]|Patterned macular dystrophy 1 [RCV000787665]|Pigmentary retinal dystrophy [RCV002248741]|Retinal dystrophy [RCV001074827]|Stargardt disea se [RCV001250285]|not provided [RCV001530240] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 6 | 42704570 | 42704570 | Human | 11 | alternate_id |
| 13434966 | CV431695 | deletion | NM_000322.5(PRPH2):c.259_266del (p.Asp87fs) | PRPH2-related disorder [RCV001857204]|Retinal dystrophy [RCV000504674]|Stargardt disease [RCV001250294]|not provided [RCV001530215] | pathogenic | 6 | 42722069 | 42722076 | Human | 4 | alternate_id |
| 13434972 | CV431851 | deletion | Single allele | Severe early-childhood-onset retinal dystrophy [RCV000504681] | likely pathogenic | 1 | 93937187 | 94040126 | Human | 2 | alternate_id |
| 13509055 | CV481602 | single nucleotide variant | NM_000350.3(ABCA4):c.319C>T (p.Arg107Ter) | Cone-rod dystrophy 3 [RCV005027679]|Retinal dystrophy [RCV001075053]|Severe early-childhood-onset retinal dystrophy [RCV001376340]|not provided [RCV000578767] | pathogenic | 1 | 94108700 | 94108700 | Human | 8 | alternate_id |
| 13518855 | CV488481 | single nucleotide variant | NM_000350.3(ABCA4):c.3608G>A (p.Gly1203Glu) | ABCA4-related disorder [RCV001101855]|ABCA4-related retinopathy [RCV005367445]|Age related macular degeneration 2 [RCV001195780]|Cone-rod dystrophy 3 [RCV002497243]|Cone-rod dystrophy [RCV002267738]|Retinal dystrophy [RCV004817792]|Retinitis pigmentosa 19 [RCV002289889]|Star '>Stargardt disease [RCV004594081]|not provided [RCV000597651]|not specified [RCV003235303] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94037350 | 94037350 | Human | 11 | alternate_id |
| 13522525 | CV489360 | single nucleotide variant | NM_000350.3(ABCA4):c.4715C>T (p.Thr1572Met) | Cone-rod dystrophy 3 [RCV002483586]|Retinal dystrophy [RCV001073247]|Retinitis pigmentosa 19 [RCV005252977]|not provided [RCV000591844] | uncertain significance | 1 | 94021904 | 94021904 | Human | 4 | alternate_id |
| 13515980 | CV489425 | single nucleotide variant | NM_000350.3(ABCA4):c.2345G>A (p.Trp782Ter) | Cone-rod dystrophy 3 [RCV005027700]|not provided [RCV000594953] | pathogenic | 1 | 94056638 | 94056638 | Human | 1 | alternate_id |
| 13515576 | CV491183 | single nucleotide variant | NM_000350.3(ABCA4):c.4342G>A (p.Gly1448Arg) | Cone-rod dystrophy 3 [RCV005357785]|not provided [RCV000594447] | conflicting interpretations of pathogenicity|uncertain significance | 1 | 94030438 | 94030438 | Human | 1 | alternate_id |
| 13533887 | CV498604 | single nucleotide variant | NM_000350.3(ABCA4):c.5196+1136C>A | Retinal dystrophy [RCV001075845]|Severe early-childhood-onset retinal dystrophy [RCV000986351]|not specified [RCV000601786] | likely benign|uncertain significance | 1 | 94018446 | 94018446 | Human | 4 | alternate_id |
| 13540826 | CV498627 | single nucleotide variant | NM_000350.3(ABCA4):c.4539+2064C>T | Retinal dystrophy [RCV004817819]|Severe early-childhood-onset retinal dystrophy [RCV001352957]|not provided [RCV000994041] | pathogenic|likely pathogenic|likely benign|uncertain significance | 1 | 94027381 | 94027381 | Human | 4 | alternate_id |
| 13539472 | CV498850 | single nucleotide variant | NM_000350.3(ABCA4):c.5196+1159G>A | Retinal dystrophy [RCV004817820]|Severe early-childhood-onset retinal dystrophy [RCV000986350]|not provided [RCV001811117]|not specified [RCV000613329] | likely pathogenic|benign|likely benign|no classifications from unflagged records | 1 | 94018423 | 94018423 | Human | 4 | alternate_id |
| 13531092 | CV511211 | single nucleotide variant | NM_201253.3(CRB1):c.3172G>T (p.Glu1058Ter) | Inborn genetic diseases [RCV000623037]|Leber congenital amaurosis 8 [RCV003451477]|Retinitis pigmentosa 12 [RCV001040018]|Retinitis pigmentosa 12 [RCV003451476]|Stargardt disease [RCV000678549] | pathogenic | 1 | 197435035 | 197435035 | Human | 4 | alternate_id |
| 13534348 | CV513016 | single nucleotide variant | NM_000350.3(ABCA4):c.4567C>T (p.Gln1523Ter) | Cone-rod dystrophy 3 [RCV000625606]|Retinal dystrophy [RCV004798849]|Severe early-childhood-onset retinal dystrophy [RCV002289913]|not provided [RCV001860463] | pathogenic|likely pathogenic | 1 | 94025021 | 94025021 | Human | 5 | alternate_id |
| 13674095 | CV536020 | deletion | NM_000350.3(ABCA4):c.287del (p.Asn96fs) | Severe early-childhood-onset retinal dystrophy [RCV000656498]|not provided [RCV001861674] | pathogenic | 1 | 94111453 | 94111453 | Human | 2 | alternate_id |
| 13705953 | CV537089 | single nucleotide variant | NM_000350.3(ABCA4):c.4417C>A (p.Leu1473Met) | Cone-rod dystrophy 3 [RCV002507145]|not provided [RCV000658513]|not specified [RCV002249386] | conflicting interpretations of pathogenicity|uncertain significance | 1 | 94029567 | 94029567 | Human | 1 | alternate_id |
| 13785575 | CV543956 | single nucleotide variant | NM_001142800.2(EYS):c.1459+5C>T | Retinitis pigmentosa 25 [RCV000667100]|Retinitis pigmentosa [RCV001162942]|Stargardt disease [RCV000787832]|not provided [RCV000762420]|not specified [RCV004768526] | likely pathogenic|uncertain significance | 6 | 65353453 | 65353453 | Human | 4 | alternate_id |
| 13795158 | CV551504 | single nucleotide variant | NM_201253.3(CRB1):c.849-26A>G | Stargardt disease [RCV000678551] | uncertain significance | 1 | 197347314 | 197347314 | Human | 1 | alternate_id |
| 13795471 | CV551522 | single nucleotide variant | NM_000350.3(ABCA4):c.4539+2001G>A | Retinal dystrophy [RCV001074340]|Severe early-childhood-onset retinal dystrophy [RCV000678510]|not provided [RCV001701152] | pathogenic|likely pathogenic | 1 | 94027444 | 94027444 | Human | 4 | alternate_id |
| 13827379 | CV581848 | single nucleotide variant | NM_000350.3(ABCA4):c.2587+2T>C | Cone-rod dystrophy 3 [RCV005027888]|Severe early-childhood-onset retinal dystrophy [RCV000722087]|not provided [RCV001868917] | pathogenic|likely pathogenic | 1 | 94055109 | 94055109 | Human | 6 | alternate_id |
| 13832708 | CV583381 | single nucleotide variant | NM_019098.5(CNGB3):c.1898A>G (p.Asp633Gly) | Achromatopsia 3 [RCV001164343]|CNGB3-related retinopathy [RCV005357967]|Retinal dystrophy [RCV004817954]|Severe early-childhood-onset retinal dystrophy [RCV001164344]|not provided [RCV000727616] | conflicting interpretations of pathogenicity|uncertain significance | 8 | 86579136 | 86579136 | Human | 5 | alternate_id |
| 14395726 | CV611528 | single nucleotide variant | NM_000350.3(ABCA4):c.1714C>T (p.Arg572Ter) | Cone-rod dystrophy 3 [RCV005029408]|Retinal dystrophy [RCV004798864]|maculopathy [RCV001002843]|not provided [RCV000760305] | pathogenic | 1 | 94063158 | 94063158 | Human | 8 | alternate_id |
| 14396669 | CV612550 | single nucleotide variant | NM_000350.3(ABCA4):c.4598T>C (p.Phe1533Ser) | Stargardt disease [RCV001199616]|not provided [RCV000761666] | pathogenic|uncertain significance | 1 | 94024990 | 94024990 | Human | 1 | alternate_id |
| 14396670 | CV612551 | single nucleotide variant | NM_000350.3(ABCA4):c.4070C>A (p.Ala1357Glu) | Retinitis pigmentosa [RCV004800573]|Severe early-childhood-onset retinal dystrophy [RCV004564474]|not provided [RCV000761667] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94031836 | 94031836 | Human | 4 | alternate_id |
| 14397320 | CV612831 | microsatellite | NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) | Achromatopsia 3 [RCV001810484]|Achromatopsia [RCV001275881]|Severe early-childhood-onset retinal dystrophy [RCV001029857]|not provided [RCV000762527]|not specified [RCV003987697] | likely pathogenic|benign|likely benign|conflicting interpretations of pathogenicity|uncertain significance|no classifications from unflagged records | 8 | 86576035 | 86576055 | Human | | alternate_id |
| 14693433 | CV620017 | single nucleotide variant | NM_000350.3(ABCA4):c.5113C>T (p.Arg1705Trp) | ABCA4-related disorder [RCV000779001]|Cone-rod dystrophy [RCV001199620]|Retinal dystrophy [RCV001074860]|Retinitis pigmentosa 1 [RCV003322616]|Retinitis pigmentosa 19 [RCV004760780]|Severe early-childhood-onset retinal dystrophy [RCV002267624]|not provided [RCV000994038] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94019665 | 94019665 | Human | 9 | alternate_id |
| 14692981 | CV620019 | single nucleotide variant | NM_000350.3(ABCA4):c.2401G>A (p.Ala801Thr) | Retinal dystrophy [RCV001073511]|Severe early-childhood-onset retinal dystrophy [RCV001353035]|not provided [RCV001683659] | pathogenic|likely pathogenic|uncertain significance | 1 | 94055297 | 94055297 | Human | 4 | alternate_id |
| 14695856 | CV622315 | single nucleotide variant | NM_000350.3(ABCA4):c.5172G>A (p.Trp1724Ter) | ABCA4-related disorder [RCV000785053]|Cone dystrophy [RCV005418344]|Severe early-childhood-onset retinal dystrophy [RCV001353013]|not provided [RCV001204682] | pathogenic|likely pathogenic | 1 | 94019606 | 94019606 | Human | 4 | alternate_id |
| 14697884 | CV623247 | single nucleotide variant | NM_000350.3(ABCA4):c.1958G>T (p.Arg653Leu) | Cone-rod dystrophy 3 [RCV000786893]|Cone-rod dystrophy 3 [RCV005029445]|Retinal dystrophy [RCV004817995]|Stargardt disease [RCV001002840]|not provided [RCV003768465] | likely pathogenic | 1 | 94060739 | 94060739 | Human | 4 | alternate_id |
| 14698441 | CV623813 | single nucleotide variant | NM_000350.3(ABCA4):c.6478A>G (p.Lys2160Glu) | Retinal dystrophy [RCV004817999]|Stargardt disease [RCV000787524]|not provided [RCV003558594] | pathogenic|likely pathogenic | 1 | 94000837 | 94000837 | Human | 3 | alternate_id |
| 14698633 | CV623814 | single nucleotide variant | NM_000350.3(ABCA4):c.6454G>T (p.Gly2152Cys) | Retinal dystrophy [RCV004817998]|Stargardt disease [RCV000787523]|not provided [RCV005411562] | likely pathogenic | 1 | 94000861 | 94000861 | Human | 3 | alternate_id |
| 14698632 | CV623815 | single nucleotide variant | NM_000350.3(ABCA4):c.6319C>T (p.Arg2107Cys) | Retinal dystrophy [RCV001074913]|Stargardt disease [RCV000787520]|not provided [RCV001380601] | pathogenic|uncertain significance | 1 | 94001069 | 94001069 | Human | 3 | alternate_id |
| 14698439 | CV623817 | single nucleotide variant | NM_000350.3(ABCA4):c.4842C>G (p.Asn1614Lys) | Macular dystrophy [RCV000787503]|Stargardt disease [RCV000787767] | uncertain significance | 1 | 94021646 | 94021646 | Human | 3 | alternate_id |
| 14698631 | CV623818 | single nucleotide variant | NM_000350.3(ABCA4):c.4679T>A (p.Ile1560Asn) | Stargardt disease [RCV000787501] | uncertain significance | 1 | 94021940 | 94021940 | Human | 1 | alternate_id |
| 14698437 | CV623819 | single nucleotide variant | NM_000350.3(ABCA4):c.4243A>C (p.Thr1415Pro) | Stargardt disease [RCV000787499] | likely pathogenic | 1 | 94031006 | 94031006 | Human | 1 | alternate_id |
| 14698436 | CV623820 | duplication | NM_000350.3(ABCA4):c.3767_3768dup (p.Leu1257fs) | Stargardt disease [RCV000787497] | likely pathogenic | 1 | 94037189 | 94037190 | Human | 1 | alternate_id |
| 14698630 | CV623821 | single nucleotide variant | NM_000350.3(ABCA4):c.3380G>A (p.Gly1127Glu) | Stargardt disease [RCV000787496]|not provided [RCV001873209] | pathogenic|likely pathogenic | 1 | 94041351 | 94041351 | Human | 1 | alternate_id |
| 14698341 | CV623822 | duplication | NM_000350.3(ABCA4):c.2680dup (p.Leu894fs) | Stargardt disease [RCV000787489] | likely pathogenic | 1 | 94048930 | 94048931 | Human | 1 | alternate_id |
| 14698340 | CV623824 | deletion | NM_000350.3(ABCA4):c.2408del (p.Gly803fs) | Stargardt disease [RCV000787484]|not provided [RCV003558593] | pathogenic | 1 | 94055290 | 94055290 | Human | 1 | alternate_id |
| 14698662 | CV623851 | single nucleotide variant | NM_000322.5(PRPH2):c.478C>T (p.Gln160Ter) | Retinal dystrophy [RCV000787662]|Stargardt disease [RCV001250328]|not provided [RCV001530345] | pathogenic|likely pathogenic | 6 | 42721857 | 42721857 | Human | 3 | alternate_id |
| 14698444 | CV623876 | single nucleotide variant | NM_004183.4(BEST1):c.1030C>T (p.Gln344Ter) | Stargardt disease [RCV000787536] | likely pathogenic | 11 | 61959973 | 61959973 | Human | 1 | alternate_id |
| 14698347 | CV623896 | duplication | NM_000554.6(CRX):c.381dup (p.Ser128fs) | Stargardt disease [RCV000787586] | likely pathogenic | 19 | 47839445 | 47839446 | Human | 1 | alternate_id |
| 14698639 | CV623898 | single nucleotide variant | NM_000554.6(CRX):c.827G>A (p.Trp276Ter) | Stargardt disease [RCV000787588] | likely pathogenic | 19 | 47839894 | 47839894 | Human | 1 | alternate_id |
| 14698342 | CV623922 | single nucleotide variant | NM_000350.3(ABCA4):c.4539+2066C>G | Stargardt disease [RCV000787500] | uncertain significance | 1 | 94027379 | 94027379 | Human | 1 | alternate_id |
| 14698586 | CV623948 | deletion | NM_014053.4(FLVCR1):c.1557_1561del (p.Asn519fs) | Stargardt disease [RCV000787835] | likely pathogenic | 1 | 212895015 | 212895019 | Human | 1 | alternate_id |
| 14698679 | CV623954 | deletion | NM_000350.3(ABCA4):c.4222del (p.Trp1408fs) | Age related macular degeneration 2 [RCV001195988]|Retinal dystrophy [RCV004818015]|Stargardt disease [RCV000787779] | pathogenic|likely pathogenic | 1 | 94031027 | 94031027 | Human | 4 | alternate_id |
| 14698593 | CV623955 | single nucleotide variant | NM_000350.3(ABCA4):c.4069G>A (p.Ala1357Thr) | Retinitis pigmentosa [RCV005240568]|Stargardt disease [RCV000787903]|not provided [RCV001235117] | pathogenic|uncertain significance | 1 | 94031837 | 94031837 | Human | 3 | alternate_id |
| 14698516 | CV623956 | single nucleotide variant | NM_000350.3(ABCA4):c.2895T>G (p.Asn965Lys) | Retinal dystrophy [RCV001074143]|Stargardt disease [RCV000787765] | likely pathogenic | 1 | 94046942 | 94046942 | Human | 3 | alternate_id |
| 14698390 | CV623984 | duplication | NM_133497.4(KCNV2):c.357dup (p.Lys120fs) | Cone dystrophy with supernormal rod response [RCV000030810]|Progressive cone dystrophy (without rod involvement) [RCV000787846]|Stargardt disease [RCV000787847] | pathogenic | 9 | 2718092 | 2718093 | Human | 3 | alternate_id |
| 14698521 | CV623991 | single nucleotide variant | NM_004183.4(BEST1):c.95T>C (p.Leu32Pro) | Stargardt disease [RCV000787797]|not provided [RCV001338345] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 11 | 61951901 | 61951901 | Human | 1 | alternate_id |
| 14698383 | CV624029 | deletion | NM_000350.2:c.(6816+1_6817-1)_(*1_?)del | Stargardt disease [RCV000787759] | pathogenic | | | | Human | 1 | alternate_id |
| 14698548 | CV624034 | single nucleotide variant | NM_014014.5(SNRNP200):c.210-5A>G | Stargardt disease [RCV000787886] | uncertain significance | 2 | 96303335 | 96303335 | Human | 1 | alternate_id |
| 14736193 | CV658103 | single nucleotide variant | NM_000350.3(ABCA4):c.4128+156C>T | Age related macular degeneration 2 [RCV001548781]|Cone-rod dystrophy 3 [RCV001548780]|Retinitis pigmentosa 19 [RCV001549180]|Severe early-childhood-onset retinal dystrophy [RCV001549179]|not provided [RCV000838362] | benign | 1 | 94031622 | 94031622 | Human | 6 | alternate_id |
| 14746747 | CV672067 | deletion | NM_000322.5(PRPH2):c.394del (p.Gln132fs) | PRPH2-related disorder [RCV001061370]|Retinal dystrophy [RCV004818062]|Retinitis pigmentosa [RCV000844928]|Stargardt disease [RCV001250304]|not provided [RCV001530283] | pathogenic|not provided | 6 | 42721941 | 42721941 | Human | 6 | alternate_id |
| 14746748 | CV672072 | single nucleotide variant | NM_178857.6(RP1L1):c.2927C>T (p.Ala976Val) | Inborn genetic diseases [RCV004029248]|RP1L1-related disorder [RCV004751753]|Retinal dystrophy [RCV004818063]|Stargardt disease [RCV000844931] | likely benign|uncertain significance|not provided | 8 | 10611171 | 10611171 | Human | 6 | alternate_id |
| 14978334 | CV677405 | single nucleotide variant | NM_000350.3(ABCA4):c.6221G>T (p.Gly2074Val) | ABCA4-related disorder [RCV004733063]|Cone-rod dystrophy 3 [RCV000850519]|Cone-rod dystrophy 3 [RCV001262439]|Retinal dystrophy [RCV001074418]|not provided [RCV001234782] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|no classifications from unflagged records | 1 | 94001919 | 94001919 | Human | 6 | alternate_id |
| 15147022 | CV691989 | single nucleotide variant | NM_000322.5(PRPH2):c.483C>G (p.Ile161Met) | PRPH2-related disorder [RCV000878664]|Stargardt disease [RCV001250329]|not provided [RCV001530346] | likely benign|uncertain significance | 6 | 42721852 | 42721852 | Human | 2 | alternate_id |
| 15177431 | CV711650 | single nucleotide variant | NM_019098.5(CNGB3):c.1626C>T (p.Ser542=) | Achromatopsia 3 [RCV001159426]|Achromatopsia [RCV001272482]|Severe early-childhood-onset retinal dystrophy [RCV001159425]|not provided [RCV000973424] | benign|likely benign | 8 | 86611624 | 86611624 | Human | 6 | alternate_id |
| 15174269 | CV736761 | single nucleotide variant | NM_019098.5(CNGB3):c.319G>A (p.Gly107Arg) | Achromatopsia 3 [RCV001161028]|Achromatopsia [RCV001272753]|CNGB3-related disorder [RCV004733088]|Severe early-childhood-onset retinal dystrophy [RCV001161029]|not provided [RCV000905932] | likely benign|conflicting interpretations of pathogenicity|uncertain significance | 8 | 86726550 | 86726550 | Human | 6 | alternate_id |
| 15164429 | CV751254 | single nucleotide variant | NM_019098.5(CNGB3):c.1368C>T (p.Arg456=) | Achromatopsia 3 [RCV001162415]|Achromatopsia [RCV001272740]|Severe early-childhood-onset retinal dystrophy [RCV001162416]|not provided [RCV000926379] | benign|likely benign|uncertain significance | 8 | 86629031 | 86629031 | Human | 6 | alternate_id |
| 15194224 | CV766898 | single nucleotide variant | NM_019098.5(CNGB3):c.2159A>G (p.Gln720Arg) | Achromatopsia 3 [RCV001162312]|Achromatopsia [RCV001276124]|CNGB3-related disorder [RCV004733090]|Severe early-childhood-onset retinal dystrophy [RCV001162313]|not provided [RCV000933583] | likely benign|uncertain significance | 8 | 86576075 | 86576075 | Human | 6 | alternate_id |
| 15129351 | CV766903 | single nucleotide variant | NM_019098.5(CNGB3):c.1347A>T (p.Thr449=) | Achromatopsia 3 [RCV001162418]|Achromatopsia [RCV001272741]|Severe early-childhood-onset retinal dystrophy [RCV001162417]|not provided [RCV000941867] | likely benign|uncertain significance | 8 | 86629052 | 86629052 | Human | 6 | alternate_id |
| 15128096 | CV766908 | single nucleotide variant | NM_019098.5(CNGB3):c.720C>T (p.Leu240=) | Achromatopsia 3 [RCV001162523]|Achromatopsia [RCV001279841]|Severe early-childhood-onset retinal dystrophy [RCV001162524]|not provided [RCV000941658] | likely benign|uncertain significance | 8 | 86667057 | 86667057 | Human | 6 | alternate_id |
| 15163053 | CV779561 | single nucleotide variant | NM_019098.5(CNGB3):c.1178+9T>C | Achromatopsia 3 [RCV001164461]|Achromatopsia [RCV001272742]|Severe early-childhood-onset retinal dystrophy [RCV001164462]|not provided [RCV000970399] | benign|uncertain significance | 8 | 86643742 | 86643742 | Human | 6 | alternate_id |
| 21070389 | CV790002 | deletion | NM_000350.3(ABCA4):c.6471del (p.Lys2158fs) | Severe early-childhood-onset retinal dystrophy [RCV000986344]|not provided [RCV001858637] | pathogenic | 1 | 94000844 | 94000844 | Human | 2 | alternate_id |
| 21070391 | CV790003 | deletion | NM_000350.3(ABCA4):c.6221del (p.Gly2074fs) | Severe early-childhood-onset retinal dystrophy [RCV000986346] | pathogenic | 1 | 94001919 | 94001919 | Human | 2 | alternate_id |
| 21070392 | CV790004 | single nucleotide variant | NM_000350.3(ABCA4):c.6007A>T (p.Ile2003Phe) | Severe early-childhood-onset retinal dystrophy [RCV000986348] | likely benign | 1 | 94005581 | 94005581 | Human | 2 | alternate_id |
| 21070393 | CV790005 | single nucleotide variant | NM_000350.3(ABCA4):c.5714+1G>T | Severe early-childhood-onset retinal dystrophy [RCV000986349]|not provided [RCV001071878] | pathogenic|likely pathogenic | 1 | 94010799 | 94010799 | Human | 2 | alternate_id |
| 21070394 | CV790006 | deletion | NM_000350.3(ABCA4):c.5012_5016del (p.Ile1671fs) | Cone-rod dystrophy 3 [RCV005029545]|Severe early-childhood-onset retinal dystrophy [RCV000986354] | pathogenic|likely pathogenic | 1 | 94021242 | 94021246 | Human | 6 | alternate_id |
| 21070397 | CV790007 | deletion | NM_000350.3(ABCA4):c.4734_4739del (p.Phe1579_Leu1580del) | Severe early-childhood-onset retinal dystrophy [RCV000986356] | pathogenic | 1 | 94021880 | 94021885 | Human | 2 | alternate_id |
| 21070398 | CV790008 | deletion | NM_000350.3(ABCA4):c.4108del (p.His1370fs) | Severe early-childhood-onset retinal dystrophy [RCV000986357]|not provided [RCV002549665] | pathogenic | 1 | 94031798 | 94031798 | Human | 2 | alternate_id |
| 21070400 | CV790009 | microsatellite | NM_000350.3(ABCA4):c.4036_4037del (p.Thr1346fs) | Severe early-childhood-onset retinal dystrophy [RCV000986358]|not provided [RCV001071876] | pathogenic | 1 | 94031869 | 94031870 | Human | | alternate_id |
| 21070402 | CV790010 | deletion | NM_000350.3(ABCA4):c.4003_4004del (p.Pro1335fs) | Severe early-childhood-onset retinal dystrophy [RCV000986359]|not provided [RCV001858638] | pathogenic | 1 | 94031902 | 94031903 | Human | 2 | alternate_id |
| 21070403 | CV790011 | single nucleotide variant | NM_000350.3(ABCA4):c.3729T>A (p.Tyr1243Ter) | Severe early-childhood-onset retinal dystrophy [RCV000986361]|not provided [RCV001244393] | pathogenic | 1 | 94037229 | 94037229 | Human | 2 | alternate_id |
| 21070405 | CV790012 | single nucleotide variant | NM_000350.3(ABCA4):c.3698T>C (p.Leu1233Pro) | Severe early-childhood-onset retinal dystrophy [RCV000986362]|not provided [RCV001858639] | likely pathogenic|uncertain significance | 1 | 94037260 | 94037260 | Human | 2 | alternate_id |
| 21070406 | CV790013 | deletion | NM_000350.3(ABCA4):c.3664_3669del (p.Val1222_Glu1223del) | Severe early-childhood-onset retinal dystrophy [RCV000986363]|not provided [RCV001858640] | likely pathogenic|uncertain significance | 1 | 94037289 | 94037294 | Human | 2 | alternate_id |
| 21070408 | CV790014 | single nucleotide variant | NM_000350.3(ABCA4):c.3385C>G (p.Arg1129Gly) | Retinal dystrophy [RCV004818091]|Severe early-childhood-onset retinal dystrophy [RCV000986364] | likely pathogenic|uncertain significance | 1 | 94041346 | 94041346 | Human | 4 | alternate_id |
| 21070409 | CV790015 | single nucleotide variant | NM_000350.3(ABCA4):c.2537A>G (p.Asp846Gly) | Severe early-childhood-onset retinal dystrophy [RCV000986367] | likely pathogenic | 1 | 94055161 | 94055161 | Human | 2 | alternate_id |
| 21070411 | CV790016 | single nucleotide variant | NM_000350.3(ABCA4):c.2161-1G>A | Severe early-childhood-onset retinal dystrophy [RCV000986368] | pathogenic | 1 | 94056823 | 94056823 | Human | 2 | alternate_id |
| 21070412 | CV790017 | single nucleotide variant | NM_000350.3(ABCA4):c.1846G>A (p.Glu616Lys) | Severe early-childhood-onset retinal dystrophy [RCV000986370]|Stargardt disease [RCV001002841]|not provided [RCV001858641] | pathogenic|likely pathogenic | 1 | 94062668 | 94062668 | Human | 2 | alternate_id |
| 21070413 | CV790018 | single nucleotide variant | NM_000350.3(ABCA4):c.1364T>A (p.Leu455Gln) | Severe early-childhood-onset retinal dystrophy [RCV000986371]|not provided [RCV001869332] | pathogenic|uncertain significance | 1 | 94077880 | 94077880 | Human | 2 | alternate_id |
| 21070415 | CV790019 | single nucleotide variant | NM_000350.3(ABCA4):c.36G>A (p.Trp12Ter) | Severe early-childhood-onset retinal dystrophy [RCV000986377]|not provided [RCV005092967] | pathogenic | 1 | 94121010 | 94121010 | Human | 2 | alternate_id |
| 21071293 | CV790453 | single nucleotide variant | NM_006017.3(PROM1):c.1984-1G>T | Cone-rod dystrophy [RCV003324540]|Leber congenital amaurosis [RCV003324541]|PROM1-related disorder [RCV004536013]|Retinitis pigmentosa 41 [RCV000987420]|Stargardt disease [RCV002467454]|not provided [RCV001049161] | pathogenic|likely pathogenic | 4 | 15989825 | 15989825 | Human | 7 | alternate_id |
| 21071297 | CV790456 | single nucleotide variant | NM_006017.3(PROM1):c.784+1G>A | Leber congenital amaurosis [RCV003324543]|Retinal dystrophy [RCV001075553]|Retinitis pigmentosa 41 [RCV000987424]|Stargardt disease [RCV002466264]|not provided [RCV001047807] | pathogenic|likely pathogenic | 4 | 16023325 | 16023325 | Human | 5 | alternate_id |
| 21071896 | CV794733 | single nucleotide variant | NM_000350.3(ABCA4):c.5774G>T (p.Arg1925Ile) | Retinal dystrophy [RCV004818106]|Stargardt disease [RCV001199625]|not provided [RCV000994034] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94008812 | 94008812 | Human | 3 | alternate_id |
| 21404203 | CV799030 | single nucleotide variant | NM_019098.5(CNGB3):c.1781+1G>T | Achromatopsia 3 [RCV000999643] | pathogenic | 8 | 86604092 | 86604092 | Human | 1 | alternate_id |
| 21404776 | CV800450 | deletion | NM_000350.3(ABCA4):c.6077del (p.Leu2026fs) | Stargardt disease [RCV001002808] | pathogenic | 1 | 94005511 | 94005511 | Human | 1 | alternate_id |
| 21404783 | CV800452 | single nucleotide variant | NM_000350.3(ABCA4):c.5380G>C (p.Ala1794Pro) | Stargardt disease [RCV001002814]|not provided [RCV001035476] | pathogenic|likely pathogenic | 1 | 94014623 | 94014623 | Human | 1 | alternate_id |
| 21404785 | CV800453 | single nucleotide variant | NM_000350.3(ABCA4):c.5351T>G (p.Leu1784Arg) | Stargardt disease [RCV001002815]|not provided [RCV003769391] | pathogenic | 1 | 94014652 | 94014652 | Human | 1 | alternate_id |
| 21404791 | CV800455 | single nucleotide variant | NM_000350.3(ABCA4):c.5169C>G (p.Tyr1723Ter) | Retinal dystrophy [RCV004818134]|Stargardt disease [RCV001002820]|not provided [RCV001388592] | pathogenic | 1 | 94019609 | 94019609 | Human | 3 | alternate_id |
| 21404792 | CV800456 | deletion | NM_000350.3(ABCA4):c.5059del (p.Ile1687fs) | Stargardt disease [RCV001002821]|not provided [RCV003769392] | pathogenic | 1 | 94019719 | 94019719 | Human | 1 | alternate_id |
| 21404795 | CV800458 | single nucleotide variant | NM_000350.3(ABCA4):c.4854G>C (p.Trp1618Cys) | Retinal dystrophy [RCV001074894]|Severe early-childhood-onset retinal dystrophy [RCV004563619]|Stargardt disease [RCV001002824]|not provided [RCV001216794] | pathogenic|likely pathogenic|uncertain significance | 1 | 94021404 | 94021404 | Human | 4 | alternate_id |
| 21404801 | CV800459 | deletion | NM_000350.3(ABCA4):c.3449_3451del (p.Cys1150del) | Stargardt disease [RCV001002833] | pathogenic | 1 | 94041280 | 94041282 | Human | 1 | alternate_id |
| 21404808 | CV800460 | single nucleotide variant | NM_000350.3(ABCA4):c.1758C>A (p.Asp586Glu) | Stargardt disease [RCV001002842] | likely pathogenic | 1 | 94063114 | 94063114 | Human | 1 | alternate_id |
| 21404811 | CV800461 | deletion | NM_000350.3(ABCA4):c.1172del (p.Lys391fs) | Stargardt disease [RCV001002845] | pathogenic | 1 | 94079389 | 94079389 | Human | 1 | alternate_id |
| 21404814 | CV800462 | deletion | NM_000350.3(ABCA4):c.834del (p.Asp279fs) | Retinal dystrophy [RCV001074665]|Retinitis pigmentosa 19 [RCV001542646]|Stargardt disease [RCV001002846]|not provided [RCV001008400] | pathogenic|likely pathogenic | 1 | 94083376 | 94083376 | Human | 4 | alternate_id |
| 21404816 | CV800463 | single nucleotide variant | NM_000350.3(ABCA4):c.452T>C (p.Ile151Thr) | Retinal dystrophy [RCV004818135]|Stargardt disease [RCV001002847]|not provided [RCV001860519] | likely pathogenic|uncertain significance | 1 | 94103133 | 94103133 | Human | 3 | alternate_id |
| 21404818 | CV800464 | single nucleotide variant | NM_000350.3(ABCA4):c.242G>C (p.Cys81Ser) | Stargardt disease [RCV001002848] | likely pathogenic | 1 | 94111498 | 94111498 | Human | 1 | alternate_id |
| 21404799 | CV800685 | single nucleotide variant | NM_000350.3(ABCA4):c.4254-1G>A | Retinal dystrophy [RCV001074402]|Stargardt disease [RCV001002830] | pathogenic|likely pathogenic | 1 | 94030527 | 94030527 | Human | 3 | alternate_id |
| 21404970 | CV800697 | single nucleotide variant | NM_001844.5(COL2A1):c.1527+135G>A | Stargardt disease [RCV001002986]|Stickler syndrome type 1 [RCV005253675]|not provided [RCV001571488] | pathogenic | 12 | 47986201 | 47986201 | Human | 2 | alternate_id |
| 38464738 | CV801310 | microsatellite | NM_000350.3(ABCA4):c.5907CCT[3] (p.Leu1971_Gly1972insLeu) | Retinal dystrophy [RCV004818163]|Stargardt disease [RCV001199626] | pathogenic|likely pathogenic | 1 | 94007726 | 94007727 | Human | | alternate_id |
| 38464725 | CV801311 | single nucleotide variant | NM_000350.3(ABCA4):c.5329A>T (p.Met1777Leu) | ABCA4-related retinopathy [RCV005359739]|Isolated macular dystrophy [RCV001199622]|Retinal dystrophy [RCV004818161]|Severe early-childhood-onset retinal dystrophy [RCV001352943]|not provided [RCV001450679] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94014674 | 94014674 | Human | 4 | alternate_id |
| 38465184 | CV801314 | single nucleotide variant | NM_000350.3(ABCA4):c.4848+1G>T | Stargardt disease [RCV001199631] | pathogenic | 1 | 94021639 | 94021639 | Human | 1 | alternate_id |
| 38464679 | CV801319 | deletion | NM_000350.3(ABCA4):c.2731_2732del (p.Glu911fs) | Stargardt disease [RCV001199607] | pathogenic | 1 | 94048879 | 94048880 | Human | 1 | alternate_id |
| 38464662 | CV801325 | microsatellite | NM_000350.3(ABCA4):c.2012_2013del (p.Val671fs) | Retinitis pigmentosa [RCV001199603]|Severe early-childhood-onset retinal dystrophy [RCV004761860] | pathogenic | 1 | 94060684 | 94060685 | Human | | alternate_id |
| 38464652 | CV801327 | deletion | NM_000350.3(ABCA4):c.1454del (p.Gly485fs) | Retinal dystrophy [RCV004818160]|Stargardt disease [RCV001199601] | pathogenic | 1 | 94077790 | 94077790 | Human | 3 | alternate_id |
| 38464720 | CV801329 | duplication | NM_000350.3(ABCA4):c.517dup (p.Leu173fs) | Stargardt disease [RCV001199621] | pathogenic | 1 | 94103067 | 94103068 | Human | 1 | alternate_id |
| 28912200 | CV801386 | single nucleotide variant | NM_003322.6(TULP1):c.1201C>T (p.Gln401Ter) | Retinal dystrophy [RCV004818157]|Stargardt disease [RCV001199560]|not provided [RCV001093077] | pathogenic | 6 | 35503760 | 35503760 | Human | 3 | alternate_id |
| 38464732 | CV801502 | duplication | NM_000350.3(ABCA4):c.571_580dup | Retinal dystrophy [RCV004818162]|Stargardt disease [RCV001199624] | pathogenic | 1 | 94098981 | 94098982 | Human | 3 | alternate_id |
| 25314700 | CV818175 | single nucleotide variant | NM_000350.3(ABCA4):c.6113G>C (p.Arg2038Pro) | Severe early-childhood-onset retinal dystrophy [RCV001029767] | likely pathogenic | 1 | 94005475 | 94005475 | Human | 2 | alternate_id |
| 25314804 | CV818177 | deletion | NM_000350.3(ABCA4):c.488_491del (p.Leu163fs) | Severe early-childhood-onset retinal dystrophy [RCV001029826]|Stargardt disease 3 [RCV004559836]|not provided [RCV001873430] | pathogenic | 1 | 94103094 | 94103097 | Human | 3 | alternate_id |
| 26890030 | CV824455 | single nucleotide variant | NM_000350.3(ABCA4):c.5642C>T (p.Ala1881Val) | Cone-rod dystrophy 3 [RCV002471022]|Cone-rod dystrophy 3 [RCV005029638]|Retinal dystrophy [RCV004813655]|not provided [RCV001058803] | pathogenic|likely pathogenic|uncertain significance | 1 | 94010872 | 94010872 | Human | 3 | alternate_id |
| 26916833 | CV824456 | single nucleotide variant | NM_000350.3(ABCA4):c.5383T>G (p.Leu1795Val) | Cone-rod dystrophy 3 [RCV002479263]|Retinitis pigmentosa [RCV001270350]|not provided [RCV001040976] | likely pathogenic|uncertain significance | 1 | 94014620 | 94014620 | Human | 3 | alternate_id |
| 26916257 | CV824477 | single nucleotide variant | NM_000350.3(ABCA4):c.2947A>G (p.Thr983Ala) | Retinal dystrophy [RCV004813571]|Severe early-childhood-onset retinal dystrophy [RCV001352962]|not provided [RCV001040117] | pathogenic|likely pathogenic | 1 | 94044716 | 94044716 | Human | 4 | alternate_id |
| 26893946 | CV824478 | single nucleotide variant | NM_000350.3(ABCA4):c.2930C>T (p.Thr977Met) | ABCA4-related retinopathy [RCV005359834]|Cone-rod dystrophy 3 [RCV005029647]|Retinal dystrophy [RCV004813673]|not provided [RCV001063061] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94044733 | 94044733 | Human | 8 | alternate_id |
| 26907323 | CV824482 | single nucleotide variant | NM_000350.3(ABCA4):c.2626C>T (p.Gln876Ter) | Retinal dystrophy [RCV001073797]|Severe early-childhood-onset retinal dystrophy [RCV004594246]|not provided [RCV001068714] | pathogenic|likely pathogenic | 1 | 94051660 | 94051660 | Human | 4 | alternate_id |
| 26895626 | CV824485 | single nucleotide variant | NM_000350.3(ABCA4):c.2396C>T (p.Pro799Leu) | Retinal dystrophy [RCV004813678]|Stargardt disease [RCV002469338]|not provided [RCV001064178] | pathogenic|likely pathogenic|uncertain significance | 1 | 94055302 | 94055302 | Human | 3 | alternate_id |
| 26885389 | CV824497 | single nucleotide variant | NM_000350.3(ABCA4):c.1792G>A (p.Val598Met) | ABCA4-related retinopathy [RCV005359819]|Cone-rod dystrophy 3 [RCV002481977]|Retinal dystrophy [RCV004813627]|not provided [RCV001053452] | uncertain significance | 1 | 94062722 | 94062722 | Human | 8 | alternate_id |
| 26919501 | CV824499 | single nucleotide variant | NM_000350.3(ABCA4):c.1592A>G (p.Glu531Gly) | Stargardt disease [RCV005429299]|not provided [RCV001045652] | pathogenic|likely pathogenic|uncertain significance | 1 | 94063280 | 94063280 | Human | 1 | alternate_id |
| 26904204 | CV824501 | single nucleotide variant | NM_000350.3(ABCA4):c.1496G>A (p.Trp499Ter) | Cone-rod dystrophy 3 [RCV005036344]|Retinal dystrophy [RCV001075839]|not provided [RCV001052785] | pathogenic|likely pathogenic | 1 | 94077748 | 94077748 | Human | 3 | alternate_id |
| 26893923 | CV824502 | single nucleotide variant | NM_000350.3(ABCA4):c.1342A>G (p.Met448Val) | Cone-rod dystrophy 3 [RCV005036365]|not provided [RCV001063057]|not specified [RCV004702620] | pathogenic|likely pathogenic|uncertain significance | 1 | 94078604 | 94078604 | Human | 1 | alternate_id |
| 26905704 | CV824513 | duplication | NM_000350.3(ABCA4):c.247_250dup (p.Ser84fs) | Cone-rod dystrophy 3 [RCV002471023]|Retinal dystrophy [RCV001074519]|Severe early-childhood-onset retinal dystrophy [RCV001352948]|not provided [RCV001059911] | pathogenic|likely pathogenic | 1 | 94111489 | 94111490 | Human | 5 | alternate_id |
| 26907201 | CV824517 | single nucleotide variant | NM_000350.3(ABCA4):c.93G>A (p.Trp31Ter) | Retinal dystrophy [RCV001074538]|Retinitis pigmentosa [RCV005236580]|Severe early-childhood-onset retinal dystrophy [RCV005232105]|not provided [RCV001067891] | pathogenic|likely pathogenic | 1 | 94113040 | 94113040 | Human | 6 | alternate_id |
| 26922168 | CV831959 | single nucleotide variant | NM_000322.5(PRPH2):c.683C>T (p.Thr228Ile) | PRPH2-related disorder [RCV001051591]|Patterned dystrophy of the retinal pigment epithelium [RCV001250315]|Stargardt disease [RCV001250332]|not provided [RCV001530252] | likely pathogenic|uncertain significance | 6 | 42704510 | 42704510 | Human | 2 | alternate_id |
| 26889057 | CV835088 | single nucleotide variant | NM_019098.5(CNGB3):c.168G>C (p.Lys56Asn) | Achromatopsia 3 [RCV001162610]|Severe early-childhood-onset retinal dystrophy [RCV001162611]|not provided [RCV001057922] | uncertain significance | 8 | 86739698 | 86739698 | Human | 3 | alternate_id |
| 26906828 | CV850822 | single nucleotide variant | NM_000350.3(ABCA4):c.859-9T>C | ABCA4-related disorder [RCV004536128]|Cone-rod dystrophy 3 [RCV005036373]|Retinal dystrophy [RCV001074005]|Severe early-childhood-onset retinal dystrophy [RCV005235516]|not provided [RCV001065436] | pathogenic|likely pathogenic|likely benign|conflicting interpretations of pathogenicity | 1 | 94080727 | 94080727 | Human | 8 | alternate_id |
| 26916469 | CV851007 | single nucleotide variant | NM_000350.3(ABCA4):c.5460+3G>A | Stargardt disease [RCV002468616]|not provided [RCV001040442] | likely pathogenic|uncertain significance | 1 | 94014540 | 94014540 | Human | 1 | alternate_id |
| 26916332 | CV851327 | duplication | NM_000350.3(ABCA4):c.1356+4dup | Severe early-childhood-onset retinal dystrophy [RCV001593204]|not provided [RCV001040253] | uncertain significance | 1 | 94078585 | 94078586 | Human | 2 | alternate_id |
| 26909716 | CV856029 | single nucleotide variant | NM_000350.3(ABCA4):c.6718A>G (p.Thr2240Ala) | Cone-rod dystrophy 3 [RCV005029676]|Retinal dystrophy [RCV001073878]|Severe early-childhood-onset retinal dystrophy [RCV004564573]|not provided [RCV001371824] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|no classifications from unflagged records | 1 | 93997872 | 93997872 | Human | 8 | alternate_id |
| 26909463 | CV856037 | single nucleotide variant | NM_000350.3(ABCA4):c.6191C>T (p.Ala2064Val) | Cone-rod dystrophy 3 [RCV005029675]|Retinal dystrophy [RCV001073480]|Retinitis pigmentosa [RCV004587039]|not provided [RCV003558652] | pathogenic|likely pathogenic | 1 | 94001949 | 94001949 | Human | 5 | alternate_id |
| 26910153 | CV856040 | single nucleotide variant | NM_000350.3(ABCA4):c.6094C>T (p.His2032Tyr) | Retinal dystrophy [RCV001074505]|Severe early-childhood-onset retinal dystrophy [RCV004570317]|not provided [RCV001366334] | pathogenic|uncertain significance | 1 | 94005494 | 94005494 | Human | 4 | alternate_id |
| 26910043 | CV856042 | single nucleotide variant | NM_000350.3(ABCA4):c.5951T>G (p.Met1984Arg) | Retinal dystrophy [RCV001074320]|Severe early-childhood-onset retinal dystrophy [RCV004570316]|not provided [RCV001209734] | pathogenic|uncertain significance | 1 | 94007688 | 94007688 | Human | 4 | alternate_id |
| 26910794 | CV856046 | single nucleotide variant | NM_000350.3(ABCA4):c.5824G>C (p.Glu1942Gln) | Retinal dystrophy [RCV001075476]|Severe early-childhood-onset retinal dystrophy [RCV004564578]|not provided [RCV001862615] | uncertain significance | 1 | 94008762 | 94008762 | Human | 4 | alternate_id |
| 26909374 | CV856060 | single nucleotide variant | NM_000350.3(ABCA4):c.5059A>T (p.Ile1687Phe) | Cone-rod dystrophy 3 [RCV005029673]|Retinal dystrophy [RCV001073357]|not provided [RCV001247223] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94019719 | 94019719 | Human | 3 | alternate_id |
| 26909722 | CV856064 | deletion | NM_000350.3(ABCA4):c.4880del (p.Leu1627fs) | ABCA4-related disorder [RCV004733149]|Retinal dystrophy [RCV001073887]|Severe early-childhood-onset retinal dystrophy [RCV004564574]|not provided [RCV001232685] | pathogenic|likely pathogenic | 1 | 94021378 | 94021378 | Human | 4 | alternate_id |
| 26910712 | CV856066 | single nucleotide variant | NM_000350.3(ABCA4):c.4773G>T (p.Gly1591=) | Retinal dystrophy [RCV001075350]|Severe early-childhood-onset retinal dystrophy [RCV004564577]|Stargardt disease [RCV004017784]|not provided [RCV001340257] | pathogenic|likely pathogenic|uncertain significance | 1 | 94021846 | 94021846 | Human | 4 | alternate_id |
| 26909630 | CV856067 | single nucleotide variant | NM_000350.3(ABCA4):c.4765G>A (p.Val1589Met) | Cone-rod dystrophy 3 [RCV002505662]|Retinal dystrophy [RCV001073758]|not provided [RCV001359813] | uncertain significance | 1 | 94021854 | 94021854 | Human | 3 | alternate_id |
| 26910471 | CV856071 | single nucleotide variant | NM_000350.3(ABCA4):c.4667G>C (p.Arg1556Thr) | ABCA4-related disorder [RCV004733152]|Retinal dystrophy [RCV001075014]|Severe early-childhood-onset retinal dystrophy [RCV004564576]|not provided [RCV001220523] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94023386 | 94023386 | Human | 4 | alternate_id |
| 26909371 | CV856080 | single nucleotide variant | NM_000350.3(ABCA4):c.3416A>G (p.Tyr1139Cys) | Cone-rod dystrophy 3 [RCV002497485]|Retinal dystrophy [RCV001073352]|not provided [RCV001220401] | uncertain significance | 1 | 94041315 | 94041315 | Human | 3 | alternate_id |
| 26909533 | CV856084 | single nucleotide variant | NM_000350.3(ABCA4):c.3386G>A (p.Arg1129His) | Cone-rod dystrophy 3 [RCV005036386]|Retinal dystrophy [RCV001073590]|not provided [RCV003405293] | pathogenic|likely pathogenic | 1 | 94041345 | 94041345 | Human | 3 | alternate_id |
| 26909406 | CV856085 | single nucleotide variant | NM_000350.3(ABCA4):c.3383A>G (p.Asp1128Gly) | Retinal dystrophy [RCV001073403]|Severe early-childhood-onset retinal dystrophy [RCV004559902] | likely pathogenic|uncertain significance | 1 | 94041348 | 94041348 | Human | 4 | alternate_id |
| 26910174 | CV856097 | single nucleotide variant | NM_000350.3(ABCA4):c.2576A>G (p.Gln859Arg) | Cone-rod dystrophy 3 [RCV002505665]|Retinal dystrophy [RCV001074539]|not provided [RCV001346357] | uncertain significance | 1 | 94055122 | 94055122 | Human | 3 | alternate_id |
| 26910195 | CV856103 | single nucleotide variant | NM_000350.3(ABCA4):c.1995C>A (p.Tyr665Ter) | Cone-rod dystrophy 3 [RCV005029680]|Retinal dystrophy [RCV001074567]|Severe early-childhood-onset retinal dystrophy [RCV001376519]|not provided [RCV001381381] | pathogenic | 1 | 94060702 | 94060702 | Human | 8 | alternate_id |
| 26909433 | CV856108 | single nucleotide variant | NM_000350.3(ABCA4):c.1726G>C (p.Asp576His) | Cone-rod dystrophy 3 [RCV005029674]|Retinal dystrophy [RCV001073439]|not provided [RCV001862502] | pathogenic|likely pathogenic | 1 | 94063146 | 94063146 | Human | 3 | alternate_id |
| 26910202 | CV856119 | single nucleotide variant | NM_000350.3(ABCA4):c.868C>T (p.Arg290Trp) | Retinal dystrophy [RCV001074574]|Severe early-childhood-onset retinal dystrophy [RCV001729794]|Stargardt disease 3 [RCV004559903]|not provided [RCV001268174] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity | 1 | 94080709 | 94080709 | Human | 5 | alternate_id |
| 26910690 | CV856454 | single nucleotide variant | NM_000322.5(PRPH2):c.708C>G (p.Tyr236Ter) | PRPH2-related disorder [RCV001386137]|Patterned dystrophy of the retinal pigment epithelium [RCV001250333]|Retinal dystrophy [RCV001075315]|Stargardt disease [RCV001250334]|not provided [RCV001530324] | pathogenic|likely pathogenic | 6 | 42704485 | 42704485 | Human | 4 | alternate_id |
| 26910487 | CV856459 | single nucleotide variant | NM_000322.5(PRPH2):c.665G>A (p.Cys222Tyr) | PRPH2-related disorder [RCV001228233]|Retinal dystrophy [RCV001075038]|Stargardt disease [RCV001250313]|not provided [RCV001530249] | pathogenic|likely pathogenic|uncertain significance | 6 | 42704528 | 42704528 | Human | 4 | alternate_id |
| 26909549 | CV856470 | single nucleotide variant | NM_000322.5(PRPH2):c.246C>A (p.Cys82Ter) | PRPH2-related disorder [RCV001862510]|Retinal dystrophy [RCV001073624]|Stargardt disease [RCV001250293]|not provided [RCV001530300] | pathogenic|likely pathogenic | 6 | 42722089 | 42722089 | Human | 4 | alternate_id |
| 26910194 | CV857141 | single nucleotide variant | NM_000350.3(ABCA4):c.6817-2A>G | Retinal dystrophy [RCV001074566]|Severe early-childhood-onset retinal dystrophy [RCV003989637]|not provided [RCV001862833] | pathogenic|likely pathogenic | 1 | 93993244 | 93993244 | Human | 4 | alternate_id |
| 26909965 | CV857147 | single nucleotide variant | NM_000350.3(ABCA4):c.4849-1G>A | ABCA4-related disorder [RCV004733150]|Cone-rod dystrophy 3 [RCV005029679]|Retinal dystrophy [RCV001074206]|Severe early-childhood-onset retinal dystrophy [RCV004564575]|not provided [RCV001235111] | pathogenic|likely pathogenic | 1 | 94021410 | 94021410 | Human | 8 | alternate_id |
| 26910499 | CV857160 | single nucleotide variant | NM_000350.3(ABCA4):c.3523-2A>G | Retinal dystrophy [RCV001075055]|Severe early-childhood-onset retinal dystrophy [RCV005235521] | pathogenic|likely pathogenic | 1 | 94040129 | 94040129 | Human | 4 | alternate_id |
| 26910644 | CV857174 | single nucleotide variant | NM_000350.3(ABCA4):c.302+4A>C | Cone-rod dystrophy 3 [RCV005029682]|Retinal dystrophy [RCV001075244]|Retinitis pigmentosa 19 [RCV005253712]|Retinitis pigmentosa [RCV004689988]|not provided [RCV005093414] | pathogenic|likely pathogenic | 1 | 94111434 | 94111434 | Human | 6 | alternate_id |
| 28887191 | CV858972 | microsatellite | NM_000350.3(ABCA4):c.4246TTC[1] (p.Phe1417del) | Retinal dystrophy [RCV004813745]|Severe early-childhood-onset retinal dystrophy [RCV004564579]|not provided [RCV001091947] | pathogenic|conflicting interpretations of pathogenicity | 1 | 94030998 | 94031000 | Human | | alternate_id |
| 28884832 | CV858974 | deletion | NM_000350.3(ABCA4):c.967del (p.Leu323fs) | Stargardt disease [RCV005418992]|not provided [RCV001091617] | pathogenic | 1 | 94080610 | 94080610 | Human | 1 | alternate_id |
| 28884656 | CV864842 | single nucleotide variant | NM_000350.3(ABCA4):c.6805C>T (p.Arg2269Ter) | ABCA4-related disorder [RCV001097881]|Cone-rod dystrophy 3 [RCV002489742]|not provided [RCV001856321] | uncertain significance | 1 | 93996120 | 93996120 | Human | 6 | alternate_id |
| 28909027 | CV900096 | single nucleotide variant | NM_019098.4(CNGB3):c.*1733T>C | Achromatopsia 3 [RCV001160380]|Severe early-childhood-onset retinal dystrophy [RCV001160381] | uncertain significance | 8 | 86574071 | 86574071 | Human | 3 | alternate_id |
| 28909030 | CV900097 | single nucleotide variant | NM_019098.4(CNGB3):c.*1705A>C | Achromatopsia 3 [RCV001160382]|Severe early-childhood-onset retinal dystrophy [RCV001160383] | uncertain significance | 8 | 86574099 | 86574099 | Human | 3 | alternate_id |
| 28867689 | CV900098 | single nucleotide variant | NM_019098.4(CNGB3):c.*1654C>T | Achromatopsia 3 [RCV001162032]|Severe early-childhood-onset retinal dystrophy [RCV001162033] | uncertain significance | 8 | 86574150 | 86574150 | Human | 3 | alternate_id |
| 28871633 | CV900099 | single nucleotide variant | NM_019098.5(CNGB3):c.*1476T>A | Achromatopsia 3 [RCV001164045]|Severe early-childhood-onset retinal dystrophy [RCV001164044] | uncertain significance | 8 | 86574328 | 86574328 | Human | 3 | alternate_id |
| 28906769 | CV900100 | single nucleotide variant | NM_019098.5(CNGB3):c.*1431G>A | Achromatopsia 3 [RCV001159141]|Severe early-childhood-onset retinal dystrophy [RCV001159140] | uncertain significance | 8 | 86574373 | 86574373 | Human | 3 | alternate_id |
| 28909226 | CV900101 | single nucleotide variant | NM_019098.5(CNGB3):c.*1218C>T | Achromatopsia 3 [RCV001160493]|Severe early-childhood-onset retinal dystrophy [RCV001160492] | uncertain significance | 8 | 86574586 | 86574586 | Human | 3 | alternate_id |
| 28909228 | CV900102 | single nucleotide variant | NM_019098.5(CNGB3):c.*1143T>C | Achromatopsia 3 [RCV001160494]|Severe early-childhood-onset retinal dystrophy [RCV001160495] | uncertain significance | 8 | 86574661 | 86574661 | Human | 3 | alternate_id |
| 28867848 | CV900103 | single nucleotide variant | NM_019098.5(CNGB3):c.*997A>G | Achromatopsia 3 [RCV001162126]|Severe early-childhood-onset retinal dystrophy [RCV001162127] | benign|likely benign | 8 | 86574807 | 86574807 | Human | 3 | alternate_id |
| 28867850 | CV900104 | single nucleotide variant | NM_019098.5(CNGB3):c.*915G>C | Achromatopsia 3 [RCV001162129]|Severe early-childhood-onset retinal dystrophy [RCV001162128] | benign | 8 | 86574889 | 86574889 | Human | 3 | alternate_id |
| 28867854 | CV900105 | single nucleotide variant | NM_019098.5(CNGB3):c.*800C>G | Achromatopsia 3 [RCV001162131]|Severe early-childhood-onset retinal dystrophy [RCV001162130] | uncertain significance | 8 | 86575004 | 86575004 | Human | 3 | alternate_id |
| 28871874 | CV900106 | single nucleotide variant | NM_019098.5(CNGB3):c.*737T>C | Achromatopsia 3 [RCV001164146]|Severe early-childhood-onset retinal dystrophy [RCV001164147] | uncertain significance | 8 | 86575067 | 86575067 | Human | 3 | alternate_id |
| 28906951 | CV900107 | single nucleotide variant | NM_019098.5(CNGB3):c.*649A>G | Achromatopsia 3 [RCV001159238]|Severe early-childhood-onset retinal dystrophy [RCV001159237] | uncertain significance | 8 | 86575155 | 86575155 | Human | 3 | alternate_id |
| 28906955 | CV900108 | single nucleotide variant | NM_019098.5(CNGB3):c.*570T>C | Achromatopsia 3 [RCV001159240]|Severe early-childhood-onset retinal dystrophy [RCV001159239] | uncertain significance | 8 | 86575234 | 86575234 | Human | 3 | alternate_id |
| 28906957 | CV900109 | single nucleotide variant | NM_019098.5(CNGB3):c.*499G>C | Achromatopsia 3 [RCV001159241]|Severe early-childhood-onset retinal dystrophy [RCV001159242] | uncertain significance | 8 | 86575305 | 86575305 | Human | 3 | alternate_id |
| 28909400 | CV900110 | single nucleotide variant | NM_019098.5(CNGB3):c.*435G>A | Achromatopsia 3 [RCV001160593]|Severe early-childhood-onset retinal dystrophy [RCV001160592] | uncertain significance | 8 | 86575369 | 86575369 | Human | 3 | alternate_id |
| 28867973 | CV900111 | single nucleotide variant | NM_019098.5(CNGB3):c.*291T>A | Achromatopsia 3 [RCV001162207]|Severe early-childhood-onset retinal dystrophy [RCV001162208] | uncertain significance | 8 | 86575513 | 86575513 | Human | 3 | alternate_id |
| 28867975 | CV900112 | single nucleotide variant | NM_019098.5(CNGB3):c.*272G>T | Achromatopsia 3 [RCV001162210]|Severe early-childhood-onset retinal dystrophy [RCV001162209] | uncertain significance | 8 | 86575532 | 86575532 | Human | 3 | alternate_id |
| 28867979 | CV900113 | single nucleotide variant | NM_019098.5(CNGB3):c.*183A>C | Achromatopsia 3 [RCV001162211]|Severe early-childhood-onset retinal dystrophy [RCV001162212] | uncertain significance | 8 | 86575621 | 86575621 | Human | 3 | alternate_id |
| 28872085 | CV900114 | single nucleotide variant | NM_019098.5(CNGB3):c.*108C>T | Achromatopsia 3 [RCV001164238]|Severe early-childhood-onset retinal dystrophy [RCV001164237]|not provided [RCV004695066] | uncertain significance | 8 | 86575696 | 86575696 | Human | 3 | alternate_id |
| 28907130 | CV900115 | single nucleotide variant | NM_019098.5(CNGB3):c.*29G>T | Achromatopsia 3 [RCV001159335]|Severe early-childhood-onset retinal dystrophy [RCV001159334] | uncertain significance | 8 | 86575775 | 86575775 | Human | 3 | alternate_id |
| 28907132 | CV900116 | single nucleotide variant | NM_019098.5(CNGB3):c.2423A>C (p.Lys808Thr) | Achromatopsia 3 [RCV001159336]|Inborn genetic diseases [RCV002558410]|Severe early-childhood-onset retinal dystrophy [RCV001159337] | uncertain significance | 8 | 86575811 | 86575811 | Human | 4 | alternate_id |
| 28907134 | CV900117 | single nucleotide variant | NM_019098.5(CNGB3):c.2419G>A (p.Ala807Thr) | Achromatopsia 3 [RCV001159338]|Severe early-childhood-onset retinal dystrophy [RCV001159339]|not provided [RCV002558411] | uncertain significance | 8 | 86575815 | 86575815 | Human | 3 | alternate_id |
| 28909554 | CV900118 | single nucleotide variant | NM_019098.5(CNGB3):c.2350C>T (p.Leu784Phe) | Achromatopsia 3 [RCV001160704]|Severe early-childhood-onset retinal dystrophy [RCV001160705] | uncertain significance | 8 | 86575884 | 86575884 | Human | 3 | alternate_id |
| 28868149 | CV900119 | single nucleotide variant | NM_019098.5(CNGB3):c.2087G>A (p.Arg696Gln) | Achromatopsia 3 [RCV001162314]|Achromatopsia [RCV001828576]|Inborn genetic diseases [RCV003353182]|Severe early-childhood-onset retinal dystrophy [RCV001162315]|not provided [RCV001247986] | likely benign|uncertain significance | 8 | 86578705 | 86578705 | Human | 7 | alternate_id |
| 28907269 | CV900120 | single nucleotide variant | NM_019098.5(CNGB3):c.1773A>G (p.Gly591=) | Achromatopsia 3 [RCV001159423]|Severe early-childhood-onset retinal dystrophy [RCV001159424] | uncertain significance | 8 | 86604101 | 86604101 | Human | 3 | alternate_id |
| 28909691 | CV900121 | single nucleotide variant | NM_019098.5(CNGB3):c.1515G>A (p.Thr505=) | Achromatopsia 3 [RCV001160800]|Achromatopsia [RCV001828574]|Severe early-childhood-onset retinal dystrophy [RCV001160801]|not provided [RCV001240796] | likely benign|uncertain significance | 8 | 86626046 | 86626046 | Human | 6 | alternate_id |
| 28872573 | CV900122 | single nucleotide variant | NM_019098.5(CNGB3):c.989A>G (p.Lys330Arg) | Achromatopsia 3 [RCV001164463]|Severe early-childhood-onset retinal dystrophy [RCV001164464] | uncertain significance | 8 | 86647802 | 86647802 | Human | 3 | alternate_id |
| 28868486 | CV900123 | single nucleotide variant | NM_019098.5(CNGB3):c.721G>A (p.Val241Ile) | Achromatopsia 3 [RCV001160908]|Severe early-childhood-onset retinal dystrophy [RCV001162522]|not provided [RCV001474218] | likely benign|uncertain significance | 8 | 86667056 | 86667056 | Human | 3 | alternate_id |
| 28868490 | CV900124 | single nucleotide variant | NM_019098.5(CNGB3):c.677C>A (p.Thr226Asn) | Achromatopsia 3 [RCV001164560]|Severe early-childhood-onset retinal dystrophy [RCV001162525]|not provided [RCV002558550] | uncertain significance | 8 | 86667100 | 86667100 | Human | 3 | alternate_id |
| 28907610 | CV900125 | single nucleotide variant | NM_019098.5(CNGB3):c.473C>T (p.Pro158Leu) | Achromatopsia 3 [RCV001159642]|Retinal dystrophy [RCV004813812]|Severe early-childhood-onset retinal dystrophy [RCV001159643] | uncertain significance | 8 | 86670964 | 86670964 | Human | 5 | alternate_id |
| 28907614 | CV900126 | single nucleotide variant | NM_019098.5(CNGB3):c.460G>T (p.Asp154Tyr) | Achromatopsia 3 [RCV001159646]|Severe early-childhood-onset retinal dystrophy [RCV001159645] | uncertain significance | 8 | 86670977 | 86670977 | Human | 3 | alternate_id |
| 28909977 | CV900127 | single nucleotide variant | NM_019098.5(CNGB3):c.387T>G (p.Asp129Glu) | Achromatopsia 3 [RCV001161024]|Severe early-childhood-onset retinal dystrophy [RCV001161025] | uncertain significance | 8 | 86671050 | 86671050 | Human | 3 | alternate_id |
| 28873002 | CV900128 | single nucleotide variant | NM_019098.5(CNGB3):c.-1G>A | Achromatopsia 3 [RCV001164672]|Severe early-childhood-onset retinal dystrophy [RCV001164671] | uncertain significance | 8 | 86743628 | 86743628 | Human | 3 | alternate_id |
| 34890998 | CV905881 | deletion | NM_000350.3(ABCA4):c.6146del (p.Lys2049fs) | Retinitis pigmentosa 19 [RCV005253730]|Severe early-childhood-onset retinal dystrophy [RCV001250529]|Stargardt disease [RCV001174687]|not provided [RCV003727942] | pathogenic | 1 | 94005442 | 94005442 | Human | 3 | alternate_id |
| 38462790 | CV918665 | single nucleotide variant | NM_000350.3(ABCA4):c.676C>A (p.Arg226Ser) | Age related macular degeneration 2 [RCV001196793]|Cone-rod dystrophy 3 [RCV005359925]|Severe early-childhood-onset retinal dystrophy [RCV001352988]|not provided [RCV001233979] | likely pathogenic|uncertain significance | 1 | 94098886 | 94098886 | Human | 6 | alternate_id |
| 38471013 | CV930698 | single nucleotide variant | NM_000350.3(ABCA4):c.2473G>A (p.Gly825Arg) | Retinal dystrophy [RCV004813895]|Severe early-childhood-onset retinal dystrophy [RCV001376391]|not provided [RCV001213685] | uncertain significance | 1 | 94055225 | 94055225 | Human | 4 | alternate_id |
| 38458608 | CV930702 | inversion | NM_000350.3(ABCA4):c.1267_1268inv (p.His423Cys) | Stargardt disease [RCV002471046]|not provided [RCV001211455] | uncertain significance | 1 | 94078678 | 94078679 | Human | | alternate_id |
| 38471031 | CV933337 | single nucleotide variant | NM_000322.5(PRPH2):c.403A>G (p.Lys135Glu) | PRPH2-related disorder [RCV001208448]|Stargardt disease [RCV001250305]|not provided [RCV001530284] | uncertain significance | 6 | 42721932 | 42721932 | Human | 2 | alternate_id |
| 38477813 | CV933524 | single nucleotide variant | NM_022726.4(ELOVL4):c.226C>T (p.Arg76Cys) | Spinocerebellar ataxia type 34 [RCV005036457]|not provided [RCV001205258] | uncertain significance | 6 | 79926256 | 79926256 | Human | 1 | alternate_id |
| 38479819 | CV939832 | single nucleotide variant | NM_000350.3(ABCA4):c.303-3C>T | Cone-rod dystrophy 3 [RCV002484113]|not provided [RCV001206140] | uncertain significance | 1 | 94108719 | 94108719 | Human | 1 | alternate_id |
| 38471078 | CV940038 | single nucleotide variant | NM_000322.5(PRPH2):c.582-1G>A | Choroideremia [RCV005419038]|PRPH2-related disorder [RCV001212443]|Retinal dystrophy [RCV004813889]|Stargardt disease [RCV001250354]|not provided [RCV001530353] | pathogenic|likely pathogenic | 6 | 42704612 | 42704612 | Human | 6 | alternate_id |
| 38475811 | CV942123 | single nucleotide variant | NM_000350.3(ABCA4):c.3812A>G (p.Glu1271Gly) | Severe early-childhood-onset retinal dystrophy [RCV003313997]|not provided [RCV001232792] | pathogenic|likely pathogenic|uncertain significance | 1 | 94037146 | 94037146 | Human | 2 | alternate_id |
| 38481568 | CV942127 | single nucleotide variant | NM_000350.3(ABCA4):c.3352C>T (p.His1118Tyr) | Severe early-childhood-onset retinal dystrophy [RCV004557470]|not provided [RCV001235193] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94041379 | 94041379 | Human | 2 | alternate_id |
| 38466209 | CV942129 | single nucleotide variant | NM_000350.3(ABCA4):c.2900C>T (p.Ala967Val) | Cone-rod dystrophy 3 [RCV005036499]|Retinitis pigmentosa [RCV004587084]|not provided [RCV001230252] | likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance | 1 | 94046937 | 94046937 | Human | 3 | alternate_id |
| 38477105 | CV942145 | single nucleotide variant | NM_000350.3(ABCA4):c.61C>T (p.Gln21Ter) | Retinal dystrophy [RCV004813942]|Severe early-childhood-onset retinal dystrophy [RCV001353021]|not provided [RCV001233348] | pathogenic|likely pathogenic | 1 | 94120985 | 94120985 | Human | 4 | alternate_id |
| 38497195 | CV943737 | single nucleotide variant | NM_198506.5(LRIT3):c.277G>T (p.Val93Leu) | Stargardt disease [RCV002466640]|not provided [RCV001226899] | pathogenic|uncertain significance | 4 | 109851664 | 109851664 | Human | 1 | alternate_id |
| 38471174 | CV945035 | deletion | NM_000322.5(PRPH2):c.318del (p.Leu107fs) | PRPH2-related disorder [RCV001229461]|Patterned dystrophy of the retinal pigment epithelium [RCV001732083]|Retinal dystrophy [RCV004813925]|Stargardt disease [RCV001250300]|not provided [RCV001530222] | pathogenic|likely pathogenic | 6 | 42722017 | 42722017 | Human | 4 | alternate_id |
| 38471194 | CV945036 | deletion | NM_000322.5(PRPH2):c.310_313del (p.Ile104fs) | PRPH2-related disorder [RCV001232081]|Patterned dystrophy of the retinal pigment epithelium [RCV001250298]|Stargardt disease [RCV001250299]|not provided [RCV001530221] | pathogenic | 6 | 42722022 | 42722025 | Human | 2 | alternate_id |
| 38493162 | CV952532 | single nucleotide variant | NM_000350.3(ABCA4):c.6306C>A (p.Asp2102Glu) | Severe early-childhood-onset retinal dystrophy [RCV004562083]|Stargardt disease [RCV005057139]|not provided [RCV001240517] | pathogenic|likely pathogenic | 1 | 94001082 | 94001082 | Human | 2 | alternate_id |
| 38496644 | CV952533 | indel | NM_000350.3(ABCA4):c.5959_5964delinsTG (p.Thr1986_Gly1987insTer) | Cone-rod dystrophy 3 [RCV002504344]|not provided [RCV001242691] | pathogenic|likely pathogenic | 1 | 94007675 | 94007680 | Human | | alternate_id |
| 38498343 | CV952555 | single nucleotide variant | NM_000350.3(ABCA4):c.766G>T (p.Val256Leu) | Cone-rod dystrophy 3 [RCV002491814]|Retinal dystrophy [RCV004813995]|not provided [RCV001243761] | uncertain significance | 1 | 94098796 | 94098796 | Human | 3 | alternate_id |
| 38482401 | CV959571 | single nucleotide variant | NM_000350.3(ABCA4):c.2382+1G>A | Stargardt disease [RCV005419046]|not provided [RCV001235513] | pathogenic|likely pathogenic | 1 | 94056600 | 94056600 | Human | 1 | alternate_id |
| 38495951 | CV960458 | single nucleotide variant | NM_201548.5(CERKL):c.678-1G>A | Retinitis pigmentosa 26 [RCV003469461]|Stargardt disease [RCV002466648]|not provided [RCV001242249] | pathogenic|likely pathogenic | 2 | 181558709 | 181558709 | Human | 2 | alternate_id |
| 38465807 | CV962010 | single nucleotide variant | NM_000322.5(PRPH2):c.961G>T (p.Glu321Ter) | Stargardt disease [RCV001250381]|not provided [RCV001530391] | pathogenic|uncertain significance | 6 | 42698375 | 42698375 | Human | 1 | alternate_id |
| 38465762 | CV962014 | single nucleotide variant | NM_000322.5(PRPH2):c.642C>A (p.Cys214Ter) | PRPH2-related disorder [RCV001387192]|Stargardt disease [RCV001250310]|not provided [RCV001530363] | pathogenic|likely pathogenic | 6 | 42704551 | 42704551 | Human | 2 | alternate_id |
| 38465758 | CV962015 | single nucleotide variant | NM_000322.5(PRPH2):c.638G>C (p.Cys213Ser) | PRPH2-related disorder [RCV002568706]|Stargardt disease [RCV001250307]|not provided [RCV001530361] | pathogenic|likely pathogenic | 6 | 42704555 | 42704555 | Human | 2 | alternate_id |
| 38465741 | CV962017 | single nucleotide variant | NM_000322.5(PRPH2):c.614T>C (p.Leu205Pro) | PRPH2-related disorder [RCV003770295]|Stargardt disease [RCV001250283]|not provided [RCV001530237] | uncertain significance | 6 | 42704579 | 42704579 | Human | 2 | alternate_id |
| 38465735 | CV962018 | single nucleotide variant | NM_000322.5(PRPH2):c.612C>A (p.Tyr204Ter) | PRPH2-related disorder [RCV001879779]|Patterned dystrophy of the retinal pigment epithelium [RCV001250281]|Stargardt disease [RCV001250373]|Vitelliform macular dystrophy 2 [RCV001250282] | pathogenic | 6 | 42704581 | 42704581 | Human | 4 | alternate_id |
| 38465937 | CV962020 | duplication | NM_000322.5(PRPH2):c.588_589dup (p.Lys197fs) | Stargardt disease [RCV001250278]|not provided [RCV001530359] | pathogenic|likely pathogenic | 6 | 42704603 | 42704604 | Human | 1 | alternate_id |
| 38465804 | CV962022 | single nucleotide variant | NM_000322.5(PRPH2):c.541A>T (p.Ser181Cys) | Stargardt disease [RCV001250372] | uncertain significance | 6 | 42721794 | 42721794 | Human | 1 | alternate_id |
| 38465772 | CV962025 | single nucleotide variant | NM_000322.5(PRPH2):c.458A>C (p.Lys153Thr) | Stargardt disease [RCV001250323]|not provided [RCV001530341] | uncertain significance | 6 | 42721877 | 42721877 | Human | 1 | alternate_id |
| 38465754 | CV962026 | single nucleotide variant | NM_000322.5(PRPH2):c.380A>G (p.Glu127Gly) | Cone-rod dystrophy [RCV001250301]|PRPH2-related disorder [RCV001400129]|Stargardt disease [RCV001250302]|not provided [RCV001530280] | likely pathogenic|likely benign|uncertain significance | 6 | 42721955 | 42721955 | Human | 5 | alternate_id |
| 38465749 | CV962027 | deletion | NM_000322.5(PRPH2):c.163del (p.Ser55fs) | PRPH2-related disorder [RCV001381387]|Stargardt disease [RCV001250292]|not provided [RCV001530294] | pathogenic | 6 | 42722172 | 42722172 | Human | 2 | alternate_id |
| 38465787 | CV962028 | single nucleotide variant | NM_000322.5(PRPH2):c.828+2T>C | PRPH2-related disorder [RCV001301121]|Stargardt disease [RCV001250343]|not provided [RCV001530260] | pathogenic|likely pathogenic|uncertain significance | 6 | 42704363 | 42704363 | Human | 2 | alternate_id |
| 40888008 | CV972858 | single nucleotide variant | NM_000539.3(RHO):c.361G>A (p.Gly121Ser) | Severe early-childhood-onset retinal dystrophy [RCV001265182]|not provided [RCV001323778] | uncertain significance | 3 | 129529094 | 129529094 | Human | 2 | alternate_id |
| 126730475 | CV986106 | deletion | NM_000554.6(CRX):c.590del (p.Pro197fs) | Leber congenital amaurosis 7 [RCV001925009]|Retinal dystrophy [RCV004815748]|Stargardt disease [RCV002466710] | pathogenic|likely pathogenic|uncertain significance | 19 | 47839654 | 47839654 | Human | 5 | alternate_id |
| 8639791 | CV98774 | single nucleotide variant | NM_000350.3(ABCA4):c.3322C>T (p.Arg1108Cys) | ABCA4-related disorder [RCV004537308]|Age related macular degeneration 2 [RCV001195927]|Cone-rod dystrophy 3 [RCV002490678]|Inborn genetic diseases [RCV005338078]|Retinal dystrophy [RCV001074904]|Severe early-childhood-onset retinal dystrophy [RCV000150052]|Star gardt disease [RCV001002834]|not provided [RCV000078665] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|not provided | 1 | 94042767 | 94042767 | Human | 9 | alternate_id |
| 8639794 | CV98777 | single nucleotide variant | NM_000350.3(ABCA4):c.5461-10T>C | ABCA4-related disorder [RCV004732655]|Age related macular degeneration 2 [RCV000678511]|Benign concentric annular macular dystrophy [RCV000210325]|Cone-rod dystrophy 3 [RCV000008366]|Cone-rod dystrophy 3 [RCV000763440]|Inborn genetic diseases [RCV004975272]|Macular dystrophy [RCV000504857]|Retinal d ystrophy [RCV000210327]|Retinitis pigmentosa 19 [RCV001542559]|Retinitis pigmentosa [RCV000787510]|Severe early-childhood-onset retinal dystrophy [RCV000177965]|Stargardt disease [RCV000787771]|not provided [RCV000078669]|not specified [RCV001000430] | pathogenic|likely pathogenic|conflicting interpretations of pathogenicity|uncertain significance|not provided | 1 | 94011395 | 94011395 | Human | 14 | alternate_id |
| 126734135 | CV987772 | single nucleotide variant | NM_000350.3(ABCA4):c.5691G>T (p.Gln1897His) | Severe early-childhood-onset retinal dystrophy [RCV001352990]|Stargardt disease [RCV005236773]|not provided [RCV001296443] | pathogenic|likely pathogenic|uncertain significance | 1 | 94010823 | 94010823 | Human | 2 | alternate_id |
| 8639795 | CV98778 | single nucleotide variant | NM_000350.3(ABCA4):c.67-2A>G | Cone-rod dystrophy 3 [RCV005025131]|Retinal dystrophy [RCV001074239]|Severe early-childhood-onset retinal dystrophy [RCV000078672]|Visual impairment [RCV000415227]|not provided [RCV000723703] | pathogenic|likely pathogenic | 1 | 94113068 | 94113068 | Human | 15 | alternate_id |
| 126762406 | CV987786 | single nucleotide variant | NM_000350.3(ABCA4):c.3076T>C (p.Phe1026Leu) | Cone-rod dystrophy 3 [RCV002486156]|not provided [RCV001300386] | uncertain significance | 1 | 94043450 | 94043450 | Human | 1 | alternate_id |
| 126732620 | CV987788 | single nucleotide variant | NM_000350.3(ABCA4):c.3016G>C (p.Gly1006Arg) | Severe early-childhood-onset retinal dystrophy [RCV001376520]|not provided [RCV001294592] | likely pathogenic|uncertain significance | 1 | 94044647 | 94044647 | Human | 2 | alternate_id |
| 126737526 | CV987797 | single nucleotide variant | NM_000350.3(ABCA4):c.1694C>A (p.Pro565His) | Stargardt disease [RCV002468632]|not provided [RCV001295365] | likely pathogenic|likely benign|uncertain significance | 1 | 94063178 | 94063178 | Human | 1 | alternate_id |
| 126750392 | CV987802 | single nucleotide variant | NM_000350.3(ABCA4):c.1019A>C (p.Tyr340Ser) | Cone-rod dystrophy 3 [RCV005029864]|not provided [RCV001297313]|not specified [RCV004690068] | likely pathogenic|uncertain significance | 1 | 94080558 | 94080558 | Human | 1 | alternate_id |
| 126759207 | CV991810 | single nucleotide variant | NM_022726.4(ELOVL4):c.164T>A (p.Leu55His) | Spinocerebellar ataxia type 34 [RCV005394913]|not provided [RCV001299422] | uncertain significance | 6 | 79926318 | 79926318 | Human | 1 | alternate_id |