Trim44 Strain Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

Strains search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

2 records found for search term Trim44

Refine Term:

Sort By:

Rat

Export

RGD ID	Symbol	Name	Origin	Source	Type	Annotations	Match
329969883	SD-Trim44^em1Lizh		A pair of synthetic oligonucleotides for sgRNA (sgRNA1, CCTTGCCGCTTTAAGTGACTC; sgRNA2, CCATGTTGGGAGCATTGCCTA) were annealed and then cloned into the pUC57-sgRNA expression vector, and the floxed plasmid donor was cloned into the pGSI plasmid. Both the Cas9 and sgRNA expression plasmids were lineariz ... (more) ed and used as templates for in vitro transcription. A mixture of the donor vector (4Ã¢â¬â¦ng/ul), Cas9 mRNA (25Ã¢â¬â¦ng/ul), and sgRNAs (10Ã¢â¬â¦ng/ul each) was microinjected into both the cytoplasm and male pronucleus of the fertilized eggs. The injected zygotes were then transferred to pseudopregnant SD rats, which then carried them to parturition. This is called conditional knockout Trim44 (Trim44 cKO).		mutant	1	symbol , old_strain_name , origin
329969885	SD-Trim44^em1Lizh,Tg(Myh6-cre)Lizh		The conditional Trim44 knockout (Trim44 cKO, SD-Trim44em1Lizh, RGD:329969883) was bred with the Î±-MHC-Cre tool rat (SD-Tg(Myh6-cre)Lizh, RGD:329969882) to generate cardiac-specific ... (more) an style='font-weight:700;'>Trim44 knockout which had the Trim44flox/flox/Î±-MHC-Cre genotype.		mutant	2	symbol , origin , old_strain_symbol