| 728138 | SS.MNS-(Mme-Gca)/Ayd | | Segments from Milan normotensive rat were inserted in thre homologous region of Dahl salt-sensitive | | congenic | 2 | symbol , old_strain_symbol |
| 13462045 | LE-Tg(Thy1-GCaMP6f)7Rrrc | | Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-c hain kinase. | Rat Resource & Research Center | transgenic | 1 | symbol , origin |
| 401959229 | LE-Tg(Thy1-GCaMP6f)8Rrrc | | Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-ch ain kinase. Reference ID: https://doi.org/10.1101/2023.08.17.553594 | Rat Resource & Research Center | transgenic | 1 | symbol , origin |
| 13462044 | LE-Tg(Thy1-GCaMP6f)9Rrrc | | Pronuclear injection was used to introduce an expression cassette containing the Thy-1 enhancer and GCaMP6f protein coding sequence. GCaMP6f is a genetically encoded calcium indicator. It is a synthetic fusion of green fluorescent protein, calmodulin, and M13, a peptide sequence from myosin light-c hain kinase. | Rat Resource & Research Center | transgenic | 1 | symbol , origin |
| 598092585 | SD.LIS-Actbtm1(CAG-GCaMP8)Ksak | | The ES cell line derived from Lister Hooded rats (Seac:LIS), which was established by Prof. Sakimura at Department of Animal Model Development, Brain Research Institute, Niigata University, was used. Cloned ES cells established by introducing a vector of G8CaMP-flox stop at the 3'non-coding site of the Actb gene were injected into fertilized eggs of SD rats (Slc:SD) using a microinjection method. | National BioResource Project for the Rat in Japan | mutant | 1 | symbol |
| 1579909 | FHH-Fgl2m1Mcwi | | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. A301S mutation is generated from the codon change GCA/TCA. | | mutant | 1 | origin |
| 150429988 | SHR-Tg(EEF1A1-Wars2)Ipcv | | This strain was derived by microinjecting fertilized eggs with a mix of the Sleeping Beauty construct containing BN Wars2 cDNA under control of the universal EF-1α (human EEF1A1) promoter and mRNA of the SB100X transposase (Ivics et al. 2014). Transgenic rats were detected using PCR with the follow ing primers: Wars2-F 5'-TGT GCT ACA AGT CCA CAC AC-3' and Wars2-R 5'-GCA GAA GGG TCA CGA AGA GA-3'. | | transgenic | 3 | origin |
| 1642281 | SS-Podxlm1Mcwi | | Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. T154A mutation is generated from the codon change ACA/GCA. | | mutant | 1 | origin |
| 408364958 | SD-Cyp27b1em1Hfd | | The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos
WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCA ht:700;'>GCAAAGGGGG
KO: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCAAAGGGGG | Rat Resource and Research Center (RRRC); strain ID 1031 | mutant | 1 | origin |
| 405850241 | SD-Mir500 em1Cgen | | Sprague Dawley rats by microinjection of TALENs in fertilized eggs (Cyagen Biosciences). Briefly, the rno-mir-500 gene (Gene ID: 100314112; MirBase accession no. MIMAT0005321), which was located on rat chromosome X, was selected as the TALEN target site. TALENs were constructed using the Golden Gate Assembly and confirmed by sequencing. The founder, which carried 8- bp deletion (GCACCTGG) in the both strands compared with the wild-type (WT) DNA sequence, were genotyped by PCR followed by DNA-sequencing analysis. After that, heterozygous F1 were produced by mating F0 with WT rats. Heterozygous F1 rats were determined and mated to produce homozygote mutant (mir-500−/−) and WT (mir-500+/+). | | mutant | 4 | origin |
| 39128170 | SHRSP-Stim1em1Izm | | "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.19 18C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence.
The sequence of the guide RNA target site is as follows,
Stim1: 5'-GCAGGGTAGCTGAAACACAC-3'
The sequence of the ssODN for homologous recombination is as follows,
5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" | National BioResource Project for the Rat in Japan | mutant | 1 | origin |
