Foxo4 Strain Search Result - Rat Genome Database

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

Strains search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

2 records found for search term Foxo4

Refine Term:

Sort By:

Rat

Export

RGD ID	Symbol	Name	Origin	Source	Type	Annotations	Match
405855876	SD-Foxo4^em1Soar		This Foxo4 mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 ... (more) yle='font-weight:700;'>Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.	Rat Resource and Research Center	mutant	4	symbol , old_strain_name , origin
405855877	SD-Foxo4^em1Soar+/+		This is the wild type littermate from crossing of heterozygous mutant female rats with wild-type male rats to generate hemizygous null male rats and wild type mutant. Foxo4 mutant strain (RGD:405855876) was created in zygotes from Holtzman Sprague-Dawley. Gui ... (more) ded RNAs targeting exon 2 (target sequence: CCAGATATACGAATGGATGGTCC; nucleotides 517-539) and exon 3 (target sequence: GTTCATCAAGGTACATAACGAGG; nucleotides 631-653) of the Foxo4 gene (NM_001106943.1)) were injected to the embryos to create a 3096-bp deletion including the 3' part of exon 2 and 5' part of exon 3, and resulting a premature stop of the protein.		mutant	1	symbol , old_strain_name , origin