MARC_11813-11814:1029266043:1 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: MARC_11813-11814:1029266043:1

Symbol: MARC_11813-11814:1029266043:1
Previously known as:
RGD ID: 5491431
Expected Size: 0 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372170,937,114 - 170,938,335UniSTSGRCh37
Celera2164,553,436 - 164,554,657UniSTS
HuRef2162,824,785 - 162,826,006UniSTS
Is Marker For: Genes:   UBR3  




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer TATCATCATTCGAGGCCACC
Reverse Primer CGGACCCCATCTTTTATTGA
 


1 to 23 of 23 rows
RefSeq Transcripts NM_172070 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NW_921585 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AB095944 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC092641 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK094741 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK126998 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK127553 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK128490 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK303062 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL834144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY399207 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV104525 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX649036 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003449 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003497 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471058 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000253 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000463 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000492 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000664 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486275 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990913 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL583168 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
1 to 23 of 23 rows



Database
Acc Id
Source(s)
NCBI Gene 130507 UniSTS