AU048473 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU048473

Symbol: AU048473
Also known as:
RGD ID: 5036573
Expected Size: 163 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21556,162,906 - 56,162,948 (-)MAPPERmRatBN7.2
mRatBN7.2967,819,099 - 67,819,141 (+)MAPPERmRatBN7.2
mRatBN7.274,934,666 - 4,934,704 (+)MAPPERmRatBN7.2
mRatBN7.22114,191,426 - 114,191,466 (+)MAPPERmRatBN7.2
mRatBN7.215101,669,377 - 101,669,415 (-)MAPPERmRatBN7.2
mRatBN7.21620,296,657 - 20,296,822 (-)MAPPERmRatBN7.2
mRatBN7.22030,756,791 - 30,756,825 (-)MAPPERmRatBN7.2
mRatBN7.2449,956,395 - 49,956,437 (-)MAPPERmRatBN7.2
Rnor_6.01621,772,921 - 21,773,087NCBIRnor6.0
Rnor_6.01621,723,867 - 21,724,037NCBIRnor6.0
Rnor_5.01621,636,798 - 21,636,968UniSTSRnor5.0
Rnor_5.01621,687,239 - 21,687,405UniSTSRnor5.0


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCGTGCCTCAATTGTTTACA
Reverse Primer ATGTTGCACTCTCTGGATGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41268996LOC120098994vacuolar protein-sorting-associated protein 36-like203074147730763595Rat
1563748PotemPOTE ankyrin domain family member M162019364620311924Rat
9461660LOC103693918uncharacterized LOC103693918162024551820297490Rat
2536Ednrbendothelin receptor type B158064083980672115Rat
3264Pccapropionyl-CoA carboxylase subunit alpha159962795599969555Rat
628710Nalcnsodium leak channel, non-selective15100398615100712283Rat
620165Fgf14fibroblast growth factor 1415101045038101679888Rat
727855SetsipSET-like protein157451290974513767Rat
708518Dnajc3DnaJ heat shock protein family (Hsp40) member C3159602572996065114Rat
621736Slc15a1solute carrier family 15 member 1159853764198582544Rat
621446Klf5Kruppel-like factor 5157606032076079445Rat
620266Abcc4ATP binding cassette subfamily C member 4159554118695774898Rat
620590Rap2aRAP2A, member of RAS oncogene family159759684897597338Rat
629617Dock9dedicator of cytokinesis 9159861151898883306Rat
620074Pou4f1POU class 4 homeobox 1158125556681260057Rat
1304615Clyblcitramalyl-CoA lyase159928364499505697Rat
1304724Sox21SRY-box transcription factor 21159529227295295316Rat
1304646Dis3DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease157582004075850450Rat
1304889Gpr18G protein-coupled receptor 18159899742799001177Rat
1304748Ggactgamma-glutamylamine cyclotransferase159996924699998343Rat
1305102Scelsciellin158033966180456546Rat
1307452Klhl1kelch-like family member 1157269818873142707Rat
1308858Slitrk1SLIT and NTRK-like family, member 1158572325285727290Rat
1306544TgdsTDP-glucose 4,6-dehydratase159517460795195577Rat
1306550Slitrk6SLIT and NTRK-like family, member 6158756350687570125Rat
1305077Pibf1progesterone immunomodulatory binding factor 1157585038976019711Rat
1306348Pcdh9protocadherin 9156934010870237531Rat
1306441RGD1306441similar to RIKEN cDNA 4921530L21157246415772468708Rat
1304753Pcdh17protocadherin 17156022208860316172Rat
1305346Farp1FERM, ARH/RhoGEF and pleckstrin domain protein 1159812430498363299Rat
1306297Pcdh20protocadherin 20156442553464431790Rat
1305888Hs6st3heparan sulfate 6-O-sulfotransferase 3159628150297000804Rat
1308626Slain1SLAIN motif family, member 1158048281880542461Rat
1308027Cldn10claudin 10159586278595954526Rat
1359193Gpr180G protein-coupled receptor 180159519578295224955Rat
1334029Olr1647-psolfactory receptor pseudogene 164715101597962101598240Rat
1311472Spry2sprouty RTK signaling antagonist 2158269231282697408Rat
1312048Mycbp2MYC binding protein 2157993735480175432Rat
1309421Kctd12potassium channel tetramerization domain containing 12157980007779806064Rat
1305660Fbxl3F-box and leucine-rich repeat protein 3157990679579926678Rat
1308715Ipo5importin 5159799075598041074Rat
1308297Rbm26RNA binding motif protein 26158188478381964245Rat
1310957Slitrk5SLIT and NTRK-like family, member 5158884812388858809Rat
1309204Klf12Kruppel-like factor 12157662877877062000Rat
1306965Cln5CLN5, intracellular trafficking protein157989357379903438Rat
1310160Zic5Zic family member 5159955822999567035Rat
1308835Gpc5glypican 5159220727593644054Rat
1307701Dzip1DAZ interacting zinc finger protein 1159595632996009994Rat
1310126Tdrd3tudor domain containing 3156334053163497208Rat
1309522Borabora, aurora kinase A activator157579762475835599Rat
1564706Obi1ORC ubiquitin ligase 1158126941381308734Rat
1559579RGD1559579similar to Ski protein157416494974169032Rat
1561196Uchl3ubiquitin C-terminal hydrolase L3157848530478527355Rat
1561742Stk24serine/threonine kinase 24159836370798458940Rat
1559682Ppial4gpeptidylprolyl isomerase A like 4G157401562874016215Rat
1311174Zic2Zic family member 2159957669799581522Rat
1309716Ndfip2Nedd4 family interacting protein 2158203236682087043Rat
1560635Itgbl1integrin subunit beta like 115100780184101041734Rat
1311689Ubac2UBA domain containing 2159896013999107795Rat
1359230Tm9sf2transmembrane 9 superfamily member 2159920155699254054Rat
1302984Lmo7LIM domain 7157856702978769833Rat
1560745Commd6COMM domain containing 6157846733378474382Rat
1559833RGD1559833similar to 60S ribosomal protein L5158869968988700973Rat
1560069RGD1560069similar to ribosomal protein L27157501018575011443Rat
1303155Oxgr1oxoglutarate receptor 1159714594797146960Rat
1560183Tmtc4transmembrane O-mannosyltransferase targeting cadherins 415100000157100056573Rat
1585863LOC680926similar to Preli159959173699597729Rat
1563520Uggt2UDP-glucose glycoprotein glucosyltransferase 2159607455796239365Rat
1561609Tbc1d4TBC1 domain family, member 4157825603078434168Rat
1564975Dctdopachrome tautomerase159506200695100863Rat
1565615Trim52tripartite motif-containing 52158288623782924611Rat
1563454Acod1aconitate decarboxylase 1157987181979881101Rat
1592157LOC692015similar to cytochrome P450, family 2, subfamily c, polypeptide 66155684739456863597Rat
1593227LOC364462similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)158316576883173084Rat
1592123LOC692049similar to ribosomal protein S11159145907091459609Rat
1592124LOC692048similar to CDK105 protein159091718590918020Rat
1592125LOC692047hypothetical protein LOC692047158976300589764127Rat
1592131LOC692041hypothetical protein LOC692041158232682782327275Rat
1592138LOC692034similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)157880882278810075Rat
1592139LOC692033similar to ribosomal protein L10a157731037477317398Rat
1592140Mzt1mitotic spindle organizing protein 1157578699275797631Rat
1592142LOC692030similar to pescadillo homolog 1, containing BRCT domain157532363475325610Rat
1592145LOC692027similar to family with sequence similarity 60, member A157231631972318425Rat
1592146LOC692026similar to mesenchymal stem cell protein DSC92157145020371453611Rat
1592073Dach1dachshund family transcription factor 1157452812274909811Rat
1592151LOC692021similar to 3-phosphoglycerate dehydrogenase156580583465807366Rat
1592156LOC692016similar to sorbitol dehydrogenase 1155712815857129211Rat
1593308Gpc6glypican 6159403021895027883Rat
1593223LOC364485similar to ribosomal protein L24159960150899602127Rat
1595676LOC502027similar to Voltage-dependent anion-selective channel protein 1 (VDAC-1) (mVDAC1) (mVDAC5) (Outer mitochondrial membrane protein porin 1) (Plasmalemmal porin)157047334670479101Rat
1595677LOC502026similar to non-POU domain containing, octamer-binding156738764167435806Rat
1591755Mbnl2muscleblind-like splicing regulator 2159738523897542924Rat
1592106LOC290492similar to glyceraldehyde-3-phosphate dehydrogenase159712898497129907Rat
1592109LOC290453hypothetical LOC290453158173608781737952Rat
1593287Diaph3diaphanous-related formin 3156254337563013060Rat
1594175LOC680256similar to zinc finger, CCHC domain containing 9159714046097141352Rat
1593229LOC364451similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)157509038375091676Rat
1592110LOC290444similar to eukaryotic translation initiation factor 3, subunit 12157897398078974607Rat
1592111LOC290428similar to small nuclear ribonucleoparticle-associated protein157319364773194285Rat
1592113LOC290412similar to Pyruvate kinase isozymes M1/M2 (Pyruvate kinase muscle isozyme)156431995864321551Rat
1590791LOC498555similar to 60S acidic ribosomal protein P2156763836567638804Rat
1588172Timm8a2translocase of inner mitochondrial membrane 8A2159912337499131097Rat
1598095Gpr183G protein-coupled receptor 183159903776499050550Rat
1597679Calm-ps2calmodulin pseudogene 2155811060058111718Rat
2316379Vom1r-ps104vomeronasal 1 receptor pseudogene 104159064415390645034Rat
2319369LOC100361805WD repeat domain 12158769675987698451Rat
2319992LOC100364974hypothetical LOC100364974158220537682205981Rat
2320118LOC100361447hypothetical LOC100361447156542691565427910Rat
2320163LOC100361402hypothetical LOC100361402156327575063276346Rat
2319521LOC100361753apolipoprotein O-like158661594886617012Rat
2319690LOC100361683cyclin-dependent kinase 4156737104667371603Rat
2323417LOC100363223hypothetical LOC100363223158249735882498715Rat
2320681LOC10036118040S ribosomal protein S17-like155717842557179006Rat
2320734RGD2320734cytochrome b-c1 complex subunit 9-like157844839778452589Rat
2321527LOC100360731SNRPN upstream reading frame protein-like157319322273193407Rat
2323017LOC100363428PCNA-associated factor-like158461031484612236Rat
2321672LOC100360685breast cancer associated 3157257613772579688Rat
2320932LOC100361028Spi-C transcription factor (Spi-1/PU.1 related)-like157582978175831885Rat
2321007LOC100364453hypothetical LOC100364453157620740576208337Rat
2323174LOC100363369hypothetical LOC100363369158440878284410255Rat
2323549LOC100363190ribosomal protein S7-like159806191398062536Rat
2324281Selenok-ps4selenoprotein K, pseudogene 4157760905977609793Rat
2323641LOC100359553heterogeneous nuclear ribonucleoprotein A1-like158737599687415696Rat
2325390Mir92a1microRNA 92a-1159218133692181413Rat
2325396Mir18amicroRNA 18a159218076592180860Rat
2325401Mir20amicroRNA 20a159218108492181168Rat
2325433Mir19b1microRNA 19b-1159218121492181300Rat
2323955LOC100362823hypothetical LOC100362823157853373578534635Rat
2325462Mir19amicroRNA 19a159218091292180993Rat
2325600Mir17microRNA 17159218062992180712Rat
6488688LOC10091213260S ribosomal protein L10-like159341778893418406Rat
6498975LOC10091037940S ribosomal protein S13-like158228226982285536Rat
6496491LOC10091076640S ribosomal protein SA-like156394891363949900Rat
6500878LOC100909907uncharacterized LOC100909907158029136880301194Rat
6501347LOC100909886uncharacterized LOC100909886159809105498094498Rat
7502353LOC102546379uncharacterized LOC102546379157967613879677687Rat
7499911LOC102546571uncharacterized LOC102546571159674755696802385Rat
7536491LOC102554612MLV-related proviral Env polyprotein-like158533635685338410Rat
7517571LOC10254836940S ribosomal protein S16-like159225976392260218Rat
7613297LOC102547440uncharacterized LOC102547440159096273691056107Rat
7632669LOC102546300uncharacterized LOC102546300157962671979635335Rat
7651565LOC102546653uncharacterized LOC102546653156686439666876742Rat
7653320LOC102553927uncharacterized LOC102553927157627260276347580Rat
7654866LOC102549101uncharacterized LOC102549101159535610895360987Rat
7577763LOC102556284uncharacterized LOC102556284157938945979463606Rat
7625858LOC102550655uncharacterized LOC102550655158168480081693102Rat
7609495LOC102551086uncharacterized LOC102551086159729515697300575Rat
7644006LOC102548462uncharacterized LOC102548462159221026192241147Rat
7615992LOC102550034uncharacterized LOC102550034158025787180259789Rat
7590644LOC102554519glyceraldehyde-3-phosphate dehydrogenase-like158509422085095216Rat
7596678LOC102547141uncharacterized LOC10254714115101484097101504497Rat
7620398LOC102548872uncharacterized LOC102548872159511475295122461Rat
7563047LOC102547244uncharacterized LOC102547244159726669697271473Rat
7551051LOC102547827uncharacterized LOC102547827159124609691274378Rat
7552264LOC102547864uncharacterized LOC102547864156655133366593853Rat
7607858LOC102547865AFG3-like protein 1-like157251057272511658Rat
7554821LOC102546958MLV-related proviral Env polyprotein-like156673717466757250Rat
7554898LOC102551509uncharacterized LOC102551509158237271682380113Rat
7735776LOC102548945uncharacterized LOC102548945159515310795163012Rat
41054335LOC12009706840S ribosomal protein S11-like158196856981971604Rat
7751243LOC102550182uncharacterized LOC102550182158067233480695485Rat
7705185LOC102548523importin-5-like159469698594698791Rat
7684851LOC102550064uncharacterized LOC102550064159064649290670738Rat
7732154LOC102555437uncharacterized LOC102555437159941114099411942Rat
7666955LOC102550758uncharacterized LOC102550758158169622481700611Rat
7716610LOC102550532uncharacterized LOC102550532159082435890826589Rat
7717526LOC102550250uncharacterized LOC102550250159072108890793587Rat
7742907LOC102550315uncharacterized LOC102550315158097601180978272Rat
7672387LOC102554138uncharacterized LOC102554138155806456458084413Rat
7747880LOC102556470uncharacterized LOC102556470158857410588758613Rat
7727799LOC102555195peptidyl-prolyl cis-trans isomerase FKBP3-like159923137999232348Rat
7679581LOC102555382uncharacterized LOC102555382157783604977841407Rat
9095740LOC103693790uncharacterized LOC103693790159539505695417585Rat
9107661Lnc004long non-coding RNA 004159854437898555224Rat
9187193LOC103693842ferritin light chain 1 pseudogene158483465984835093Rat
9194298LOC103693766uncharacterized LOC103693766157664178776658502Rat
9205700LOC103693880uncharacterized LOC103693880156019854560221983Rat
9231101LOC103693783transmembrane protein 11, mitochondrial-like159444922194450151Rat
9333309LOC103693748uncharacterized LOC103693748156458992964832650Rat
9364271LOC103693771uncharacterized LOC103693771158283879182854514Rat
9466192LOC103693740cytochrome b-c1 complex subunit 7 pseudogene155875934358759666Rat
9409882Matr3-ps2matrin 3, pseudogene 2157388290973886465Rat
9449268LOC103693782uncharacterized LOC103693782159453665594540278Rat
9417610LOC103693758uncharacterized LOC103693758157231848772385670Rat
9459085LOC103693764uncharacterized LOC103693764157490991974915756Rat
9685073Mir1297microRNA 1297155684843056848503Rat
11362115LOC108352964uncharacterized LOC108352964158319152783263790Rat
11455629LOC108352970uncharacterized LOC108352970158821293388334191Rat
11433702LOC108352979uncharacterized LOC108352979159714828597155674Rat
11467873LOC108353050protein transport protein Sec61 subunit gamma pseudogene159016860990169004Rat
11470834LOC108352951RING finger and CHY zinc finger domain-containing protein 1 pseudogene157629335476294634Rat
11361310LOC10835304560S ribosomal protein L29 pseudogene158047350280473993Rat
11436659LOC108353006ATP synthase subunit d, mitochondrial pseudogene155721053057211782Rat
11452914LOC108352963uncharacterized LOC108352963158179293381816324Rat
11394812LOC10835302940S ribosomal protein S6 pseudogene159448741794488169Rat
11416357LOC108352977uncharacterized LOC108352977159704529097048825Rat
11423500LOC108352981uncharacterized LOC108352981159780958397827270Rat
11427239LOC108352956uncharacterized LOC108352956157932711779349197Rat
11376868LOC108352955uncharacterized LOC108352955157749736177507913Rat
11410085LOC108352959uncharacterized LOC108352959158017539580194897Rat
11410099LOC108353042uncharacterized LOC108353042157086763970872983Rat
11379167LOC108352949uncharacterized LOC108352949156023615860255653Rat
11402272LOC108353046protein transport protein Sec61 subunit gamma pseudogene158300188783002135Rat
11392609LOC108352982uncharacterized LOC108352982159909718899123189Rat
11393005LOC108353047uncharacterized LOC108353047158433751184349331Rat
11501014LOC108352972uncharacterized LOC108352972159117279191220830Rat
11478155LOC108352978uncharacterized LOC108352978159712133797122141Rat
11510082LOC10835301240S ribosomal protein S17 pseudogene159175115591760651Rat
11498208LOC108352954uncharacterized LOC108352954157732467577471131Rat
11512925LOC108352966uncharacterized LOC108352966157988308779886189Rat
11513546LOC108352971uncharacterized LOC108352971158930528289472145Rat
11487989LOC108352958cytochrome c, somatic pseudogene158009335680096114Rat
11489075LOC108352965endogenous retrovirus group K member 21 Env polyprotein-like158457319084581734Rat
11492158Trnaf-gaa5transfer RNA phenylalanine (anticodon GAA) 5159515332395153395Rat
41353381LOC120097085uncharacterized LOC120097085159730884897313364Rat
41354306LOC120097060uncharacterized LOC120097060157633918676341011Rat
41086981LOC120097308U6 spliceosomal RNA155884001758840119Rat
41323194LOC120097062uncharacterized LOC120097062157943056379436640Rat
41380823LOC120096996hsc70-interacting protein-like158820212788210457Rat
41204718LOC120097281U2 spliceosomal RNA156877186068772017Rat
41324489LOC120097079poly(rC)-binding protein 2-like159118261391186823Rat
41381972LOC120096993tubulin alpha chain-like156407140364072451Rat
41114645LOC120097198U6 spliceosomal RNA159949104599491148Rat
41169861LOC120097095uncharacterized LOC120097095159946998299552531Rat
41170420LOC120097275U6atac minor spliceosomal RNA15100826536100826663Rat
41206390LOC120093115uncharacterized LOC120093115159957167099575937Rat
41251075LOC120097271small nucleolar RNA SNORA17157083639770836536Rat
41252070NEWGENE_40926764transfer RNA proline (anticodon AGG)158207672882076800Rat
41325790LOC120097252small nucleolar RNA SNORA17156655180666551936Rat
41326155LOC120097228small nucleolar RNA SNORA48156366873363668876Rat
41142542LOC120097170uncharacterized LOC120097170158026663180280617Rat
41142702NEWGENE_40926764transfer RNA proline (anticodon AGG)15101209643101209715Rat
41253514LOC120097178uncharacterized LOC120097178159453023894533381Rat
41287184LOC120097257small nucleolar RNA SNORA17156867010768670234Rat
41361993LOC120097243small nucleolar RNA SNORA17157919355479193685Rat
41363119LOC120097317U6 spliceosomal RNA157755266577552761Rat
41363845LOC120097318U6 spliceosomal RNA159564706895647171Rat
41096054LOC120093128uncharacterized LOC120093128156393710263941299Rat
41148836LOC120097260small nucleolar RNA SNORA17158175643981756561Rat
41176091LOC120097266small nucleolar RNA SNORA17157169596971696057Rat
41261712LOC120097292U6 spliceosomal RNA157300867373008779Rat
41262856LOC120097242small nucleolar RNA SNORA17155906759759067728Rat
41365783LOC120097247small nucleolar RNA SNORA17156575091865751049Rat
41121265LOC120097225small nucleolar RNA SNORA2/SNORA34 family157176224671762373Rat
41121747LOC120097259small nucleolar RNA SNORA17157404462274044753Rat
41189376LOC120097230small nucleolar RNA SNORA48156305046163050601Rat
41155398LOC120097076uncharacterized LOC120097076158880934788819173Rat
41192109LOC120097081uncharacterized LOC120097081159566944695671421Rat
41265548LOC120097069ATP synthase subunit g, mitochondrial-like158197168381973581Rat
41266332LOC120097278U2 spliceosomal RNA158537843785378563Rat
41270046LOC120097061uncharacterized LOC120097061157847410178480713Rat
41397731LOC120097316U6 spliceosomal RNA158137324981373355Rat
41103500LOC120097287U4 spliceosomal RNA157766526677665430Rat
41127910LOC120097107ATP synthase subunit ATP5MPL, mitochondrial-like156320208063202497Rat
41159086LOC120097072uncharacterized LOC120097072158331386583364030Rat
41219327LOC120097221small nucleolar RNA SNORA4415100076623100076728Rat
41347773LOC120097088uncharacterized LOC120097088159759071997594836Rat
41071279LOC120097270small nucleolar RNA SNORA17158355395883554033Rat
41129869LOC120097280U2 spliceosomal RNA15101296217101296311Rat
41229299LOC120097209small nucleolar RNA SNORA70159341777793417911Rat
41271476LOC120097313U1 spliceosomal RNA156228193762282097Rat
41401429NEWGENE_40934091transfer RNA alanine (anticodon AGC)158973361389733687Rat
41131207LOC120097267U2 spliceosomal RNA157653365876533849Rat
41163671LOC120097255small nucleolar RNA SNORA17159584439295844525Rat
41199290LOC120097089uncharacterized LOC120097089159759511097595948Rat
41131751LOC12009699440S ribosomal protein S18-like158133040181331061Rat
41131757LOC120097091uncharacterized LOC120097091159851081998516020Rat
41352702LOC120097077uncharacterized LOC120097077158858861588620218Rat
41377666LOC120097139eukaryotic translation initiation factor 1-like157486420674864707Rat
41085385LOC120097237small nucleolar RNA SNORA17157719048977190617Rat
41110278LOC120097092uncharacterized LOC120097092159862478398629732Rat
40948418LOC120097190uncharacterized LOC120097190157495382274967542Rat
40975150LOC120097286small nucleolar RNA U3155954783759548029Rat
41340417LOC120097294U6 spliceosomal RNA159668169196681797Rat
41341524LOC120097269small nucleolar RNA SNORA17158675373586753851Rat
40954088LOC120097183uncharacterized LOC12009718315101436936101482988Rat
40955435LOC120097086uncharacterized LOC120097086159747272197483347Rat
40957543LOC120097141uncharacterized LOC120097141156968199469719442Rat
40958512LOC120097052uncharacterized LOC120097052155889457659015688Rat
41002785NEWGENE_40933816transfer RNA valine (anticodon AAC)156270754162707622Rat
40932818LOC120097171uncharacterized LOC120097171158030998280321557Rat
40933037LOC120097073uncharacterized LOC120097073158401208884035861Rat
40959529LOC120097187uncharacterized LOC120097187156649888566520540Rat
40983884LOC120097054uncharacterized LOC120097054156665172066661831Rat
41007823LOC120097177uncharacterized LOC120097177159410394094117928Rat
40937839LOC120097261small nucleolar RNA SNORA17159536277595362881Rat
40989554LOC120097194U6 spliceosomal RNA156219208462192173Rat
40990485LOC120097223U1 spliceosomal RNA157612224976122407Rat
41010480LOC120097305U6 spliceosomal RNA159119039091190496Rat
40995928LOC120097056uncharacterized LOC120097056156786285767953489Rat
41023963LOC120097189SNF-related serine/threonine-protein kinase-like157078688370789325Rat
41026113LOC120097264small nucleolar RNA SNORA1715100999787100999905Rat
41026458LOC120097310U6 spliceosomal RNA156374503163745137Rat
41077813LOC120097094uncharacterized LOC120097094159896120498971381Rat
41315848LOC120097074uncharacterized LOC120097074158454660484561746Rat
41027949LOC120097302U1 spliceosomal RNA156946362569463786Rat
41029165LOC120097236small nucleolar RNA SNORA17158141609781416227Rat
41051620LOC120097140uncharacterized LOC120097140156950797869538198Rat
41052703LOC120097090uncharacterized LOC120097090159768577697687881Rat
41079966LOC120097254small nucleolar RNA SNORA17156728878167288910Rat
41080237LOC120097051protein kish-A-like155894679058952210Rat
41029775LOC120097309U6 spliceosomal RNA158379931683799420Rat
41030389LOC120097059uncharacterized LOC120097059157557001275574783Rat
41254968LOC120097293U6 spliceosomal RNA157617301176173117Rat
41255204LOC120097311U6 spliceosomal RNA157988191979882023Rat
41054013LOC120097265small nucleolar RNA SNORA17157166663371666721Rat
41136264LOC120097181RNA polymerase II subunit A C-terminal domain phosphatase SSU72-like15101052529101059215Rat
41338783LOC120097306U6 spliceosomal RNA159350534093505446Rat
41257981LOC120097142uncharacterized LOC120097142156999016870006898Rat
41031812LOC120097179uncharacterized LOC120097179159694132296951978Rat
41032975LOC120097083uncharacterized LOC120097083159623935996242484Rat
41315464LOC120097053uncharacterized LOC120097053156138063461394655Rat
41059821LOC120097082uncharacterized LOC120097082159584002795844074Rat
41300597LOC120097055uncharacterized LOC120097055156664332566653880Rat
41336497LOC120097058non-histone chromosomal protein HMG-17-like157462079774621379Rat
41035228LOC120096902uncharacterized LOC120096902158254978282551605Rat
41062514LOC120097087uncharacterized LOC120097087159751874297528413Rat
41226654LOC120097232small nucleolar RNA SNORA17156651097266511103Rat
41301829LOC120097284U2 spliceosomal RNA159003149590031677Rat
41334176LOC120096897nucleoside diphosphate kinase B-like157898122778983942Rat
41227491LOC120097063uncharacterized LOC120097063157986770779873636Rat
41303432LOC120097180uncharacterized LOC120097180159635699596381188Rat
41039001LOC120097075uncharacterized LOC120097075158797526887982501Rat
41039265LOC120097078uncharacterized LOC120097078159105624391080155Rat
41304945LOC120097070uncharacterized LOC120097070158201298382033164Rat
41018907LOC120097188uncharacterized LOC120097188156747758567491791Rat
41238556LOC120097315U6 spliceosomal RNA158919629889196401Rat
41022028LOC120097213small nucleolar RNA SNORD113/SNORD114 family158092711780927199Rat
41046097LOC120097080uncharacterized LOC120097080159200549392016267Rat
41241680LOC120097084uncharacterized LOC120097084159722963997238607Rat
41022417LOC120096995eukaryotic initiation factor 4A-II-like158795316987957830Rat
41023110LOC120097143protein S100-A10-like159602997896030291Rat
41023740LOC120097057uncharacterized LOC120097057156848083468606048Rat
3044Map2microtubule-associated protein 296772342267981886Rat
68393Kcnd2potassium voltage-gated channel subfamily D member 244977581250277746Rat
1307225Egfem1EGF-like and EMI domain containing 12113721236114324547Rat

Nucleotide Sequences
GenBank Nucleotide AU048473 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU048595 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH519838 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH576429 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH583605 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH623065 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH675080 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH685776 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH694505 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH703606 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH716817 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH724098 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH756661 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FT033703 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FT065796 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FT118044 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FT165799 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FT174437 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FT187245 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FT192964 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH618634 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20132578807Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600972Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600972Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20152784246527842Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20153065546530655Rat
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)20260683647606836Rat
7411652Foco24Food consumption QTL 240.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)201175751554435887Rat
9590092Insglur9Insulin/glucose ratio QTL 918.380.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)201175751554435887Rat
4889610Pancm3Pancreatic morphology QTL 33.750.001pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)201761783247606836Rat
2317880Alcrsp25Alcohol response QTL 252.3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)201769755054435887Rat
2303626Vencon10Ventilatory control QTL 100.001respiration trait (VT:0001943)respiration rate (CMO:0000289)201919072154435887Rat
2303578Gluco50Glucose level QTL 502blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)202510672254435887Rat
2303587Bw93Body weight QTL 9313body mass (VT:0001259)body weight (CMO:0000012)202510672254435887Rat
2300188Bmd68Bone mineral density QTL 686.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)202510672254435887Rat
1331747Hrtrt16Heart rate QTL 163.163heart pumping trait (VT:2000009)heart rate (CMO:0000002)202520973454435887Rat
1598869Memor6Memory QTL 63.1exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)202924438854435887Rat
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8hepatic copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
631517Scl9Serum cholesterol level QTL 93.3blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)161572643321034895Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor depth of invasion (CMO:0001888)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70205Gcr3Gastric cancer resistance QTL 32.3stomach morphology trait (VT:0000470)stomach tumor diameter (CMO:0001889)161769679182635055Rat
70215Niddm29Non-insulin dependent diabetes mellitus QTL 293.54blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)161900443575226532Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151249614165205939Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat
10054130Srcrt8Stress Responsive Cort QTL 82.180.0085blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)152211793367117933Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
1582214Stl21Serum triglyceride level QTL 213.10.022blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)152803066582262678Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)152803066582262678Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
1582242Gluco28Glucose level QTL 283.30.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)152803066582262678Rat
1582244Bw79Body weight QTL 7940.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
2293691Bmd37Bone mineral density QTL 376.60.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)153361105871477291Rat
2293686Bmd36Bone mineral density QTL 367.40.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)153361105871477291Rat
1598828Glom14Glomerulus QTL 142.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)153405413979054139Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
724545Niddm54Non-insulin dependent diabetes mellitus QTL 540.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)155079449473699215Rat
2317050Aia24Adjuvant induced arthritis QTL 242.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)155284790873690657Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
61477Aia4Adjuvant induced arthritis QTL 43joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)155559608991365858Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)155559608995018120Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat
2313080Bss65Bone structure and strength QTL 653.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)156099046873690657Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
724548Niddm55Non-insulin dependent diabetes mellitus QTL 550.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)156832736073699069Rat
1331724Bp223Blood pressure QTL 2233.53715arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)157369051895018228Rat
1641889Colcr6Colorectal carcinoma resistance QTL 62.90.0126intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)157369051899794247Rat
70182BpQTLcluster12Blood pressure QTL cluster 123.53arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)157369065795018120Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1575788062101769107Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1575788062101769107Rat
1581555Eae19Experimental allergic encephalomyelitis QTL 194.7nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)157630609990088744Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1576306099101769107Rat
1300118Bp190Blood pressure QTL 1902.94arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)158226252098288169Rat
1300120Kidm7Kidney mass QTL 73.55kidney mass (VT:0002707)left kidney wet weight to body weight ratio (CMO:0001954)158226252098288169Rat
1581519Cm59Cardiac mass QTL 592.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)158885347095840528Rat
1358354Srcrt5Stress Responsive Cort QTL 53.38blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)159815000199043291Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9187073594Rat
70186Niddm26Non-insulin dependent diabetes mellitus QTL 263.87blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)92207116986369743Rat
7207814Bmd91Bone mineral density QTL 913.5femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)92375414483851531Rat
70218Cm28Cardiac mass QTL 288.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)92526804479271759Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)925661188100929786Rat
1641894Alcrsp12Alcohol response QTL 12response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)92746863972468639Rat
7411656Foco26Food consumption QTL 269.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)93253550577535505Rat
7411571Bw138Body weight QTL 13814.30.001body mass (VT:0001259)body weight gain (CMO:0000420)93253550577535505Rat
1598834Memor11Memory QTL 112.5exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)93696235977814038Rat
8662828Vetf6Vascular elastic tissue fragility QTL 63.9artery integrity trait (VT:0010639)patent ductus arteriosus score (CMO:0002566)93696235992058970Rat
2290450Scl57Serum cholesterol level QTL 574.15blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)93696235995410867Rat
6903941Pur31Proteinuria QTL 310.036total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)94019418885194188Rat
11353949Bp393Blood pressure QTL 393arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94019418885194188Rat
61352Bp34Blood pressure QTL 345arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94249534379271511Rat
10058949Gmadr5Adrenal mass QTL 520.014adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)94279151387976209Rat
11353951Bp394Blood pressure QTL 394arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94464992189649921Rat
12879506Pur33Proteinuria QTL 33total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)94464992189649921Rat
11353957Bmd92Bone mineral density QTL 920.01tibia mineral mass (VT:1000283)volumetric bone mineral density (CMO:0001553)94611419991114199Rat
631656Bp108Blood pressure QTL 1085.970.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)94859825193598251Rat
1598849Memor17Memory QTL 172.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)94996854671098346Rat
2303170Bp332Blood pressure QTL 3323.730.027arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)95584784177026453Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)95662771378595166Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)95662771378595166Rat
2303180Bp333Blood pressure QTL 3330.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)95662771378595166Rat
1578760Cm53Cardiac mass QTL 533.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)956771635101771635Rat
724515Uae16Urinary albumin excretion QTL 168urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)958163035100929646Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)961381434104821652Rat
1581580Uae34Urinary albumin excretion QTL 34urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)96207227596470995Rat
1578757Pur6Proteinuria QTL 63.30.005total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)96207227596470995Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)963869687108869687Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)964573531109573531Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41008408955084089Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41008408955084089Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41008408955084089Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41008408955084089Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
11530004Niddm71Non-insulin dependent diabetes mellitus QTL 710.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)43258419952754138Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43443048482490359Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)436303261103194984Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43950527573892441Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43952426474726312Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44043341485433414Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
10450818Scl76Serum cholesterol level QTL 763.60.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450821Scl77Serum cholesterol level QTL 774.10.01blood VLDL cholesterol amount (VT:0005144)blood high density lipoprotein cholesterol level (CMO:0000052)44917811657114705Rat
10450825Scl78Serum cholesterol level QTL 783.70.01blood VLDL cholesterol amount (VT:0005144)blood low density lipoprotein cholesterol level (CMO:0000053)44917811657114705Rat
1302794Stl27Serum triglyceride level QTL 274.40.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)225413423143657569Rat
1358894Kidm24Kidney mass QTL 244.03kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358899Kidm23Kidney mass QTL 233.88kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358901Cm38Cardiac mass QTL 382heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358904Cm39Cardiac mass QTL 392.26heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423157142209Rat
1358910Kidm27Kidney mass QTL 275.77kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358911Kidm28Kidney mass QTL 285.42kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)225413423157142209Rat
1358913Cm41Cardiac mass QTL 412.73heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358917Cm42Cardiac mass QTL 422.82heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)225413423203928301Rat
1358887Bw50Body weight QTL 502.39body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1358908Bw49Body weight QTL 493.36body mass (VT:0001259)body weight (CMO:0000012)225413652157142078Rat
1354603Bp243Blood pressure QTL 2433.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)226917817127469484Rat
2290453Scl55Serum cholesterol level QTL 552.83blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)226917817136917119Rat
2293835Kiddil5Kidney dilation QTL 53.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607157142209Rat
2293843Kiddil6Kidney dilation QTL 63.1kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)242804607182042367Rat
1298074Bp164Blood pressure QTL 1640.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
1298085Bp165Blood pressure QTL 1650.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)242804607202447032Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)243154682202446871Rat
61467Bp14Blood pressure QTL 142.2arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)243154682202446871Rat
2293671Bss44Bone structure and strength QTL 4410.970.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)243162366148478373Rat
1354601Slep1Serum leptin concentration QTL 15.39blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)243171017184114403Rat
631266Bp132Blood pressure QTL 1320.0005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)246123260202447032Rat
1331760Bp206Blood pressure QTL 2063.62454arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)256043031202447032Rat
1558648Smcn1Smooth muscle cell number QTL 10.039blood vessel smooth muscle cell quantity (VT:0010525)aorta smooth muscle cell count per unit vessel length (CMO:0001646)259134147127460910Rat
61438Cia7Collagen induced arthritis QTL 74.60.0001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)259324377141596857Rat
1298080Bp163Blood pressure QTL 1630.02arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118275202447032Rat
1354648Bp239Blood pressure QTL 2390.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)266118463226797303Rat
1558653Prcr1Prostate cancer resistance QTL 15prostate integrity trait (VT:0010571)area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899)272532993157142209Rat
1354605Rf48Renal function QTL 482.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)274786664206665859Rat
631198Cm22Cardiac mass QTL 224.30.0008heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)276539322150540526Rat
61374Edpm2Estrogen-dependent pituitary mass QTL 24.420.86pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)276539322202447032Rat
2299162Iddm32Insulin dependent diabetes mellitus QTL 322.36blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)278665616143657569Rat
1581569Uae32Urinary albumin excretion QTL 320.0001urine protein amount (VT:0005160)urine albumin excretion rate (CMO:0000757)278665619219826953Rat
724534Uae6Urinary albumin excretion QTL 610urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)278665619249053267Rat
61392Bp6Blood pressure QTL 67arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)280270434125270434Rat
1598865Bp296Blood pressure QTL 2962.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)281018907126018907Rat
8662832Vetf7Vascular elastic tissue fragility QTL 73.5aorta elastin amount (VT:0003905)aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002)281689826221035911Rat
1354622Kidm16Kidney mass QTL 163kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)281754530222436696Rat
1354649Kidm17Kidney mass QTL 172.9kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)281754530227146641Rat
1578772Stresp14Stress response QTL 1450.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)282345893130923501Rat
7207808Bmd89Bone mineral density QTL 894.1femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)288862519133862519Rat
2300165Bmd49Bone mineral density QTL 494.80.0001lumbar vertebra mineral mass (VT:0010511)bone mineral density (CMO:0001226)288862519133862519Rat
2300170Bmd45Bone mineral density QTL 4512.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)288862519133862519Rat
2300185Bmd46Bone mineral density QTL 468.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)288862519133862519Rat
1598862Glom9Glomerulus QTL 93.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)292337601137337601Rat
1598863Cm65Cardiac mass QTL 652.3heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)292337601137337601Rat
631566Bp90Blood pressure QTL 900.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2102803808147803808Rat
8662836Vetf8Vascular elastic tissue fragility QTL 80.66thoracic aorta molecular composition trait (VT:0010568)aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003)2104559726149559726Rat
1581552Pur12Proteinuria QTL 125.190.0009total urine protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)2112103657148076632Rat
631507Bp105Blood pressure QTL 1050.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)2112456140212696837Rat
634308Sach6Saccharin preference QTL 64.9taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)2112456140212696837Rat


Additional Information

Database Acc Id Source(s)
UniSTS 144923 UniSTS