D18Got55 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D18Got55

Symbol: D18Got55
Previously known as: oxsts1437; OT34.14; 
RGD ID: 45552
Expected Size: 198 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81852,246,954 - 52,247,152 (+)Marker Load Pipeline
Rnor_5.01850,852,822 - 50,853,021NCBIRnor5.0
RGSC_v3.41852,340,553 - 52,340,751RGDRGSC3.4
RGSC_v3.11852,386,048 - 52,386,246RGD
RH 3.4 Map18524.3RGD
RH 3.4 Map18524.3UniSTS
RH 2.0 Map18393.7RGD




#
Reference Title
Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8


 
Forward Primer CCCTGGGGAAACCTCTAGTG
Reverse Primer CAGTAAGTAAGGTCACCGGAGC
 


GenBank Nucleotide AU025667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles