Marker: D3Got124 |
Symbol: |
D3Got124 |
Previously known as: |
oxsts1851; OT18.34;
|
RGD ID: |
43730 |
Expected Size: |
149 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | 5 | 71,270,707 - 71,270,856 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 5 | 73,317,437 - 73,317,586 | NCBI | Rnor6.0 | Rnor_5.0 | 5 | 77,475,064 - 77,475,213 | UniSTS | Rnor5.0 | RGSC_v3.4 | 5 | 74,458,593 - 74,458,742 | RGD | RGSC3.4 | RGSC_v3.4 | 5 | 74,458,594 - 74,458,742 | UniSTS | RGSC3.4 | RGSC_v3.1 | 5 | 74,463,707 - 74,463,855 | RGD | | Celera | 5 | 70,123,294 - 70,123,442 | UniSTS | | RH 3.4 Map | 3 | 1381.9 | UniSTS | | RH 3.4 Map | 3 | 1381.9 | RGD | | RH 2.0 Map | 3 | 924.3 | RGD | |
|
Annotation
References - curated
# |
Reference Title |
Reference Citation |
1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
3. |
UniSTS Pipeline |
RGD automated pipelines
|
4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
|
Forward Primer |
TCCAATCCCCTTCTGGAC |
Reverse Primer |
ATCCACATCCACAGTCCCAG |
|
Region
Additional Information
|
|