D1Got147 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Got147

Symbol: D1Got147
Previously known as: oxsts36; OT29.31; 
RGD ID: 43325
Expected Size: 120 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21153,764,921 - 153,765,041 (+)MAPPERmRatBN7.2
Rnor_6.01164,422,427 - 164,422,546NCBIRnor6.0
Rnor_5.01170,624,287 - 170,624,406UniSTSRnor5.0
RGSC_v3.41156,798,028 - 156,798,148RGDRGSC3.4
RGSC_v3.41156,798,029 - 156,798,148UniSTSRGSC3.4
RGSC_v3.11156,876,435 - 156,876,554RGD
Celera1151,847,658 - 151,847,777UniSTS
RH 3.4 Map11239.4UniSTS
RH 3.4 Map11239.4RGD
RH 2.0 Map1805.8RGD
Cytogenetic Map1q32UniSTS
Is Marker For: Genes:   Klhl35  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCTGGTCACATCTGCATGA
Reverse Primer TGTGACTGGTCATTTACATGCC
 

Region

Nucleotide Sequences
GenBank Nucleotide AU025016 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AU048784 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 308850 UniSTS