REN62563 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: REN62563

Symbol: REN62563
Previously known as:
RGD ID: 1983326
Expected Size: 225 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh377117,350,271 - 117,350,495UniSTSGRCh37
Build 367117,137,507 - 117,137,731RGDNCBI36
Celera7112,158,439 - 112,158,663RGD
Cytogenetic Map7q31UniSTS
HuRef7111,715,744 - 111,715,968UniSTS
CRA_TCAGchr7v27116,745,707 - 116,745,931UniSTS
Is Marker For: Genes:   CTTNBP2  




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer ATGATCTATGATTTTGACAGCATTCAG
Reverse Primer TTTCATAAATACCAAAGAAGTATGATTTTG
 


1 to 30 of 47 rows
GenBank Nucleotide AC004240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BL000001 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BL000002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003454 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003502 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH236947.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471070 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000497 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000669 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001615.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ354388 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ354389 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ354390 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ354391 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356257 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356259 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356260 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356261 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356262 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356263 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356264 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388128 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388129 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388130 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388131 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388132 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388133 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
1 to 30 of 47 rows



Database
Acc Id
Source(s)
NCBI Gene 83992 UniSTS