REN62058 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: REN62058

Symbol: REN62058
Previously known as:
RGD ID: 1982316
Expected Size: 232 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh377117,484,083 - 117,484,314UniSTSGRCh37
Build 367117,271,319 - 117,271,550RGDNCBI36
Celera7112,292,219 - 112,292,450RGD
Cytogenetic Map7q31UniSTS
HuRef7111,849,695 - 111,849,926UniSTS
CRA_TCAGchr7v27116,879,495 - 116,879,726UniSTS
Is Marker For: Genes:   CTTNBP2  




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer ATGACAACAGAAGCAGAAACGAAG
Reverse Primer TGGAGGTCAGAAGTCTAAAATGAGTC
 


1 to 30 of 33 rows
GenBank Nucleotide AC007568 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BL000001 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BL000002 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003502 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH236947.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471070 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000497 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000669 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001615.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ354390 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ354391 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356260 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ356262 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388129 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388132 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388134 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388135 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388137 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388139 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388140 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388143 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388144 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ388145 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486028 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990666 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000059 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
1 to 30 of 33 rows



Database
Acc Id
Source(s)
NCBI Gene 83992 UniSTS