RH94177 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH94177

Symbol: RH94177
Previously known as: stSG52290; 
RGD ID: 1675377
Expected Size: 123 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh372140,800,236 - 40,800,358UniSTSGRCh37
Build 362139,722,106 - 39,722,228RGDNCBI36
Celera2125,997,932 - 25,998,054RGD
Cytogenetic Map21q22.2UniSTS
HuRef2126,269,093 - 26,269,215UniSTS
Is Marker For: Genes:   LCA5L  




#
Reference Title
Reference Citation
1. UniSTS Pipeline RGD automated pipelines


 
Forward Primer AAAACAATAGGAGGTCTGCAGC
Reverse Primer TTAAACTTCCACAGGAGCACTG
 


1 to 23 of 23 rows
RefSeq Transcripts NM_152505 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AF121781 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AL163279 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BA000005 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC031059 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC043006 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX647793 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BX648744 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003468 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003516 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH471079 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000272 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000482 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000511 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000683 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM001629.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DQ050841 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486298 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990936 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  EI777566 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL000151 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL296728.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH976414.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
1 to 23 of 23 rows



Database
Acc Id
Source(s)
NCBI Gene 150082 UniSTS