D14Wox14 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D14Wox14

Symbol: D14Wox14
Previously known as: oxsts5550; R101; Csna; RATCASAG1; CASAG1; Csn1; 
RGD ID: 10413
Expected Size: 126 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01422,009,849 - 22,009,966NCBIRnor6.0
Rnor_5.01421,924,894 - 21,925,011UniSTSRnor5.0
RGSC_v3.41421,885,743 - 21,885,861RGDRGSC3.4
RGSC_v3.41421,885,744 - 21,885,861UniSTSRGSC3.4
RGSC_v3.11421,885,743 - 21,885,861RGD
Celera1419,763,170 - 19,763,287UniSTS
RH 3.4 Map14283.6UniSTS
RH 3.4 Map14283.6RGD
RH 2.0 Map14276.7RGD
Cytogenetic Map14p21UniSTS
Is Marker For: Strains:   F344.OLETF-(D14Rat23-D14Wox14)/Tj   F344.OLETF-(D14Wox14-D14Rat12)/Tj  
Genes:   Csn1s1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer ACTTGATTACACACACAAACACAGA
Reverse Primer CTTTGCTTTCTTTTAGCCATTT
 

Region



Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 24284 UniSTS
NCBI Nucleotide X03584
UniSTS 118051 UniSTS