D6Wox21 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D6Wox21

Symbol: D6Wox21
Previously known as: oxsts5139; REP6; 
RGD ID: 10393
Expected Size: 126 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.26132,232,243 - 132,232,369 (+)MAPPERmRatBN7.2
Rnor_6.06137,964,666 - 137,964,791NCBIRnor6.0
Rnor_5.06146,959,009 - 146,959,134UniSTSRnor5.0
RGSC_v3.46138,158,583 - 138,158,708UniSTSRGSC3.4
Celera6129,770,692 - 129,770,817UniSTS
Cytogenetic Map6q32UniSTS
Is Marker For: Genes:   Crip1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGAGAAGCGTTAAAATATGTG
Reverse Primer TTGGTTTCCAGGGTGAGAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1597237Crip1cysteine rich protein 16132226746132234620Rat

Nucleotide Sequences
GenBank Nucleotide L25263 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12801411Schws8Schwannoma susceptibility QTL 8nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)694968928139968928Rat
4145118Mcs26Mammary carcinoma susceptibility QTL 260.0001mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6106752656132339866Rat
1641917Colcr5Colorectal carcinoma resistance QTL 53.180.0009intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)6122549046137801795Rat
61414Pia3Pristane induced arthritis QTL 34.5joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)694968928137848904Rat
71111Iddm8Insulin dependent diabetes mellitus QTL 81.90.002blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)6105156861140994061Rat
1358355Srcrt4Stress Responsive Cort QTL 46.39blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)6100364669140994061Rat
724513Uae14Urinary albumin excretion QTL 146.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)685311061133478515Rat
2303624Vencon5Ventilatory control QTL 54.45respiration trait (VT:0001943)minute ventilation (CMO:0000132)688047916133047916Rat
731173Uae22Urinary albumin excretion QTL 2210.1urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
61329Eae9Experimental allergic encephalomyelitis QTL 93.7body mass (VT:0001259)change in body weight (CMO:0002045)6122549046140994061Rat
737976Pia24Pristane induced arthritis QTL 24joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)6112636280140994061Rat
2312560Pur20Proteinuria QTL 202.10.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)6125628133137801795Rat
2313399Anxrr28Anxiety related response QTL 28aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)6100671796132340886Rat
2290393Uae37Urinary albumin excretion QTL 370.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)665531555140994061Rat
8552796Vie3Viral induced encephalitis QTL 32.6brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)696833997140994061Rat
2293085Iddm29Insulin dependent diabetes mellitus QTL 297.66blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)6122549046140286318Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 691657 UniSTS