Symbol:
Mir6900
Name:
microRNA 6900
RGD ID:
9674724
MGI Page
MGI
Description:
microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]
Type:
ncrna (Ensembl: miRNA)
RefSeq Status:
PROVISIONAL
Previously known as:
Gm27708; mmu-mir-6900
Latest Assembly:
GRCm39 - Mouse Genome Assembly GRCm39
Position:
Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 92,392,205 - 92,392,264 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 92,392,205 - 92,392,264 (-) Ensembl GRCm39 Ensembl GRCm38 1 92,464,483 - 92,464,542 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 92,464,483 - 92,464,542 (-) Ensembl GRCm38 mm10 GRCm38 Celera 1 95,403,848 - 95,403,907 (-) NCBI Celera Cytogenetic Map 1 D NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
.
Predicted Targets
Count of predictions: 27744 Count of gene targets: 11661 Count of transcripts: 20642 Interacting mature miRNAs: mmu-miR-6900-3p, mmu-miR-6900-5p Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
11039528 Ccc3_m colitis susceptibility in the Collaborative Cross 3 (mouse) 1 3680142 195051546 Mouse 15039333 Nmrs1_m NAFLD-associated magnetic resonance shift 1 (mouse) 1 89786512 123786512 Mouse 1357847 Jckm2_m juvenile cystic kidney modifier 2 (mouse) Not determined 1 74991977 133290937 Mouse 4142394 Mssq1_m mandible size and shape QTL 1 (mouse) Not determined 73615692 107615830 Mouse 1300821 Lore1_m loss of righting induced by ethanol 1 (mouse) Not determined 1 75549191 92941077 Mouse 10412185 Hcs9_m hepatocarcinogenesis susceptibility 9 (mouse) Not determined 1 63854690 189303617 Mouse 1558928 Mord2_m modifier of retinal degeneration 2 (mouse) Not determined 1 77123115 110536075 Mouse 1301722 Cia9_m collagen induced arthritis QTL 9 (mouse) Not determined 1 45783900 189303617 Mouse 13824984 Twq5_m testis weight QTL 5 (mouse) 1 3069992 184732197 Mouse 14697706 Stsl3a_m Salmonella typhimurium susceptibility locus 3a (mouse) 1 77476637 95827725 Mouse 12790991 Aath1_m aortic arch atherosclerosis 1 (mouse) 1 86483929 120483929 Mouse 1357721 Sle17_m systematic lupus erythematosus susceptibility 17 (mouse) Not determined 1 39132808 126445310 Mouse 10412238 Alpq5_m alcohol preference QTL 5 (mouse) Not determined 1 82832635 116832635 Mouse 1302146 Cocrb1_m cocaine related behavior 1 (mouse) Not determined 1 70133533 104139557 Mouse 1301444 Alcw5_m alcohol withdrawal 5 (mouse) Not determined 1 58549191 92549443 Mouse 1558860 W10q7_m weight 10 weeks QTL 7 (mouse) Not determined 1 34760138 150193871 Mouse 4141347 Reb1_m repetitive behavior 1 (mouse) Not determined 91468266 100413667 Mouse 12791004 Aath7_m aortic arch atherosclerosis 7 (mouse) 1 82832635 116832635 Mouse 4141725 Wbcq4_m white blood cell quantitative locus 4 (mouse) Not determined 1 79858683 113858791 Mouse 12050069 Nabq1_m nasal bone morphology QTL 1 (mouse) 1 79858683 113858791 Mouse 1300976 Bmd19_m bone mineral density 19 (mouse) Not determined 1 73266214 108838414 Mouse 1357488 Splq3_m spleen weight QTL 3 (mouse) Not determined 1 34760138 150193871 Mouse 4141914 Gcsfis_m G-CSF induced splenomegaly (mouse) Not determined 74516235 148715579 Mouse 27095928 Pglq6_m pelvic girdle length QTL 6, 10 week (mouse) 1 75976637 148775742 Mouse 27095931 Pglq1_m pelvic girdle length QTL 1, 5 week (mouse) 1 75976637 128527737 Mouse 13452395 Leusq2_m leucocytosis susceptibility QTL 2 (mouse) 1 80245593 126386517 Mouse 1301748 Abbp1_m A/J and C57BL/6 blood pressure 1 (mouse) Not determined 1 62946755 120529678 Mouse 1301304 Hrq3_m heart rate quantitative locus 3 (mouse) Not determined 1 73615692 107615830 Mouse 1357439 Popoa_m premature ovulation and primary oocyte arrest (mouse) Not determined 1 82643189 135615379 Mouse 4142291 Aec2_m autoimmune exocrinopathy 2 (mouse) Not determined 52457737 182250592 Mouse 1357753 Kidq2_m kidney weight QTL 2 (mouse) Not determined 1 34760138 150193871 Mouse 1300989 Lrdg1_m light induced retinal degeneration 1 (mouse) Not determined 1 73755175 147125370 Mouse 4141329 Mleu1_m myeloid leukemia survival 1 (mouse) Not determined 89786512 123786512 Mouse 1301667 Lxw5_m lupus BXSB x NZW 5 (mouse) Not determined 1 58549191 92549443 Mouse 11667074 Led2_m late embryonic death 2 (mouse) 1 85696027 117195081 Mouse 27095918 Ulnl1_m ulna length 1, 5 week (mouse) 1 67339159 129727737 Mouse 1301350 Nidd4k_m Nidd4 on KK-A (mouse) Not determined 7 82291982 147125370 Mouse 1300841 Ssial1_m susceptibility to sialadenitis 1 (mouse) Not determined 1 63920002 153557562 Mouse 26884448 Sklq1_m skull length QTL 1, 5 week (mouse) 1 75976637 181327565 Mouse
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
Ensembl Acc Id:
ENSMUST00000183483
Type:
CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 Ensembl 1 92,392,205 - 92,392,264 (-) Ensembl GRCm38.p6 Ensembl 1 92,464,483 - 92,464,542 (-) Ensembl
RefSeq Acc Id:
NR_105865
RefSeq Status:
PROVISIONAL
Type:
NON-CODING
Position:
Mouse Assembly Chr Position (strand) Source GRCm39 1 92,392,205 - 92,392,264 (-) NCBI GRCm38 1 92,464,483 - 92,464,542 (-) NCBI Celera 1 95,403,848 - 95,403,907 (-) NCBI
Sequence:
TCATGTGCCAGGAGAAGCCTAGAGCCGTCTGGACTCTGATGGTGATGGGCTCTCTTGTAG
hide sequence
RGD ID: 6874498
Promoter ID: EPDNEW_M700
Type: single initiation site
Name: Mir6900_1
Description: Mus musculus microRNA 6900 , microRNA.
SO ACC ID: SO:0000170
Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ )
Experiment Methods: Single-end sequencing.
Position: Mouse Assembly Chr Position (strand) Source GRCm38 1 92,464,454 - 92,464,514 EPDNEW