Symbol: |
Gm16261 |
Name: |
predicted gene 16261 |
RGD ID: |
9645837 |
MGI Page |
MGI |
Description: |
|
Type: |
protein-coding (Ensembl: processed_pseudogene)
|
RefSeq Status: |
MODEL |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 14 | 60,389,935 - 60,391,808 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 14 | 60,391,600 - 60,391,804 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 14 | 60,152,486 - 60,154,359 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 14 | 60,154,151 - 60,154,355 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Celera | 14 | 57,940,762 - 57,945,034 (+) | NCBI | | Celera | | | Cytogenetic Map | 14 | D1 | NCBI | | | | | cM Map | 14 | 31.62 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 100 | Count of miRNA genes: | 97 | Interacting mature miRNAs: | 100 | Transcripts: | ENSMUST00000096813 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
1357589 | Kdnw2_m | kidney weight 2 (mouse) | | | Not determined | | 14 | 20887473 | 121269804 | Mouse | 1300625 | Cosz2_m | cocaine seizure 2 (mouse) | | | Not determined | | 14 | 35045797 | 68785736 | Mouse | 1301777 | Bglq15_m | body growth late QTL 15 (mouse) | | | Not determined | | 14 | 42962416 | 76962593 | Mouse | 1301489 | Lbm10_m | lean body mass 10 (mouse) | | | Not determined | | 14 | 53761296 | 87761529 | Mouse | 1357527 | Epfpq1_m | epididymal fat percentage QTL 1 (mouse) | | | Not determined | | 14 | 21062450 | 71885801 | Mouse | 1301424 | Skull21_m | skull morphology 21 (mouse) | | | Not determined | | 14 | 42962416 | 76962593 | Mouse | 4142364 | Pbwg18_m | postnatal body weight growth 18 (mouse) | | | Not determined | | 14 | 52281984 | 86282125 | Mouse | 4141400 | Nilac8_m | nicotine induced locomotor activity 8 (mouse) | | | Not determined | | 14 | 43065847 | 77066045 | Mouse | 10043889 | Cia52_m | collagen induced arthritis QTL 52 (mouse) | | | Not determined | | 14 | 56082381 | 90082509 | Mouse | 27226774 | Tibl15_m | tibia length 15, 10 week (mouse) | | | | | 14 | 30321957 | 87937436 | Mouse | 1301562 | Hwq1_m | heart weight quantitative locus 1 (mouse) | | | Not determined | | 14 | 56546745 | 90546941 | Mouse | 1357565 | wrmod1_m | wobbler modifier 1 (mouse) | | | Not determined | | 14 | 58179640 | 101859473 | Mouse | 4142419 | Tgq26_m | triglyceride QTL 26 (mouse) | | | Not determined | | | 40337319 | 74337319 | Mouse | 1300605 | El5_m | epilepsy 5 (mouse) | | | Not determined | | 14 | 49455425 | 83455556 | Mouse | 11039527 | Ccc2_m | colitis susceptibility in the Collaborative Cross 2 (mouse) | | | | | 14 | 59918612 | 94138217 | Mouse | 1301091 | Bbaa21_m | B.burgdorferi-associated arthritis 21 (mouse) | | | Not determined | | 14 | 43065847 | 77066045 | Mouse | 12880432 | Fgf23lq3_m | FGF23 serum level QTL 3 (mouse) | | | | | 14 | 53937440 | 87937440 | Mouse | 1300998 | Cia17_m | collagen induced arthritis 17 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 10043887 | Cia50_m | collagen induced arthritis QTL 50 (mouse) | | | Not determined | | 14 | 37430185 | 71430320 | Mouse | 1300805 | Mors3_m | modifier of obesity related sterility 3 (mouse) | | | Not determined | | 14 | 43037270 | 77037418 | Mouse | 10043886 | Cia49_m | collagen induced arthritis QTL 49 (mouse) | | | Not determined | | 14 | 29996994 | 63997133 | Mouse | 1300909 | Ath13_m | atherosclerosis 13 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 13506929 | Recrq10_m | recombination rate in male meiosis QTL 10 (mouse) | | | | | 14 | 27921957 | 61137449 | Mouse |
Ensembl Acc Id: |
ENSMUST00000096813 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 60,391,600 - 60,391,804 (+) | Ensembl | GRCm38.p6 Ensembl | 14 | 60,154,151 - 60,154,355 (+) | Ensembl |
|
RefSeq Acc Id: |
XM_036159024 ⟹ XP_036014917 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 14 | 60,389,935 - 60,391,808 (+) | NCBI |
|
Sequence: |
ATGAATTGTGGTAGGAAACAAAGTGGCAAAGGACCGTGGGAGGGCCGTGGGGGCGGAGCAAAAGAACGTGGGCAGGCCGTGGGGGCGGAGCAAAAGAACGTGGGCGGGCCCCATCCCACAAACCTGGA TCAGGTAATGGAGTTTGTGAAGCCAAGTTGGCAGTTTGTAAAGGACTCAGTTCTGCTGGTTAAAAGATGCACCAAACCCCACAGAAGAGAATTCCAGAAGATTGCCATGGCCACAGCGATAGGATTTG CTATCATGGGATTCATTGGCTTCTTCGAGAAACTGATCCATATCCCTAATAATAACATTATTGTGGGTGGCTGA
hide sequence
|
RefSeq Acc Id: |
XP_036014917 ⟸ XM_036159024 |
|
|
|