9230102K24Rik (RIKEN cDNA 9230102K24 gene)

Advanced Search (OLGA)

Gene: 9230102K24Rik (RIKEN cDNA 9230102K24 gene) Mus musculus

Analyze

Symbol:

9230102K24Rik

Name:

RIKEN cDNA 9230102K24 gene

RGD ID:

1623036

MGI Page

MGI

Description:

Type:

ncrna (Ensembl: lncRNA)

RefSeq Status:

VALIDATED

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	10	110,436,511 - 110,451,822 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	10	110,432,127 - 110,451,826 (+)	Ensembl		GRCm39 Ensembl
GRCm38	10	110,600,650 - 110,615,961 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	10	110,596,266 - 110,615,961 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	10	110,037,706 - 110,053,017 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	10	110,004,986 - 110,019,625 (+)	NCBI		MGSCv36	mm8
Celera	10	112,536,212 - 112,551,506 (+)	NCBI		Celera
Cytogenetic Map	10	D1	NCBI
cM Map	10	57.74	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

biological_process (ND)

Cellular Component

cellular_component (ND)

Molecular Function

molecular_function (ND)

References

Additional References at PubMed

PMID:8889548	PMID:10349636	PMID:11042159	PMID:11076861	PMID:11217851	PMID:12466851	PMID:16141072	PMID:16141073	PMID:24200680	PMID:27899360

Genomics

Variants

Variants in 9230102K24Rik
780 total Variants

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301520	Uvbi1_m	UVB induced immunosuppression 1 (mouse)			Not determined		10	86909085	120909229	Mouse
27226772	Tibl13_m	tibia length 13, 10 week (mouse)					10	18875748	129635869	Mouse
4142386	Tgq20_m	triglyceride QTL 20 (mouse)			Not determined			88836456	122836456	Mouse
1357594	Estoq3_m	embryo survival total QTL 3 (mouse)			Not determined		10	84079650	122041528	Mouse
4141361	Cfmq3_m	cystic fibrosis modifier QTL 3 (mouse)			Not determined		10	101497164	130530862	Mouse
4141487	Tgq21_m	triglyceride QTL 21 (mouse)			Not determined			104110021	130530862	Mouse
27226764	Tibl19_m	tibia length 19, 16 week (mouse)					10	39175996	129635869	Mouse
1301895	Exq1_m	exploratory and excitability QTL 1 (mouse)			Not determined		10	102847852	130530862	Mouse
14746996	Manh69_m	mandible shape 69 (mouse)					10	104763638	130530862	Mouse
4141479	W10q8_m	weight 10 weeks QTL 8 (mouse)			Not determined			84079650	122041528	Mouse
14747004	Mancz8_m	mandible centroid size 8 (mouse)					10	82078412	116078412	Mouse
1301901	Im5_m	immunoregulatory 5 (mouse)			Not determined		10	101497164	130530862	Mouse
4142496	W6q8_m	weight 6 weeks QTL 8 (mouse)			Not determined			84079650	122041528	Mouse
1302067	Scc9_m	colon tumor susceptibility 9 (mouse)			Not determined		10	18259333	125575232	Mouse
11039496	Ltpr5b_m	Leishmania tropica response 5b (mouse)					10	108575094	130530862	Mouse
26884411	Bzwq8_m	bi-zygomatic width QTL 8, 10 week (mouse)					10	44876096	115935905	Mouse
1357622	Espq3_m	embryo survival preimplantation QTL 3 (mouse)			Not determined		10	84079650	122041528	Mouse
4142365	Egq9_m	early growth QTL 9 (mouse)			Not determined			84079650	122041528	Mouse
13208554	Lgth11_m	body length 11 (mouse)					10	90835862	120835905	Mouse
1357744	Cfbw4_m	cystic fibrosis body weight 4 (mouse)			Not determined		10	100986516	130530862	Mouse
11041664	Lmr25_m	leishmaniasis resistance 25 (mouse)					10	108575094	130530862	Mouse
1300921	Skl4_m	skeletal size (tail length) 4 (mouse)			Not determined		10	88088254	122088391	Mouse
1302200	Sle12_m	systematic lupus erythematosus susceptibility 12 (mouse)			Not determined		10	105041304	130530862	Mouse
26884407	Bzwq14_m	bi-zygomatic width QTL 14, 16 wee (mouse)					10	45476096	120635905	Mouse
11251717	Siim1_m	stress induced immobility 1 (mouse)					10	78381268	112381268	Mouse
1300797	Sluc22_m	susceptibility to lung cancer 22 (mouse)			Not determined		10	86713608	120713756	Mouse
26884405	Huml2_m	humerus length 2, 5 week (mouse)					10	69735830	130430862	Mouse
11039516	Ltpr5_m	Leishmania tropica response 5 (mouse)					10	90506901	125575232	Mouse
4142089	Obrq9_m	obesity resistance QTL 9 (mouse)			Not determined			108515907	130530862	Mouse
1357740	Obsty3_m	obesity 3 (mouse)			Not determined		10	8235478	116190980	Mouse
13208560	Wght9_m	weight 9 (mouse)					10	59835822	120835905	Mouse
1301165	Lith7_m	lithogenic gene 7 (mouse)			Not determined		10	82309418	116309657	Mouse
26884388	Skwq7_m	skull length QTL 7, 10 week (mouse)					10	101735861	113735905	Mouse
1357482	Nhdlq4_m	non-HDL QTL 4 (mouse)			Not determined		10	105041304	130530862	Mouse
1300908	Insq4_m	insulin QTL 4 (mouse)			Not determined		10	86909085	120909229	Mouse
4141054	mwfh_m	modifier of white forlock hypopigmentation (mouse)			Not determined			83017003	117017136	Mouse
4142461	Bmd25_m	bone mineral density 25 (mouse)			Not determined		10	97217101	130530862	Mouse
1301968	Estq4_m	estradiol regulated response QTL 4 (mouse)			Not determined		10	100986516	130530862	Mouse
27095902	Scvln11_m	sacral vertebrae length 2, 10 week (mouse)					10	110035861	125435869	Mouse
26884447	Sklq9_m	skull length QTL 9, 10 week (mouse)					10	67335830	111735905	Mouse
11353832	Pcholq4_m	plasma cholesterol QTL 4 (mouse)					10	73987216	125515907	Mouse
4142074	Tmevp2_m	Theiler's murine encephalomyelitis virus persistence 2 (mouse)			Not determined			92729941	111568319	Mouse
1357779	Tesq3_m	testis weight QTL 3 (mouse)			Not determined		10	84079650	122041528	Mouse
11059552	Lmr32c_m	leishmaniasis resistance 32c (mouse)					10	99309418	116220862	Mouse
11059553	Lmr32d_m	leishmaniasis resistance 32d (mouse)					10	82309418	116309657	Mouse
11059554	Lmr32e_m	leishmaniasis resistance 32e (mouse)					10	82309418	116309657	Mouse
11049570	Lmr25b_m	leishmaniasis resistance 25b (mouse)					10	108575094	130530862	Mouse
11059555	Lmr32f_m	leishmaniasis resistance 32f (mouse)					10	82309418	116309657	Mouse
11533921	Mvb2_m	modifier of vibrator 2 (mouse)					10	97217101	130530862	Mouse
26884426	Cvht1_m	cranial vault height 1, 5 week (mouse)					10	24675898	121035905	Mouse
26884424	Zlq9_m	zygomatic length QTL 9, 16 week (mouse)					10	63935779	115935905	Mouse
1357638	Cia29_m	collagen induced arthritis 29 (mouse)			Not determined		10	85454982	118497353	Mouse
26884430	Zlq5_m	zygomatic length QTL 5, 10 week (mouse)					10	67835830	124835905	Mouse
1300679	Nociq2_m	nociceptive sensitivity inflammatory QTL 2 (mouse)			Not determined		10	105041304	130530862	Mouse
1300678	Leg2_m	longevity extending gene 2 (mouse)			Not determined		10	102506908	130530862	Mouse
12880413	V125Dq9_m	vitamin D active form serum level QTL 9 (mouse)					10	97535905	130530862	Mouse
11353843	Gluq1_m	blood glucose QTL 1 (mouse)					10	73987216	125515907	Mouse
4141153	Ltgq2_m	liver triglyceride QTL 2 (mouse)			Not determined			108515907	130530862	Mouse
4141402	T2dm1sa_m	type 2 diabetes mellitus 1 in SMXA RI mice (mouse)			Not determined			97758644	130530862	Mouse
4141269	Ipng2_m	imprinted postnatal growth 2 (mouse)			Not determined			105088254	118497353	Mouse
1301758	Fcsa3_m	femoral cross-sectional area 3 (mouse)			Not determined		10	89927651	123927754	Mouse
10043881	Adip24_m	adiposity 24 (mouse)			Not determined		10	82392803	116392952	Mouse
11533919	Mvb4_m	modifier of vibrator 4 (mouse)					3	97217101	130530862	Mouse
11059544	Lmr32_m	leishmaniasis resistance 32 (mouse)					10	99309418	116220862	Mouse
4141007	Obrq10_m	obesity resistance QTL 10 (mouse)			Not determined			103243727	130530862	Mouse
1558757	Eae34_m	experimental allergic encephalomyelitis susceptibility 34 (mouse)			Not determined		10	21408154	114217230	Mouse
11049563	Lmr25a_m	leishmaniasis resistance 25a (mouse)					10	108575094	130530862	Mouse
4141387	Lgaq5_m	late growth adjusted QTL 5 (mouse)			Not determined			84079650	122041528	Mouse
11059550	Lmr32a_m	leishmaniasis resistance 32a (mouse)					10	82309418	116309657	Mouse
11059551	Lmr32b_m	leishmaniasis resistance 32b (mouse)					10	82309418	116309657	Mouse
14696727	Kidrq2_m	kidney weight, right QTL 2 (mouse)					10	102902508	130530862	Mouse
26884450	Sklq15_m	skull length QTL 15, 16 week (mouse)					10	59335822	122335905	Mouse
11040593	Lmr5e_m	leishmaniasis resistance 5e (mouse)					10	99220635	130530862	Mouse
27095911	Pglq15_m	pelvic girdle length QTL 15, 16 week (mouse)					10	39175996	129635869	Mouse
27226725	Tibw1_m	tibia width 1, proximal, 5 week (mouse)					10	102735861	123235905	Mouse
11040594	Lmr5f_m	leishmaniasis resistance 5f (mouse)					10	105179713	130530862	Mouse
11040595	Lmr5c_m	leishmaniasis resistance 5c (mouse)					10	99220635	130530862	Mouse
1357544	Vtbt10_m	vertebral trabecular bone trait 10 (mouse)			Not determined		10	97217101	130530862	Mouse
11040596	Lmr5d_m	leishmaniasis resistance 5d (mouse)					10	105179713	130530862	Mouse
11040597	Lmr5a_m	leishmaniasis resistance 5a (mouse)					10	99220635	130530862	Mouse
27226722	Tibw7_m	tibia width 7, proximal, 16 week (mouse)					10	108635861	125435869	Mouse
11040598	Lmr5b_m	leishmaniasis resistance 5b (mouse)					10	105179713	130530862	Mouse

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_028438	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC131677	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AK078991	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	KY467553	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSMUST00000219459

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	10	110,436,511 - 110,451,826 (+)	Ensembl
GRCm38.p6 Ensembl	10	110,600,650 - 110,615,961 (+)	Ensembl

Ensembl Acc Id:

ENSMUST00000220061

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	10	110,432,127 - 110,451,657 (+)	Ensembl
GRCm38.p6 Ensembl	10	110,596,266 - 110,615,796 (+)	Ensembl

RefSeq Acc Id:

NR_028438

RefSeq Status:

VALIDATED

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	10	110,436,511 - 110,451,822 (+)	NCBI
GRCm38	10	110,600,650 - 110,615,961 (+)	ENTREZGENE
MGSCv37	10	110,037,706 - 110,053,017 (+)	RGD
Celera	10	112,536,212 - 112,551,506 (+)	RGD
cM Map	10		ENTREZGENE

Sequence:

show sequence

ATTTCTAACAGTGCCTGAGAAAGCAAGCGCTGAGCTATTAACGTAATGAGCTTGGATTCAAAAT
TAAAAAGGGGGAGCCACAAAGCAGCACAGGCCGGCCACGAAGGGACGATGGCCTGAGTCCATAA
GGATGTGAATGCCATTACTCATTAACACACACTCCACTTAAGGAAATCCTTAGGAAAAGCAACT
GAGTCGAGCTAATGAGTCGCCTCTTCCTCCGATACTGGTTTTCATTGTCTACAGAGGGTTTCCC
AACCTCCACTATCTGCTCACTGGACTTGATGGTATATCAACTTATAGAGGGAAATATTCGCACC
CGGATGGTGTGCTAGGTCCTTTATTTATTCATCAAAAAAGAGAGAGAGAAAGAAAGGAGAGGAG
GGAAGAAAGAAAGATGGATTTGCTCACAAGGCTATAATCTAAGGACAAGTATTGATTGCTGAAA
CACTAAAGGAATATCTAAAGCCAGGACAATATCTTTCAAGGTCAAGCTAGCGCATGTGTTGTAA
CACTGTGGACTCCACACAGTAAGGCGCCACTATTCAATTTCAAAAGGCTCATGGCAAAGTCATG
TTTGGTTCTGCCCTGGATATCCAGTTTCCTGTTCTTGGCCAGCCAGGCAGCATCAGGACAGGAT
GAGGATGACCGTTGAAGAACCCAGCTGTCGGGGACAATTGCTTTAAAGTCTTTGTAATGTTACC
CCAAGGAAGCCCAAGAGATGAGCAAGAAGATTGATCACAGAACACTGAACAGAACTAAGCAGAC
CACAGCCAAATGGATAATGTTTCACAAAGAACTTGTAATCTCTGAATGCAGGGCTTCGTTTCAA
CCACATGCATTCCATAACGGCTATAAATTCCATTAGCACTAAATATCCACTGAGCTCTAAGCCA
AGGAGAGGAACAAAATATCAAAACAGCCTTGTGTGTTTCAACTATTATTTAGAGAGTGGTTCCT
CCATGCCAGGCACTAGAGTAGGTGATTAGAGGACTCAGTGAATAAGAACACAGTTCCTGCAGCC
TGCATGTGCTTTGAGAAGTGGCAATCTTAGACCTTGAAATAAATAATTTCAGTGTATAGACAGT
ACAATGGATAATACACACAAGTGCATATGGAAGTGGAATGTATGGAAGTGGCTGGGTTCAAATT
CTAACCCTACTGTGCACTAACATAACTCAGTTTCCTCACCTCTAAGCTGTTAATCATTGTACCT
GGCTTACAGGAACCGCTGTCTGGATTAGATGAGAAAATGTACTGAAATCGTTTTAAAAGCAATT
TTGATATAAAGTACTCGACAATT

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
Ensembl Genes	ENSMUSG00000112398	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000219459	ENTREZGENE
MGD	MGI:1925931	ENTREZGENE
NCBI Gene	9230102K24Rik	ENTREZGENE
PhenoGen	9230102K24Rik	PhenoGen
RNAcentral	URS000075C36E	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message