| Symbol: |
Gm25501 |
| Name: |
predicted gene, 25501 |
| RGD ID: |
14997742 |
| MGI Page |
MGI |
| Description: |
|
| Type: |
snorna
|
| RefSeq Status: |
MODEL |
| Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
| Position: |
| Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
|---|
| JBrowse | NCBI | UCSC | Ensembl |
|---|
| GRCm39 | 3 | 126,799,018 - 126,799,149 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | | GRCm39 Ensembl | 3 | 126,799,018 - 126,799,149 (+) | Ensembl | | GRCm39 Ensembl | | | | GRCm38 | 3 | 127,005,369 - 127,005,500 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | | GRCm38.p6 Ensembl | 3 | 127,005,369 - 127,005,500 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | | Cytogenetic Map | 3 | G2 | NCBI | | | | |
|
| JBrowse: |
View Region in Genome Browser (JBrowse)
|
| Model |
|
.
Predicted Target Of
| Count of predictions: | 172 | | Count of miRNA genes: | 158 | | Interacting mature miRNAs: | 170 | | Transcripts: | ENSMUST00000104429 | | Prediction methods: | Miranda, Rnahybrid, Targetscan | | Result types: | miRGate_prediction |
| 1300752 | Ap6q_m | alcohol preference 6 QTL (mouse) | | | Not determined | | 3 | 100372912 | 147045722 | Mouse | | 1558868 | Ses9_m | salmonella enteritidis susceptibility 9 (mouse) | | | Not determined | | 3 | 119057332 | 153057456 | Mouse | | 26884382 | Bzwq1_m | bi-zygomatic width QTL 1, 5 week (mouse) | | | | | 3 | 52207421 | 137205761 | Mouse | | 12910796 | Pwbwq6_m | post-weaning body weight QTL 6 (mouse) | | | | | 3 | 110084357 | 135715812 | Mouse | | 25314313 | Syncl1_m | synaptonemal complex length 1 (mouse) | | | | | 3 | 67907333 | 128393649 | Mouse | | 12910793 | Pwbwq7_m | post-weaning body weight QTL 7 (mouse) | | | | | 3 | 110084357 | 135715812 | Mouse | | 26884436 | Zlq3_m | zygomatic length QTL 3, 10 week (mouse) | | | | | 3 | 3265060 | 142405761 | Mouse | | 4142449 | Tgq14_m | triglyceride QTL 14 (mouse) | | | Not determined | | | 119318586 | 153318586 | Mouse | | 10412240 | Alpq6_m | alcohol preference QTL 6 (mouse) | | | Not determined | | 3 | 120772078 | 154772078 | Mouse | | 11533920 | Mvb3_m | modifier of vibrator 3 (mouse) | | | | | 3 | 98635284 | 132635383 | Mouse | | 4141935 | Tgq15_m | triglyceride QTL 15 (mouse) | | | Not determined | | | 119318586 | 153318586 | Mouse | | 1302151 | Lprm2_m | lymphoproliferation modifier 2 (mouse) | | | Not determined | | 3 | 119778857 | 153779044 | Mouse | | 1301381 | Bomb1_m | bone marrow pre-B 1 (mouse) | | | Not determined | | 3 | 111133243 | 145133417 | Mouse | | 10043919 | Afpq8_m | abdominal fat percent QTL 8 (mouse) | | | Not determined | | 3 | 119057332 | 153057456 | Mouse | | 1300619 | Cdcs1_m | cytokine deficiency colitis susceptibility 1 (mouse) | | | Not determined | | 3 | 109834882 | 143835005 | Mouse | | 26884419 | Bzwq6_m | bi-zygomatic width QTL 6, 10 week (mouse) | | | | | 3 | 100607316 | 137205761 | Mouse | | 1301705 | Sles3_m | systemic lupus erythmatosus suppressor 3 (mouse) | | | Not determined | | 3 | 37174862 | 143353183 | Mouse | | 12910815 | Ogrq1_m | overall growth rate QTL 1 (mouse) | | | | | 3 | 110084357 | 135715812 | Mouse | | 4142245 | Pstc1_m | periosteal circumference 1 (mouse) | | | Not determined | | 3 | 126270248 | 159745316 | Mouse | | 13207570 | Tcq12_m | total cholesterol QTL 12 (mouse) | | | | | 3 | 16504164 | 130163649 | Mouse | | 12792984 | Modn1_m | modifier of Dstn neovascularization 1 (mouse) | | | | | 3 | 98635284 | 132635383 | Mouse | | 4142178 | Ctrq2_m | C. trachomatis resistance QTL 2 (mouse) | | | Not determined | | 3 | 89139967 | 137453008 | Mouse | | 1302093 | Orgwq5_m | organ weight QTL 5 (mouse) | | | Not determined | | 3 | 107376936 | 147304689 | Mouse | | 26884415 | Bzwq11_m | bi-zygomatic width QTL 11, 16 week (mouse) | | | | | 3 | 124993649 | 137205761 | Mouse | | 10043955 | Wt10q4_m | body weight, 10 weeks, QTL 4 (mouse) | | | Not determined | | 3 | 98624041 | 132624197 | Mouse | | 1301347 | Fpli_m | fasting plasma insulin (mouse) | | | Not determined | | 3 | 126460514 | 159745316 | Mouse | | 1302114 | Tbs1_m | tuberculosis severity 1 (mouse) | | | Not determined | | 3 | 98924105 | 132924250 | Mouse | | 1301218 | Letohc1_m | low ethanol consumption 1 (mouse) | | | Not determined | | 3 | 126352986 | 159745316 | Mouse | | 27226733 | Tibmd6_m | tibia midshaft diameter 6, 16 week (mouse) | | | | | 3 | 101307316 | 149805637 | Mouse | | 27226732 | Tibmd3_m | tibia midshaft diameter 3, 10 week (mouse) | | | | | 3 | 96607316 | 147805636 | Mouse | | 12903998 | Cfq3_m | conditioned fear QTL 3 (mouse) | | | | | 3 | 122188811 | 127220016 | Mouse | | 1302056 | Orgwq4_m | organ weight QTL 4 (mouse) | | | Not determined | | 3 | 30067588 | 147304689 | Mouse | | 1301805 | Mors2_m | modifier of obesity related sterility 2 (mouse) | | | Not determined | | 3 | 103482659 | 137482783 | Mouse | | 1301100 | Bdt2_m | bone density traits 2 (mouse) | | | Not determined | | 3 | 114736617 | 148736784 | Mouse |
| Ensembl Acc Id: |
ENSMUST00000104429 |
| Type: |
CODING |
| Position: |
| Mouse Assembly | Chr | Position (strand) | Source |
|---|
| GRCm39 Ensembl | 3 | 126,799,018 - 126,799,149 (+) | Ensembl | | GRCm38.p6 Ensembl | 3 | 127,005,369 - 127,005,500 (+) | Ensembl |
|
| RefSeq Acc Id: |
XR_004941721 |
| Type: |
NON-CODING |
| Position: |
| Mouse Assembly | Chr | Position (strand) | Source |
|---|
| GRCm39 | 3 | 126,799,018 - 126,799,149 (+) | NCBI |
|
| Sequence: |
CCTGCCTCTAGAGGCTTTGCAGGAGTGGCCGCTGTGTCCTGCTTACGTCAGTAGGTGGCAGAGAGGAGAGAGACTATGTCTACACTCAGTATTCTGACCTTTGAACATCTGAATGATTAGTAGCTCCA
CATT
hide sequence
|
|
|
