Symbol: |
Gm22027 |
Name: |
predicted gene, 22027 |
RGD ID: |
14996636 |
MGI Page |
MGI |
Description: |
|
Type: |
snorna
|
RefSeq Status: |
MODEL |
RGD Orthologs |
|
Alliance Orthologs |
|
More Info |
more info ...
|
More Info |
|
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 3 | 96,083,677 - 96,083,803 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 3 | 96,083,677 - 96,083,803 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 3 | 96,176,361 - 96,176,487 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 3 | 96,176,361 - 96,176,487 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 3 | F2.1 | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
Gm22027 (Mus musculus - house mouse) |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 3 | 96,083,677 - 96,083,803 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 3 | 96,083,677 - 96,083,803 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 3 | 96,176,361 - 96,176,487 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 3 | 96,176,361 - 96,176,487 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 3 | F2.1 | NCBI | | | | |
|
LOC124900296 (Homo sapiens - human) |
Human Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCh38 | 10 | 119,060,983 - 119,061,111 (-) | NCBI | GRCh38 | GRCh38 | hg38 | GRCh38 | GRCh38.p14 Ensembl | 10 | 119,060,983 - 119,061,111 (-) | Ensembl | GRCh38 | | hg38 | GRCh38 | Cytogenetic Map | 10 | q26.11 | NCBI | | | | | T2T-CHM13v2.0 | 10 | 119,956,423 - 119,956,551 (-) | NCBI | | T2T-CHM13v2.0 | | |
|
LOC119866652 (Canis lupus familiaris - dog) |
Dog Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
Dog10K_Boxer_Tasha | 28 | 29,452,804 - 29,452,933 (-) | NCBI | | Dog10K_Boxer_Tasha | | | ROS_Cfam_1.0 | 28 | 29,841,466 - 29,841,595 (-) | NCBI | | ROS_Cfam_1.0 | | | UMICH_Zoey_3.1 | 28 | 29,395,378 - 29,395,507 (-) | NCBI | | UMICH_Zoey_3.1 | | | UNSW_CanFamBas_1.0 | 28 | 29,415,276 - 29,415,405 (-) | NCBI | | UNSW_CanFamBas_1.0 | | | UU_Cfam_GSD_1.0 | 28 | 29,609,523 - 29,609,652 (-) | NCBI | | UU_Cfam_GSD_1.0 | | |
|
.
Predicted Target Of
Count of predictions: | 87 | Count of miRNA genes: | 83 | Interacting mature miRNAs: | 85 | Transcripts: | ENSMUST00000122737 | Prediction methods: | Miranda, Rnahybrid, Targetscan | Result types: | miRGate_prediction |
4142399 | Aec1_m | autoimmune exocrinopathy 1 (mouse) | | | Not determined | | | 7586174 | 102690034 | Mouse | 26884378 | Skwq6_m | skull length QTL 6, 10 week (mouse) | | | | | 3 | 51907421 | 102307316 | Mouse | 1301971 | Cia5_m | collagen induced arthritis QTL 5 (mouse) | | | Not determined | | 3 | 66046658 | 100046795 | Mouse | 1301392 | Eae3_m | susceptibility to experimental allergic encephalomyelitis 3 (mouse) | | | Not determined | | 3 | 79548730 | 113548837 | Mouse | 1301904 | Iba2_m | induction of brown adipocytes 2 (mouse) | | | Not determined | | 3 | 82147043 | 116147184 | Mouse | 26884382 | Bzwq1_m | bi-zygomatic width QTL 1, 5 week (mouse) | | | | | 3 | 52207421 | 137205761 | Mouse | 11041900 | Lmr11a_m | leishmaniasis resistance 11a (mouse) | | | | | 3 | 83463991 | 117464137 | Mouse | 1301398 | Rapop3_m | radiation-induced apoptosis 3 (mouse) | | | Not determined | | 3 | 90511217 | 100464137 | Mouse | 26884380 | Skwq1_m | skull length QTL 1, 5 week (mouse) | | | | | 3 | 43954435 | 101607316 | Mouse | 14746984 | Manh54_m | mandible shape 54 (mouse) | | | | | 3 | 85289152 | 119289152 | Mouse | 12738440 | Twq3_m | testis weight QTL 3 (mouse) | | | | | 3 | 87228015 | 121228015 | Mouse | 25314313 | Syncl1_m | synaptonemal complex length 1 (mouse) | | | | | 3 | 67907333 | 128393649 | Mouse | 1301272 | Cfsw1_m | cystic fibrosis survival to weaning 1 (mouse) | | | Not determined | | 3 | 83882912 | 117883044 | Mouse | 1301791 | Char4_m | P. chabaudi malaria resistance QTL 4 (mouse) | | | Not determined | | 3 | 69625509 | 100655290 | Mouse | 11049572 | Lmr11c_m | leishmaniasis resistance 11c (mouse) | | | | | 3 | 72139967 | 106140094 | Mouse | 26884436 | Zlq3_m | zygomatic length QTL 3, 10 week (mouse) | | | | | 3 | 3265060 | 142405761 | Mouse | 26884427 | Cvht4_m | cranial vault height 4, 10 week (mouse) | | | | | 3 | 16054164 | 109707316 | Mouse | 10766455 | Sle22_m | systematic lupus erythematosus susceptibility 22 (mouse) | | | | | 3 | 90376936 | 124377072 | Mouse | 14747001 | Mancz4_m | mandible centroid size 4 (mouse) | | | | | 3 | 90378017 | 124378017 | Mouse | 1301705 | Sles3_m | systemic lupus erythmatosus suppressor 3 (mouse) | | | Not determined | | 3 | 37174862 | 143353183 | Mouse | 13207570 | Tcq12_m | total cholesterol QTL 12 (mouse) | | | | | 3 | 16504164 | 130163649 | Mouse | 1357583 | Sle18_m | systematic lupus erythematosus susceptibility 18 (mouse) | | | Not determined | | 3 | 87208904 | 125316236 | Mouse | 26884422 | Cvht7_m | cranial vault height 7, 16 week (mouse) | | | | | 3 | 28954149 | 118893649 | Mouse | 4142178 | Ctrq2_m | C. trachomatis resistance QTL 2 (mouse) | | | Not determined | | 3 | 89139967 | 137453008 | Mouse | 1300595 | Tmevd2_m | Theiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 2 (mouse) | | | Not determined | | 3 | 75463302 | 109463549 | Mouse | 11251721 | Ewc3_m | ethanol withdrawal and consumption 3 (mouse) | | | | | 3 | 69568554 | 103568554 | Mouse | 1300982 | Lmr11_m | leishmaniasis resistance 11 (mouse) | | | Not determined | | 3 | 72139967 | 106140094 | Mouse | 1301947 | Pcfm3_m | periosteal circumference and femur length 3 (mouse) | | | Not determined | | 3 | 81084652 | 115084797 | Mouse | 4142099 | Cq3_m | cholesterol QTL 3 (mouse) | | | Not determined | | 3 | 84888918 | 118889067 | Mouse | 11039512 | Ltpr3b_m | Leishmania tropica response 3b (mouse) | | | | | 3 | 83463991 | 117464137 | Mouse | 1301349 | Pgia26_m | proteoglycan induced arthritis 26 (mouse) | | | Not determined | | 3 | 92251533 | 126251650 | Mouse | 11039519 | Ltpr3_m | Leishmania tropica response 3 (mouse) | | | | | 3 | 56704102 | 100464137 | Mouse | 1302052 | Etohcta4_m | ethanol conditioned taste aversion 4 (mouse) | | | Not determined | | 3 | 91000105 | 125008748 | Mouse | 1302056 | Orgwq4_m | organ weight QTL 4 (mouse) | | | Not determined | | 3 | 30067588 | 147304689 | Mouse | 11039507 | Ltpr3g_m | Leishmania tropica response 3g (mouse) | | | | | 3 | 83463991 | 117464137 | Mouse | 11039508 | Ltpr3f_m | Leishmania tropica response 3f (mouse) | | | | | 3 | 83463991 | 117464137 | Mouse | 1301422 | Sle11_m | systematic lupus erythematosus susceptibility 11 (mouse) | | | Not determined | | 3 | 70208904 | 104209042 | Mouse | 11039509 | Ltpr3e_m | Leishmania tropica response 3e (mouse) | | | | | 3 | 83463991 | 117464137 | Mouse | 11039510 | Ltpr3d_m | Leishmania tropica response 3d (mouse) | | | | | 3 | 83463991 | 117464137 | Mouse | 13208566 | Bmiq5_m | body mass index QTL 5 (mouse) | | | | | 3 | 40954435 | 115793649 | Mouse | 11039511 | Ltpr3c_m | Leishmania tropica response 3c (mouse) | | | | | 3 | 83463991 | 117464137 | Mouse |
Ensembl Acc Id: |
ENSMUST00000122737 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 3 | 96,083,677 - 96,083,803 (+) | Ensembl | GRCm38.p6 Ensembl | 3 | 96,176,361 - 96,176,487 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004941701 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 3 | 96,083,677 - 96,083,803 (+) | NCBI |
|
Sequence: |
ATGCACATTTCATTGTCTTTTTTCTTCACATCAAGAGAAAAGATATTTCTGATGTGCTAAATAAACCTGGGGGAATATTAGCAGCATGGCTACTTTAGCCAGTGCTGTCAGTCACCTTCAGACAGAT
hide sequence
|
|
|