Symbol: |
Gm22823 |
Name: |
predicted gene, 22823 |
RGD ID: |
14996366 |
MGI Page |
MGI |
Description: |
|
Type: |
snrna
|
RefSeq Status: |
MODEL |
Latest Assembly: |
GRCm39 - Mouse Genome Assembly GRCm39 |
Position: |
Mouse Assembly | Chr | Position (strand) | Source | Genome Browsers |
---|
JBrowse | NCBI | UCSC | Ensembl |
---|
GRCm39 | 14 | 40,969,643 - 40,969,749 (+) | NCBI | GRCm39 | GRCm39 | mm39 | | GRCm39 Ensembl | 14 | 40,969,643 - 40,969,749 (+) | Ensembl | | GRCm39 Ensembl | | | GRCm38 | 14 | 41,247,686 - 41,247,792 (+) | NCBI | GRCm38 | GRCm38 | mm10 | GRCm38 | GRCm38.p6 Ensembl | 14 | 41,247,686 - 41,247,792 (+) | Ensembl | GRCm38 | | mm10 | GRCm38 | Cytogenetic Map | 14 | B | NCBI | | | | |
|
JBrowse: |
View Region in Genome Browser (JBrowse)
|
Model |
|
.
Predicted Target Of
Count of predictions: | 35 | Count of miRNA genes: | 35 | Interacting mature miRNAs: | 35 | Transcripts: | ENSMUST00000179754 | Prediction methods: | Miranda, Rnahybrid | Result types: | miRGate_prediction |
1357589 | Kdnw2_m | kidney weight 2 (mouse) | | | Not determined | | 14 | 20887473 | 121269804 | Mouse | 1300625 | Cosz2_m | cocaine seizure 2 (mouse) | | | Not determined | | 14 | 35045797 | 68785736 | Mouse | 27226748 | Femd8_m | femur midshaft diameter 8, 10 week (mouse) | | | | | 14 | 13769273 | 46737457 | Mouse | 1357527 | Epfpq1_m | epididymal fat percentage QTL 1 (mouse) | | | Not determined | | 14 | 21062450 | 71885801 | Mouse | 27226744 | Metcl6_m | metatarsal-calcaneal length 6, 5 week (mouse) | | | | | 14 | 30321957 | 52937457 | Mouse | 27226775 | Tibl7_m | tibia length 7, 5 week (mouse) | | | | | 14 | 30321957 | 48837457 | Mouse | 27226774 | Tibl15_m | tibia length 15, 10 week (mouse) | | | | | 14 | 30321957 | 87937436 | Mouse | 4142485 | Modor2_m | modifier of ocular retardation 2 (mouse) | | | Not determined | | 14 | 24926248 | 58179769 | Mouse | 4142419 | Tgq26_m | triglyceride QTL 26 (mouse) | | | Not determined | | | 40337319 | 74337319 | Mouse | 27226737 | Metcl12_m | metatarsal-calcaneal length 12, 10 week (mouse) | | | | | 14 | 33221957 | 59437449 | Mouse | 1301372 | Sluc13_m | susceptibility to lung cancer 13 (mouse) | | | Not determined | | 14 | 18827604 | 52827726 | Mouse | 1300544 | Hypn_m | hyperinsulinemia (mouse) | | | Not determined | | 14 | 15160616 | 49160765 | Mouse | 1300998 | Cia17_m | collagen induced arthritis 17 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 10043887 | Cia50_m | collagen induced arthritis QTL 50 (mouse) | | | Not determined | | 14 | 37430185 | 71430320 | Mouse | 4141864 | Mrdq4_m | modifier of retinal degeneration QTL 4 (mouse) | | | Not determined | | | 9923245 | 48765082 | Mouse | 10043886 | Cia49_m | collagen induced arthritis QTL 49 (mouse) | | | Not determined | | 14 | 29996994 | 63997133 | Mouse | 1300779 | Dyscalc4_m | dystrophic cardiac calcinosis 4 (mouse) | | | Not determined | | 14 | 12212871 | 46213007 | Mouse | 27226727 | Tibl21_m | tibia length 21, 16 week (mouse) | | | | | 14 | 34121957 | 52937457 | Mouse | 14746973 | Manh76_m | mandible shape 76 (mouse) | | | | | 14 | 22287217 | 56287217 | Mouse | 1300909 | Ath13_m | atherosclerosis 13 (mouse) | | | Not determined | | 14 | 30335250 | 64335381 | Mouse | 27226752 | Femd4_m | femur midshaft diameter 4, 5 week (mouse) | | | | | 14 | 13769273 | 47237457 | Mouse | 13506929 | Recrq10_m | recombination rate in male meiosis QTL 10 (mouse) | | | | | 14 | 27921957 | 61137449 | Mouse |
Ensembl Acc Id: |
ENSMUST00000179754 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm38.p6 Ensembl | 14 | 41,247,686 - 41,247,792 (+) | Ensembl |
|
Ensembl Acc Id: |
ENSMUST00000239681 |
Type: |
CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 Ensembl | 14 | 40,969,643 - 40,969,749 (+) | Ensembl |
|
RefSeq Acc Id: |
XR_004938755 |
Type: |
NON-CODING |
Position: |
Mouse Assembly | Chr | Position (strand) | Source |
---|
GRCm39 | 14 | 40,969,643 - 40,969,749 (+) | NCBI |
|
Sequence: |
GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTTT
hide sequence
|
|
|