Gm41347 (predicted gene, 41347) - Rat Genome Database

Name: Gm41347
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Advanced Search (OLGA)

Gene: Gm41347 (predicted gene, 41347) Mus musculus

Analyze

Symbol:

Gm41347

Name:

predicted gene, 41347

RGD ID:

10015429

MGI Page

MGI

Description:

Type:

ncrna

RefSeq Status:

MODEL

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	74,727,050 - 74,745,245 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm38	15	74,855,201 - 74,873,396 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
Cytogenetic Map	15	D3	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

References

Genomics

Variants

Variants in Gm41347
498 total Variants

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1301779	Dpml_m	dopamine loss (mouse)			Not determined		15	51004694	76794493	Mouse
38501067	Tip3_m	tuberculosis immunophenotype 3, IFN-g level (mouse)					15	53563396	89584203	Mouse
1300627	Sluc26_m	susceptibility to lung cancer 26 (mouse)			Not determined		15	70345653	104073951	Mouse
27226777	Tibl8_m	tibia length 8, 5 week (mouse)					15	6929481	84584201	Mouse
15092079	Igly6_m	IgG glycosylation 6, GP6 (mouse)					15	74100540	82674156	Mouse
27226773	Tibl16_m	tibia length 16, 10 week (mouse)					15	6929481	75871849	Mouse
4142252	Tailaq4_m	tail length adjusted QTL 4 (mouse)			Not determined			3489694	78601286	Mouse
1357703	Vtbt17_m	vertebral trabecular bone trait 17 (mouse)			Not determined		15	44553313	78553437	Mouse
13504731	Cath5_m	carotid atherosclerosis 5 (mouse)					15	54789129	88789129	Mouse
1558786	Msq1_m	MAV-1 susceptibility QTL 1 (mouse)			Not determined		15	63389646	81086436	Mouse
12791003	Aath8_m	aortic arch atherosclerosis 8 (mouse)					15	73430144	104073951	Mouse
1301006	Hfib1_m	hepatic fibrogenesis 1 (mouse)			Not determined		15	47306334	81306479	Mouse
27095936	Ulnl4_m	ulna length 4, 5 week (mouse)					15	56763396	87684201	Mouse
10755515	Amzn3_m	anatomical modifier of Zfp423 3 (mouse)					15	46389646	80389845	Mouse
1301171	Brm2_m	brachyury modifier 2 (mouse)			Not determined		15	65525376	99525499	Mouse
1301429	Pcir3_m	periosteal circumference 3 (mouse)			Not determined		15	48465362	82465496	Mouse
1302197	Bhr2_m	bronchial hyperresponsiveness 2 (mouse)			Not determined		15	64306334	103425899	Mouse
26884402	Cvht9_m	cranial vault height 9, 16 week (mouse)					15	42163396	95497881	Mouse
1357756	Alaa4_m	alopecia areata 4 (mouse)			Not determined		15	46389646	80389845	Mouse
1302074	Bmd4_m	bone mineral density 4 (mouse)			Not determined		15	56186708	103425899	Mouse
1301433	Rapop5_m	radiation-induced apoptosis 5 (mouse)			Not determined		15	9273022	79474762	Mouse
26884392	Humsd8_m	humerus midshaft diameter 8, 16 week (mouse)					15	29300146	76084200	Mouse
26884399	Humsd1_m	humerus midshaft diameter 1, 5 week (mouse)					15	48363396	101708435	Mouse
26884397	Humsd5_m	humerus midshaft diameter 5, 10 week (mouse)					15	48363396	98397881	Mouse
1300648	Dbsty4_m	diabesity 4 (mouse)			Not determined		15	70349271	104073951	Mouse
27226786	Feml11_m	femur length 11, 5 week (mouse)					15	6129481	75871849	Mouse
10412067	Pain2_m	pain 2 (mouse)			Not determined		15	51645339	85645626	Mouse
4141952	W3q7_m	weight 3 weeks QTL 7 (mouse)			Not determined			3489694	78601286	Mouse
26884442	Sklq6_m	skull length QTL 6, 5 week (mouse)					15	6129481	100797881	Mouse
27226717	Tibw4_m	tibia width 4, proximal, 10 week (mouse)					15	6129481	78684200	Mouse
1357526	Hyplip2_m	hyperlipidemia 2 (mouse)			Not determined		15	12402203	102896555	Mouse
4142198	Hbtq_m	habituation QTL (mouse)			Not determined		15	51160708	85160833	Mouse
1357407	Pfat4_m	predicted fat percentage 4 (mouse)	8.6		Body fat amount	predicted fat percentage	15	57117005	91117153	Mouse
4142448	Tailq6_m	tail length QTL 6 (mouse)			Not determined			3489694	78601286	Mouse
1357659	Epfpq4_m	epididymal fat percentage QTL 4 (mouse)			Not determined		15	3489694	78601286	Mouse
25671381	Hrsq3_m	host response to SARS QTL 3, eosinophilia (mouse)					15	72144539	75844833	Mouse
26884425	Cvht2_m	cranial vault height 2, 5 week (mouse)					15	28800146	102008435	Mouse
1301568	Tria2_m	T-cell receptor induced activation 2 (mouse)			Not determined		15	44859141	78859281	Mouse
1302080	Szs13_m	seizure susceptibility 13 (mouse)			Not determined		15	51685832	85694449	Mouse
1300800	Ses3_m	salmonella enteritidis susceptibility 3 (mouse)			Not determined		15	57117005	91117153	Mouse
10045637	Heal27_m	wound healing/regeneration 29 (mouse)			Not determined		15	51418361	85418511	Mouse
1558985	Eae32_m	experimental allergic encephalomyelitis susceptibility 32 (mouse)			Not determined		15	32578416	103425899	Mouse
4141921	Pstc3_m	periosteal circumference 3 (mouse)			Not determined		15	67270698	101270847	Mouse
1301708	Cocrb14_m	cocaine related behavior 14 (mouse)			Not determined		15	51806515	85806651	Mouse
12880420	V25Dq8_m	vitamin D inactive form serum level QTL 8 (mouse)					15	61584200	95584200	Mouse
27095932	Ulnl11_m	ulna length 11, 16 week (mouse)					15	6129481	76384200	Mouse
1302002	Cocia2_m	cocaine induced activation 2 (mouse)			Not determined		15	72372459	79899178	Mouse
14747011	Mancz13_m	mandible centroid size 13 (mouse)					15	72382669	104073951	Mouse
1357559	Scfq2_m	subcutaneous fat pad weight QTL 2 (mouse)			Not determined		15	3489694	78601286	Mouse
1300726	Pitm4_m	prion incubation time 4 (mouse)			Not determined		15	70349271	104073951	Mouse
1301119	Drb7_m	dopamine receptor binding 7 (mouse)			Not determined		15	65336578	99341028	Mouse
4141135	Cia35_m	collagen induced arthritis 35 (mouse)			Not determined		15	64811826	98811946	Mouse
27226734	Tibmd5_m	tibia midshaft diameter 5, 10 week (mouse)					15	6129481	86684201	Mouse
13442492	Mecth2_m	mechanosensation threshold 2 (mouse)					15	74662849	79387201	Mouse
1301601	Faq9_m	fluctuating asymmetry QTL 9 (mouse)			Not determined		15	63163903	97163995	Mouse
27226729	Tibmd2_m	tibia midshaft diameter 2, 5 week (mouse)					15	38000244	86684201	Mouse
1301860	Gct3_m	granulosa cell tumorigenesis 3 (mouse)			Not determined		15	47409596	81409691	Mouse
27226721	Tibw8_m	tibia width 8, proximal, 16 week (mouse)					15	6929481	75871849	Mouse
1300844	Emo2_m	emotionality 2 (mouse)			Not determined		15	72372459	76794493	Mouse

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Sequence

Nucleotide Sequences


RefSeq Transcripts	XR_875415	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC139671	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

XR_875415

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	15	74,727,050 - 74,745,245 (+)	NCBI
GRCm38	15	74,855,201 - 74,873,396 (+)	NCBI

Sequence:

show sequence

AACTGGTAGAAAGGAGAGCCATGCTCTAGAAAAGCGTATTTGCAGCAGCAGCTTGGGGCAAGAG
GCATTCCTCTGCTACCTCCCTCGTCCTCAGGCCTGGGATCTGCATGGCATGGTATCAATCCATG
CTTGGCTGTGACTGGTCTCCACAGCGCCACCGAAGCAGGATCTGCATCTTGTGCCTGGGTCATC
AATCTCAACTCTCTCCTCTTTCCCAATGTCCACTCACAGCAAGAACACACCACGTCTCAGGCCA
CGGAGTTCTCTGTGGGCCACCCAGGGCTCCAGGTGCATCCGACGGGGGAGCATACTCTCCACCT
GGTGCAACTTCTCAGCATCCTCCGGCAACATCACAGATACGATCTGTGTTTTCCCTACACTGTG
CCTGTGGAGTGAAGCACAGAGCCCTGCTGAGAAGGTCCCCTCGAGACCCTCGAATAACTGAACC
TACTGGATGGGTCAAGTGGCGCCCAACGTGGGGCACGAGGTACGACCGCCCTCTGGACAATGGA
TTAAAGAGGTACCGCGCAGACAGTGAGACAGTGAGACAGTTCCCCGCCACTTCGCTTAAGTGTC
GCGGACATTGGGAGCTCACAATCCAGTGTTGAAGAAGTCTCGCCAGGAAGTGAAACGGAAACTG
CTGTGGAGGGATGCTGCTTACTGGCTCCTCCACCAGGGTTGCCAGCACAGAGTCTCCCAAGGCT
CCATACAGACCTGAGCCCTGGGATTCCAAGGCAGGCGCAGAAGACGCACTACCCCAGGCCTCCA
CCTGGAGGCGCTCAGGAGCTGCACTTCCTGTGGGCCGCTATGGCCCCAACCAGGAAGGATTCCC
TTTGAGATTTGGTTCACACATCTGCATCCCTTCGGACTGTCTGGACTCAAGTTGAGATACTTCC
CAAGTGGCAAGGGGCTCAGGACACCCCAGCAGAGGTCCTGATCTCTTACAGCACGTAGGACTCT
TGCTTGTGTGTCTTGCTGCTGCTGCTACAGTGAGACCCTGAGGCTAAAAAGGAGAGTGCAGGGG
AGGTTAACTCCACCCAAATG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
MGD	MGI:5624232	ENTREZGENE
NCBI Gene	Gm41347	ENTREZGENE
PhenoGen	Gm41347	PhenoGen

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message