D17Mit5 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D17Mit5

Symbol: D17Mit5
Previously known as: MIT292; R292; oxsts5681; 
RGD ID: 33707
Expected Size: 287 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21770,852,565 - 70,852,846 (+)MAPPERmRatBN7.2
Rnor_6.01774,701,926 - 74,702,206NCBIRnor6.0
Rnor_5.01776,361,596 - 76,361,876UniSTSRnor5.0
RGSC_v3.41782,125,182 - 82,125,463RGDRGSC3.4
RGSC_v3.41782,125,183 - 82,125,463UniSTSRGSC3.4
RGSC_v3.11782,136,016 - 82,136,296RGD
Celera1770,314,995 - 70,315,274UniSTS
RH 3.4 Map17690.7UniSTS
RH 3.4 Map17690.7RGD
RH 2.0 Map17598.7RGD
Cytogenetic Map17 RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LEW/Pit   LH/Mav   MHS/Gib   WN/N   WKY/OlaHsd   WTC/Kyo   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   BN-Lx/Cub   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Edcs5   Gluco40  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
6. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer TCCCTTGGTTTATTTTGCCA
Reverse Primer CCTCCTCGTGCTGGAAGTAG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473990 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000247 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
12903982Kidm70Kidney mass QTL 700.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)172365318470974005Rat
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
1354588Bvd4Brain ventricular dilatation QTL 45.310.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)175349882882479847Rat
1600398Edcs5Endometrial carcinoma susceptibility QTL 52.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)175724672370852846Rat
2302365Gluco40Glucose level QTL 404.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)175724684382046127Rat
7488963Bp369Blood pressure QTL 3690.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)175900564977910000Rat
2317045Aia11Adjuvant induced arthritis QTL 114.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)176078142686533673Rat
7411577Bw141Body weight QTL 1410.001body mass (VT:0001259)body weight gain (CMO:0000420)176261951686533673Rat
1300131Bp193Blood pressure QTL 1933.3arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)176364000973951021Rat
631502Cm26Cardiac mass QTL 263.71heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)176570358081153923Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100303144 UniSTS
  100303245 UniSTS
UniSTS 119494 UniSTS