Symbol:
Dusp4
Name:
dual specificity phosphatase 4
RGD ID:
620625
Description:
Enables MAP kinase tyrosine/serine/threonine phosphatase activity. Involved in protein dephosphorylation. Predicted to be located in nucleoplasm. Predicted to be active in cytoplasm and nucleus. Orthologous to human DUSP4 (dual specificity phosphatase 4); PARTICIPATES IN mitogen activated protein kinase signaling pathway; INTERACTS WITH (+)-schisandrin B; 2,3,7,8-tetrachlorodibenzodioxine; acetamide.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
dual specificity protein phosphatase 4; MAP kinase phosphatase; MAP kinase phosphatase 2; mitogen-activated protein kinase phosphatase 2; Mkp-2; Mkp2
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 64,079,893 - 64,101,396 (-) NCBI GRCr8 mRatBN7.2 16 57,376,659 - 57,398,161 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 57,377,229 - 57,398,138 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 62,711,691 - 62,721,924 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 66,125,603 - 66,135,836 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 61,345,654 - 61,355,885 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 61,080,767 - 61,090,973 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 61,078,175 - 61,091,169 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 60,749,903 - 60,769,025 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 61,109,626 - 61,119,981 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 61,109,700 - 61,120,056 (-) NCBI Celera 16 55,427,894 - 55,438,053 (-) NCBI Celera Cytogenetic Map 16 q12.2 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Dusp4 Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of DUSP4 mRNA] CTD PMID:31150632 Dusp4 Rat (-)-demecolcine increases expression ISO DUSP4 (Homo sapiens) 6480464 Demecolcine results in increased expression of DUSP4 mRNA CTD PMID:23649840 Dusp4 Rat (-)-epigallocatechin 3-gallate increases expression ISO DUSP4 (Homo sapiens) 6480464 epigallocatechin gallate results in increased expression of DUSP4 mRNA CTD PMID:16084531 Dusp4 Rat (1->4)-beta-D-glucan multiple interactions ISO Dusp4 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of DUSP4 mRNA CTD PMID:36331819 Dusp4 Rat 1,2-dimethylhydrazine increases expression ISO Dusp4 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of DUSP4 mRNA CTD PMID:22206623 Dusp4 Rat 1-chloro-2,4-dinitrobenzene increases expression ISO Dusp4 (Mus musculus) 6480464 Dinitrochlorobenzene results in increased expression of DUSP4 mRNA CTD PMID:18242016 Dusp4 Rat 17beta-estradiol multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Estradiol co-treated with Tetrachlorodibenzodioxin] results in increased expression of DUSP4 mRNA and [Estradiol co-treated with TGFB1 protein] results in increased expression of DUSP4 mRNA CTD PMID:19619570 and PMID:30165855 Dusp4 Rat 17beta-estradiol increases expression ISO Dusp4 (Mus musculus) 6480464 Estradiol results in increased expression of DUSP4 mRNA CTD PMID:19484750 Dusp4 Rat 17beta-estradiol increases expression ISO DUSP4 (Homo sapiens) 6480464 Estradiol results in increased expression of DUSP4 mRNA CTD PMID:19153601 more ... Dusp4 Rat 17beta-estradiol decreases expression ISO DUSP4 (Homo sapiens) 6480464 Estradiol results in decreased expression of DUSP4 mRNA CTD PMID:16202921 Dusp4 Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO DUSP4 (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of DUSP4 mRNA CTD PMID:29581250 Dusp4 Rat 2,2',4,4'-Tetrabromodiphenyl ether multiple interactions ISO Dusp4 (Mus musculus) 6480464 [Flame Retardants results in increased abundance of 2 more ... CTD PMID:38995820 Dusp4 Rat 2,2',5,5'-tetrachlorobiphenyl increases expression ISO DUSP4 (Homo sapiens) 6480464 2 more ... CTD PMID:36804509 Dusp4 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Estradiol co-treated with Tetrachlorodibenzodioxin] results in increased expression of DUSP4 mRNA CTD PMID:19619570 Dusp4 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of DUSP4 mRNA CTD PMID:33387578 and PMID:34747641 Dusp4 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of DUSP4 mRNA CTD PMID:32109520 Dusp4 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Dusp4 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of DUSP4 mRNA CTD PMID:21570461 and PMID:24680724 Dusp4 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO DUSP4 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in increased expression of DUSP4 mRNA CTD PMID:17101203 and PMID:19619570 Dusp4 Rat 2,4-diaminotoluene increases expression ISO Dusp4 (Mus musculus) 6480464 2 and 4-diaminotoluene results in increased expression of DUSP4 mRNA CTD PMID:20713471 Dusp4 Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Dusp4 (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Dusp4 Rat 2-hydroxypropanoic acid increases expression ISO DUSP4 (Homo sapiens) 6480464 Lactic Acid results in increased expression of DUSP4 mRNA CTD PMID:30851411 Dusp4 Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO Dusp4 (Mus musculus) 6480464 tetrabromobisphenol A results in increased expression of DUSP4 mRNA CTD PMID:25172293 Dusp4 Rat 3-methylcholanthrene increases expression ISO Dusp4 (Mus musculus) 6480464 Methylcholanthrene results in increased expression of DUSP4 mRNA CTD PMID:20713471 Dusp4 Rat 4,4'-sulfonyldiphenol increases expression ISO Dusp4 (Mus musculus) 6480464 bisphenol S results in increased expression of DUSP4 mRNA CTD PMID:30951980 Dusp4 Rat 4-(ethoxymethylene)-2-phenyloxazol-5-one increases expression ISO Dusp4 (Mus musculus) 6480464 Oxazolone results in increased expression of DUSP4 mRNA CTD PMID:18242016 Dusp4 Rat 8-Br-cAMP increases expression ISO DUSP4 (Homo sapiens) 6480464 8-Bromo Cyclic Adenosine Monophosphate results in increased expression of DUSP4 mRNA CTD PMID:20147733 Dusp4 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of DUSP4 mRNA CTD PMID:31881176 Dusp4 Rat afimoxifene multiple interactions ISO DUSP4 (Homo sapiens) 6480464 GPER1 protein affects the reaction [afimoxifene results in increased expression of DUSP4 mRNA] CTD PMID:19153601 Dusp4 Rat afimoxifene increases expression ISO DUSP4 (Homo sapiens) 6480464 afimoxifene results in increased expression of DUSP4 mRNA CTD PMID:19153601 Dusp4 Rat aflatoxin B1 increases expression ISO DUSP4 (Homo sapiens) 6480464 Aflatoxin B1 results in increased expression of DUSP4 mRNA CTD PMID:22100608 and PMID:27153756 Dusp4 Rat all-trans-retinoic acid increases expression ISO DUSP4 (Homo sapiens) 6480464 Tretinoin results in increased expression of DUSP4 mRNA CTD PMID:33167477 Dusp4 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of DUSP4 mRNA CTD PMID:16483693 Dusp4 Rat antimycin A increases expression ISO DUSP4 (Homo sapiens) 6480464 Antimycin A results in increased expression of DUSP4 mRNA CTD PMID:33512557 Dusp4 Rat aripiprazole multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Aripiprazole co-treated with Ozone] results in increased expression of DUSP4 mRNA CTD PMID:31476115 Dusp4 Rat arsenite(3-) increases expression ISO Dusp4 (Mus musculus) 6480464 arsenite results in increased expression of DUSP4 mRNA CTD PMID:18929588 Dusp4 Rat arsenous acid decreases expression ISO DUSP4 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of DUSP4 mRNA CTD PMID:15725085 Dusp4 Rat atrazine decreases expression EXP 6480464 Atrazine results in decreased expression of DUSP4 mRNA CTD PMID:36841081 Dusp4 Rat avobenzone increases expression ISO DUSP4 (Homo sapiens) 6480464 avobenzone results in increased expression of DUSP4 mRNA CTD PMID:31016361 Dusp4 Rat bathocuproine disulfonic acid multiple interactions ISO DUSP4 (Homo sapiens) 6480464 bathocuproine sulfonate inhibits the reaction [pyrrolidine dithiocarbamic acid inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of DUSP4 mRNA]] CTD PMID:15477007 Dusp4 Rat benzene increases expression ISO DUSP4 (Homo sapiens) 6480464 Benzene results in increased expression of DUSP4 mRNA CTD PMID:19162166 Dusp4 Rat benzo[a]pyrene multiple interactions ISO Dusp4 (Mus musculus) 6480464 AHR protein affects the reaction [Benzo(a)pyrene affects the expression of DUSP4 mRNA] CTD PMID:22228805 Dusp4 Rat benzo[a]pyrene increases expression ISO DUSP4 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of DUSP4 mRNA CTD PMID:30453624 and PMID:32234424 Dusp4 Rat benzo[a]pyrene increases methylation ISO DUSP4 (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of DUSP4 promoter CTD PMID:27901495 Dusp4 Rat benzo[a]pyrene increases expression ISO Dusp4 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of DUSP4 mRNA CTD PMID:19770486 more ... Dusp4 Rat benzo[a]pyrene diol epoxide I decreases expression ISO DUSP4 (Homo sapiens) 6480464 7 more ... CTD PMID:19150397 Dusp4 Rat benzo[e]pyrene increases methylation ISO DUSP4 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of DUSP4 intron CTD PMID:30157460 Dusp4 Rat beta-lapachone increases expression ISO DUSP4 (Homo sapiens) 6480464 beta-lapachone results in increased expression of DUSP4 mRNA CTD PMID:38218311 Dusp4 Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Dusp4 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] affects the expression of DUSP4 mRNA CTD PMID:39150890 Dusp4 Rat bis(2-ethylhexyl) phthalate multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono-(2-ethylhexyl)phthalate] which results in increased methylation of DUSP4 gene CTD PMID:33872906 Dusp4 Rat bisphenol A increases expression ISO Dusp4 (Mus musculus) 6480464 bisphenol A results in increased expression of DUSP4 mRNA CTD PMID:26063408 and PMID:32156529 Dusp4 Rat bisphenol A increases expression ISO DUSP4 (Homo sapiens) 6480464 bisphenol A results in increased expression of DUSP4 mRNA CTD PMID:33670352 Dusp4 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of DUSP4 mRNA CTD PMID:30816183 and PMID:34947998 Dusp4 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of DUSP4 mRNA CTD PMID:25181051 Dusp4 Rat bisphenol F affects expression ISO Dusp4 (Mus musculus) 6480464 bisphenol F affects the expression of DUSP4 mRNA CTD PMID:30951980 Dusp4 Rat bisphenol F increases expression ISO Dusp4 (Mus musculus) 6480464 bisphenol F results in increased expression of DUSP4 mRNA CTD PMID:38685157 Dusp4 Rat bortezomib decreases expression ISO DUSP4 (Homo sapiens) 6480464 Bortezomib results in decreased expression of DUSP4 mRNA CTD PMID:20977926 Dusp4 Rat butanal increases expression ISO DUSP4 (Homo sapiens) 6480464 butyraldehyde results in increased expression of DUSP4 mRNA CTD PMID:26079696 Dusp4 Rat Butylbenzyl phthalate multiple interactions ISO Dusp4 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] affects the expression of DUSP4 mRNA CTD PMID:39150890 Dusp4 Rat cadmium atom increases expression ISO DUSP4 (Homo sapiens) 6480464 Cadmium results in increased expression of DUSP4 mRNA CTD PMID:22562489 Dusp4 Rat cannabidiol increases expression ISO DUSP4 (Homo sapiens) 6480464 Cannabidiol results in increased expression of DUSP4 mRNA CTD PMID:33244087 Dusp4 Rat choline multiple interactions ISO Dusp4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of DUSP4 gene CTD PMID:20938992 Dusp4 Rat chromium(6+) multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [zinc chromate results in increased abundance of chromium hexavalent ion] which results in increased expression of DUSP4 mRNA CTD PMID:38479592 Dusp4 Rat copper atom multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of DUSP4 mRNA CTD PMID:30911355 Dusp4 Rat copper(0) multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Chelating Agents binds to Copper] which results in increased expression of DUSP4 mRNA CTD PMID:30911355 Dusp4 Rat copper(II) chloride increases expression ISO DUSP4 (Homo sapiens) 6480464 cupric chloride results in increased expression of DUSP4 mRNA CTD PMID:38568856 Dusp4 Rat crocidolite asbestos affects expression ISO DUSP4 (Homo sapiens) 6480464 Asbestos and Crocidolite affects the expression of DUSP4 mRNA CTD PMID:25757056 Dusp4 Rat crocidolite asbestos increases expression ISO DUSP4 (Homo sapiens) 6480464 Asbestos and Crocidolite results in increased expression of DUSP4 mRNA CTD PMID:25351596 Dusp4 Rat cumene decreases expression ISO Dusp4 (Mus musculus) 6480464 cumene results in decreased expression of DUSP4 mRNA CTD PMID:18648096 Dusp4 Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of DUSP4 mRNA CTD PMID:26577399 Dusp4 Rat cyclosporin A increases expression ISO Dusp4 (Mus musculus) 6480464 Cyclosporine results in increased expression of DUSP4 mRNA CTD PMID:19770486 Dusp4 Rat cyclosporin A decreases expression ISO DUSP4 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of DUSP4 mRNA CTD PMID:27989131 Dusp4 Rat cyclosporin A increases expression ISO DUSP4 (Homo sapiens) 6480464 Cyclosporine results in increased expression of DUSP4 mRNA CTD PMID:25562108 Dusp4 Rat cylindrospermopsin increases expression ISO DUSP4 (Homo sapiens) 6480464 cylindrospermopsin results in increased expression of DUSP4 mRNA CTD PMID:24921660 Dusp4 Rat cytarabine decreases expression ISO DUSP4 (Homo sapiens) 6480464 Cytarabine results in decreased expression of DUSP4 mRNA CTD PMID:19194470 Dusp4 Rat daidzein decreases expression ISO DUSP4 (Homo sapiens) 6480464 daidzein results in decreased expression of DUSP4 mRNA CTD PMID:16865672 Dusp4 Rat daunorubicin increases expression ISO DUSP4 (Homo sapiens) 6480464 Daunorubicin results in increased expression of DUSP4 mRNA CTD PMID:26537877 and PMID:28940058 Dusp4 Rat DDE increases expression ISO DUSP4 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in increased expression of DUSP4 mRNA CTD PMID:38568856 Dusp4 Rat deguelin increases expression ISO DUSP4 (Homo sapiens) 6480464 deguelin results in increased expression of DUSP4 mRNA CTD PMID:33512557 Dusp4 Rat dexamethasone decreases expression ISO Dusp4 (Mus musculus) 6480464 Dexamethasone results in decreased expression of DUSP4 mRNA CTD PMID:22733784 Dusp4 Rat diarsenic trioxide decreases expression ISO DUSP4 (Homo sapiens) 6480464 Arsenic Trioxide results in decreased expression of DUSP4 mRNA CTD PMID:15725085 Dusp4 Rat Dibutyl phosphate affects expression ISO DUSP4 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of DUSP4 mRNA CTD PMID:37042841 Dusp4 Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of DUSP4 mRNA CTD PMID:21266533 Dusp4 Rat dibutyl phthalate multiple interactions ISO Dusp4 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] affects the expression of DUSP4 mRNA CTD PMID:39150890 Dusp4 Rat dibutyl phthalate increases expression ISO Dusp4 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of DUSP4 mRNA CTD PMID:17361019 and PMID:21266533 Dusp4 Rat diethyl phthalate multiple interactions ISO Dusp4 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] affects the expression of DUSP4 mRNA CTD PMID:39150890 Dusp4 Rat diisobutyl phthalate multiple interactions ISO Dusp4 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] affects the expression of DUSP4 mRNA CTD PMID:39150890 Dusp4 Rat diisononyl phthalate multiple interactions ISO Dusp4 (Mus musculus) 6480464 [diethyl phthalate co-treated with Diethylhexyl Phthalate co-treated with diisononyl phthalate co-treated with Dibutyl Phthalate co-treated with diisobutyl phthalate co-treated with butylbenzyl phthalate] affects the expression of DUSP4 mRNA CTD PMID:39150890 Dusp4 Rat dinophysistoxin 1 increases expression ISO DUSP4 (Homo sapiens) 6480464 dinophysistoxin 1 results in increased expression of DUSP4 mRNA CTD PMID:28939011 Dusp4 Rat dioxygen decreases expression ISO DUSP4 (Homo sapiens) 6480464 Oxygen deficiency results in decreased expression of DUSP4 mRNA CTD PMID:26516004 Dusp4 Rat dioxygen multiple interactions ISO Dusp4 (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of DUSP4 mRNA CTD PMID:30529165 Dusp4 Rat dorsomorphin multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Dusp4 Rat doxorubicin increases expression ISO DUSP4 (Homo sapiens) 6480464 Doxorubicin results in increased expression of DUSP4 mRNA CTD PMID:26537877 more ... Dusp4 Rat doxorubicin affects expression ISO DUSP4 (Homo sapiens) 6480464 Doxorubicin affects the expression of DUSP4 mRNA CTD PMID:29803840 Dusp4 Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of DUSP4 mRNA CTD PMID:29391264 Dusp4 Rat entinostat decreases expression ISO DUSP4 (Homo sapiens) 6480464 entinostat results in decreased expression of DUSP4 mRNA CTD PMID:27188386 Dusp4 Rat equol decreases expression ISO DUSP4 (Homo sapiens) 6480464 Equol results in decreased expression of DUSP4 mRNA CTD PMID:16865672 Dusp4 Rat ethanol affects expression ISO Dusp4 (Mus musculus) 6480464 Ethanol affects the expression of DUSP4 mRNA CTD PMID:30319688 Dusp4 Rat ethyl methanesulfonate increases expression ISO DUSP4 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in increased expression of DUSP4 mRNA CTD PMID:23649840 Dusp4 Rat etoposide affects response to substance ISO DUSP4 (Homo sapiens) 6480464 DUSP4 protein affects the susceptibility to Etoposide CTD PMID:16217747 Dusp4 Rat etoposide increases expression ISO DUSP4 (Homo sapiens) 6480464 Etoposide results in increased expression of DUSP4 mRNA CTD PMID:29397400 Dusp4 Rat febuxostat increases expression ISO DUSP4 (Homo sapiens) 6480464 Febuxostat results in increased expression of DUSP4 mRNA CTD PMID:35866629 Dusp4 Rat fenpyroximate increases expression ISO DUSP4 (Homo sapiens) 6480464 fenpyroximate results in increased expression of DUSP4 mRNA CTD PMID:33512557 Dusp4 Rat ferric oxide increases expression ISO Dusp4 (Mus musculus) 6480464 ferric oxide analog results in increased expression of DUSP4 mRNA CTD PMID:25086211 Dusp4 Rat fluoranthene multiple interactions ISO Dusp4 (Mus musculus) 6480464 [1-methylanthracene co-treated with fluoranthene] results in increased expression of DUSP4 mRNA CTD PMID:28329830 Dusp4 Rat folic acid multiple interactions ISO Dusp4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of DUSP4 gene CTD PMID:20938992 Dusp4 Rat folic acid decreases expression ISO Dusp4 (Mus musculus) 6480464 Folic Acid results in decreased expression of DUSP4 mRNA CTD PMID:25629700 Dusp4 Rat fonofos increases methylation ISO DUSP4 (Homo sapiens) 6480464 Fonofos results in increased methylation of DUSP4 promoter CTD PMID:22847954 Dusp4 Rat formaldehyde decreases expression ISO DUSP4 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of DUSP4 mRNA CTD PMID:20655997 Dusp4 Rat formaldehyde increases expression ISO DUSP4 (Homo sapiens) 6480464 Formaldehyde results in increased expression of DUSP4 mRNA CTD PMID:23649840 Dusp4 Rat furan decreases expression EXP 6480464 furan results in decreased expression of DUSP4 mRNA CTD PMID:25539665 Dusp4 Rat genistein decreases expression ISO DUSP4 (Homo sapiens) 6480464 Genistein results in decreased expression of DUSP4 mRNA CTD PMID:16865672 Dusp4 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of DUSP4 mRNA CTD PMID:33387578 Dusp4 Rat glyphosate affects expression ISO DUSP4 (Homo sapiens) 6480464 Glyphosate affects the expression of DUSP4 mRNA CTD PMID:31295307 Dusp4 Rat GSK-J4 decreases expression ISO DUSP4 (Homo sapiens) 6480464 GSK-J4 results in decreased expression of DUSP4 mRNA CTD PMID:29301935 Dusp4 Rat indole-3-methanol affects expression EXP 6480464 indole-3-carbinol affects the expression of DUSP4 mRNA CTD PMID:21396975 Dusp4 Rat ionomycin multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of DUSP4 mRNA more ... CTD PMID:15477007 Dusp4 Rat isoflavones decreases expression ISO DUSP4 (Homo sapiens) 6480464 Isoflavones results in decreased expression of DUSP4 mRNA CTD PMID:17374662 Dusp4 Rat isoprenaline increases expression ISO Dusp4 (Mus musculus) 6480464 Isoproterenol results in increased expression of DUSP4 mRNA CTD PMID:20003209 Dusp4 Rat isotretinoin decreases expression ISO DUSP4 (Homo sapiens) 6480464 Isotretinoin results in decreased expression of DUSP4 mRNA CTD PMID:20436886 Dusp4 Rat L-methionine multiple interactions ISO Dusp4 (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of DUSP4 gene CTD PMID:20938992 Dusp4 Rat lead diacetate increases expression ISO DUSP4 (Homo sapiens) 6480464 lead acetate results in increased expression of DUSP4 mRNA CTD PMID:38568856 Dusp4 Rat lipopolysaccharide increases expression ISO Dusp4 (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of DUSP4 mRNA and Lipopolysaccharides results in increased expression of DUSP4 protein CTD PMID:16880258 Dusp4 Rat manganese(II) chloride increases expression EXP 6480464 manganese chloride results in increased expression of DUSP4 mRNA CTD PMID:28801915 Dusp4 Rat metacetamol decreases expression ISO Dusp4 (Mus musculus) 6480464 3-hydroxyacetanilide results in decreased expression of DUSP4 mRNA CTD PMID:18544908 Dusp4 Rat metformin increases expression EXP 6480464 Metformin results in increased expression of DUSP4 mRNA CTD PMID:19664596 Dusp4 Rat methapyrilene increases methylation ISO DUSP4 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of DUSP4 intron CTD PMID:30157460 Dusp4 Rat methotrexate affects response to substance ISO DUSP4 (Homo sapiens) 6480464 DUSP4 protein affects the susceptibility to Methotrexate CTD PMID:16217747 Dusp4 Rat methylmercury chloride increases expression ISO DUSP4 (Homo sapiens) 6480464 methylmercuric chloride results in increased expression of DUSP4 mRNA CTD PMID:28001369 Dusp4 Rat mitomycin C affects response to substance ISO DUSP4 (Homo sapiens) 6480464 DUSP4 protein affects the susceptibility to Mitomycin CTD PMID:16217747 Dusp4 Rat mitoxantrone affects response to substance ISO DUSP4 (Homo sapiens) 6480464 DUSP4 protein affects the susceptibility to Mitoxantrone CTD PMID:16217747 Dusp4 Rat mitoxantrone increases expression ISO DUSP4 (Homo sapiens) 6480464 Mitoxantrone results in increased expression of DUSP4 mRNA CTD PMID:26537877 and PMID:28940058 Dusp4 Rat mono(2-ethylhexyl) phthalate multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono-(2-ethylhexyl)phthalate] which results in increased methylation of DUSP4 gene CTD PMID:33872906 Dusp4 Rat mono(2-ethylhexyl) phthalate increases expression ISO DUSP4 (Homo sapiens) 6480464 mono-(2-ethylhexyl)phthalate results in increased expression of DUSP4 mRNA CTD PMID:36695872 Dusp4 Rat N-acetyl-L-cysteine increases expression ISO DUSP4 (Homo sapiens) 6480464 Acetylcysteine results in increased expression of DUSP4 mRNA CTD PMID:16084531 Dusp4 Rat N-methyl-4-phenylpyridinium increases expression EXP 6480464 1-Methyl-4-phenylpyridinium results in increased expression of DUSP4 mRNA CTD PMID:28801915 Dusp4 Rat N-nitrosodiethylamine decreases expression ISO Dusp4 (Mus musculus) 6480464 Diethylnitrosamine results in decreased expression of DUSP4 mRNA CTD PMID:18691550 Dusp4 Rat N-nitrosodiethylamine multiple interactions ISO Dusp4 (Mus musculus) 6480464 IKBKB protein inhibits the reaction [Diethylnitrosamine results in decreased expression of DUSP4 mRNA] and MAPK14 protein inhibits the reaction [Diethylnitrosamine results in decreased expression of DUSP4 mRNA] CTD PMID:18691550 Dusp4 Rat N-Nitrosopyrrolidine increases expression ISO DUSP4 (Homo sapiens) 6480464 N-Nitrosopyrrolidine results in increased expression of DUSP4 mRNA CTD PMID:32234424 Dusp4 Rat nickel sulfate increases expression ISO DUSP4 (Homo sapiens) 6480464 nickel sulfate results in increased expression of DUSP4 mRNA CTD PMID:16780908 Dusp4 Rat niclosamide increases expression ISO DUSP4 (Homo sapiens) 6480464 Niclosamide results in increased expression of DUSP4 mRNA CTD PMID:36318118 Dusp4 Rat okadaic acid decreases expression ISO DUSP4 (Homo sapiens) 6480464 Okadaic Acid results in decreased expression of DUSP4 protein CTD PMID:38832940 Dusp4 Rat okadaic acid increases expression ISO DUSP4 (Homo sapiens) 6480464 Okadaic Acid results in increased expression of DUSP4 mRNA CTD PMID:38832940 Dusp4 Rat ozone multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Aripiprazole co-treated with Ozone] results in increased expression of DUSP4 mRNA CTD PMID:31476115 Dusp4 Rat ozone increases expression ISO DUSP4 (Homo sapiens) 6480464 Ozone results in increased expression of DUSP4 mRNA CTD PMID:31476115 Dusp4 Rat panobinostat decreases expression ISO DUSP4 (Homo sapiens) 6480464 panobinostat results in decreased expression of DUSP4 mRNA CTD PMID:26272509 Dusp4 Rat panobinostat multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of DUSP4 mRNA CTD PMID:27188386 Dusp4 Rat paracetamol increases expression ISO Dusp4 (Mus musculus) 6480464 Acetaminophen results in increased expression of DUSP4 mRNA CTD PMID:18544908 Dusp4 Rat paracetamol increases expression ISO DUSP4 (Homo sapiens) 6480464 Acetaminophen results in increased expression of DUSP4 mRNA CTD PMID:29067470 Dusp4 Rat paracetamol affects expression ISO Dusp4 (Mus musculus) 6480464 Acetaminophen affects the expression of DUSP4 mRNA CTD PMID:17562736 Dusp4 Rat parathion increases methylation ISO DUSP4 (Homo sapiens) 6480464 Parathion results in increased methylation of DUSP4 promoter CTD PMID:22847954 Dusp4 Rat PD 0325901 multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [mirdametinib co-treated with (+)-JQ1 compound] results in decreased expression of DUSP4 mRNA CTD PMID:25119042 Dusp4 Rat PD 0325901 decreases expression ISO DUSP4 (Homo sapiens) 6480464 mirdametinib results in decreased expression of DUSP4 mRNA CTD PMID:25119042 Dusp4 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Dusp4 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of DUSP4 mRNA CTD PMID:36331819 Dusp4 Rat phorbol 13-acetate 12-myristate multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of DUSP4 mRNA more ... CTD PMID:15477007 Dusp4 Rat picoxystrobin decreases expression ISO DUSP4 (Homo sapiens) 6480464 picoxystrobin results in decreased expression of DUSP4 mRNA CTD PMID:33512557 Dusp4 Rat pirinixic acid increases expression ISO Dusp4 (Mus musculus) 6480464 pirinixic acid results in increased expression of DUSP4 mRNA CTD PMID:23811191 Dusp4 Rat potassium chromate decreases expression ISO DUSP4 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of DUSP4 mRNA CTD PMID:22714537 Dusp4 Rat pyrrolidine dithiocarbamate multiple interactions ISO DUSP4 (Homo sapiens) 6480464 bathocuproine sulfonate inhibits the reaction [pyrrolidine dithiocarbamic acid inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of DUSP4 mRNA]] and pyrrolidine dithiocarbamic acid inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of DUSP4 mRNA] CTD PMID:15477007 Dusp4 Rat quercetin increases expression ISO DUSP4 (Homo sapiens) 6480464 Quercetin results in increased expression of DUSP4 mRNA CTD PMID:21632981 Dusp4 Rat rac-lactic acid increases expression ISO DUSP4 (Homo sapiens) 6480464 Lactic Acid results in increased expression of DUSP4 mRNA CTD PMID:30851411 Dusp4 Rat raloxifene decreases expression ISO DUSP4 (Homo sapiens) 6480464 Raloxifene Hydrochloride results in decreased expression of DUSP4 mRNA CTD PMID:16497877 Dusp4 Rat Rebamipide increases expression EXP 6480464 rebamipide results in increased expression of DUSP4 mRNA CTD PMID:15104358 Dusp4 Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of DUSP4 mRNA CTD PMID:19664596 Dusp4 Rat SB 431542 multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [NOG protein co-treated with Panobinostat co-treated with dorsomorphin co-treated with 4-(5-benzo(1 more ... CTD PMID:27188386 Dusp4 Rat silver atom increases expression ISO Dusp4 (Mus musculus) 6480464 Silver results in increased expression of DUSP4 mRNA CTD PMID:27131904 Dusp4 Rat silver(0) increases expression ISO Dusp4 (Mus musculus) 6480464 Silver results in increased expression of DUSP4 mRNA CTD PMID:27131904 Dusp4 Rat sodium arsenite decreases methylation ISO DUSP4 (Homo sapiens) 6480464 sodium arsenite results in decreased methylation of DUSP4 gene CTD PMID:25199682 Dusp4 Rat Soman increases expression EXP 6480464 Soman results in increased expression of DUSP4 mRNA CTD PMID:19281266 Dusp4 Rat sotorasib multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of DUSP4 mRNA CTD PMID:36139627 Dusp4 Rat sulforaphane increases expression ISO DUSP4 (Homo sapiens) 6480464 sulforaphane results in increased expression of DUSP4 mRNA CTD PMID:31838189 Dusp4 Rat sunitinib increases expression ISO DUSP4 (Homo sapiens) 6480464 Sunitinib results in increased expression of DUSP4 mRNA CTD PMID:31533062 Dusp4 Rat tebufenpyrad increases expression ISO DUSP4 (Homo sapiens) 6480464 4-chloro-N-((4-(1 and 1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide results in increased expression of DUSP4 mRNA CTD PMID:33512557 Dusp4 Rat terbufos increases methylation ISO DUSP4 (Homo sapiens) 6480464 terbufos results in increased methylation of DUSP4 promoter CTD PMID:22847954 Dusp4 Rat testosterone decreases expression ISO DUSP4 (Homo sapiens) 6480464 Testosterone results in decreased expression of DUSP4 mRNA CTD PMID:33359661 Dusp4 Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of DUSP4 mRNA CTD PMID:31150632 Dusp4 Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of DUSP4 mRNA] CTD PMID:31150632 Dusp4 Rat thifluzamide increases expression ISO DUSP4 (Homo sapiens) 6480464 thifluzamide results in increased expression of DUSP4 mRNA CTD PMID:33512557 Dusp4 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of DUSP4 mRNA CTD PMID:34492290 Dusp4 Rat titanium dioxide decreases methylation ISO Dusp4 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of DUSP4 gene and titanium dioxide results in decreased methylation of DUSP4 promoter CTD PMID:35295148 Dusp4 Rat toluene 2,4-diisocyanate increases expression ISO Dusp4 (Mus musculus) 6480464 Toluene 2 and 4-Diisocyanate results in increased expression of DUSP4 mRNA CTD PMID:18242016 Dusp4 Rat trametinib multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [sotorasib co-treated with trametinib co-treated with NVP-BKM120] results in decreased expression of DUSP4 mRNA CTD PMID:36139627 Dusp4 Rat trichostatin A decreases expression ISO DUSP4 (Homo sapiens) 6480464 trichostatin A results in decreased expression of DUSP4 mRNA CTD PMID:24935251 and PMID:26272509 Dusp4 Rat trichostatin A affects expression ISO DUSP4 (Homo sapiens) 6480464 trichostatin A affects the expression of DUSP4 mRNA CTD PMID:28542535 Dusp4 Rat trichostatin A multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [NOG protein co-treated with trichostatin A co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of DUSP4 mRNA CTD PMID:27188386 Dusp4 Rat trimellitic anhydride increases expression ISO Dusp4 (Mus musculus) 6480464 trimellitic anhydride results in increased expression of DUSP4 mRNA CTD PMID:19042947 Dusp4 Rat valproic acid affects expression ISO Dusp4 (Mus musculus) 6480464 Valproic Acid affects the expression of DUSP4 mRNA CTD PMID:17963808 Dusp4 Rat valproic acid decreases expression EXP 6480464 Valproic Acid results in decreased expression of DUSP4 mRNA CTD PMID:29427782 Dusp4 Rat valproic acid multiple interactions ISO DUSP4 (Homo sapiens) 6480464 [NOG protein co-treated with Valproic Acid co-treated with dorsomorphin co-treated with 4-(5-benzo(1 and 3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide] results in decreased expression of DUSP4 mRNA CTD PMID:27188386 Dusp4 Rat valproic acid decreases expression ISO DUSP4 (Homo sapiens) 6480464 Valproic Acid results in decreased expression of DUSP4 mRNA CTD PMID:23179753 more ... Dusp4 Rat valproic acid increases methylation ISO DUSP4 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of DUSP4 gene CTD PMID:29154799 Dusp4 Rat valproic acid affects expression ISO DUSP4 (Homo sapiens) 6480464 Valproic Acid affects the expression of DUSP4 mRNA CTD PMID:25979313 Dusp4 Rat vincristine increases expression ISO DUSP4 (Homo sapiens) 6480464 Vincristine results in increased expression of DUSP4 mRNA CTD PMID:23649840 Dusp4 Rat vorinostat decreases expression ISO DUSP4 (Homo sapiens) 6480464 vorinostat results in decreased expression of DUSP4 mRNA CTD PMID:27188386 Dusp4 Rat zoledronic acid decreases expression ISO DUSP4 (Homo sapiens) 6480464 zoledronic acid results in decreased expression of DUSP4 mRNA CTD PMID:24714768
Imported Annotations - KEGG (archival)
(+)-schisandrin B (EXP) (-)-demecolcine (ISO) (-)-epigallocatechin 3-gallate (ISO) (1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 1-chloro-2,4-dinitrobenzene (ISO) 17beta-estradiol (ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,2',5,5'-tetrachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-diaminotoluene (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2-hydroxypropanoic acid (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-methylcholanthrene (ISO) 4,4'-sulfonyldiphenol (ISO) 4-(ethoxymethylene)-2-phenyloxazol-5-one (ISO) 8-Br-cAMP (ISO) acetamide (EXP) afimoxifene (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) ammonium chloride (EXP) antimycin A (ISO) aripiprazole (ISO) arsenite(3-) (ISO) arsenous acid (ISO) atrazine (EXP) avobenzone (ISO) bathocuproine disulfonic acid (ISO) benzene (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) benzo[e]pyrene (ISO) beta-lapachone (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) bortezomib (ISO) butanal (ISO) Butylbenzyl phthalate (ISO) cadmium atom (ISO) cannabidiol (ISO) choline (ISO) chromium(6+) (ISO) copper atom (ISO) copper(0) (ISO) copper(II) chloride (ISO) crocidolite asbestos (ISO) cumene (ISO) Cuprizon (EXP) cyclosporin A (ISO) cylindrospermopsin (ISO) cytarabine (ISO) daidzein (ISO) daunorubicin (ISO) DDE (ISO) deguelin (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (EXP,ISO) diethyl phthalate (ISO) diisobutyl phthalate (ISO) diisononyl phthalate (ISO) dinophysistoxin 1 (ISO) dioxygen (ISO) dorsomorphin (ISO) doxorubicin (ISO) endosulfan (EXP) entinostat (ISO) equol (ISO) ethanol (ISO) ethyl methanesulfonate (ISO) etoposide (ISO) febuxostat (ISO) fenpyroximate (ISO) ferric oxide (ISO) fluoranthene (ISO) folic acid (ISO) fonofos (ISO) formaldehyde (ISO) furan (EXP) genistein (ISO) gentamycin (EXP) glyphosate (ISO) GSK-J4 (ISO) indole-3-methanol (EXP) ionomycin (ISO) isoflavones (ISO) isoprenaline (ISO) isotretinoin (ISO) L-methionine (ISO) lead diacetate (ISO) lipopolysaccharide (ISO) manganese(II) chloride (EXP) metacetamol (ISO) metformin (EXP) methapyrilene (ISO) methotrexate (ISO) methylmercury chloride (ISO) mitomycin C (ISO) mitoxantrone (ISO) mono(2-ethylhexyl) phthalate (ISO) N-acetyl-L-cysteine (ISO) N-methyl-4-phenylpyridinium (EXP) N-nitrosodiethylamine (ISO) N-Nitrosopyrrolidine (ISO) nickel sulfate (ISO) niclosamide (ISO) okadaic acid (ISO) ozone (ISO) panobinostat (ISO) paracetamol (ISO) parathion (ISO) PD 0325901 (ISO) perfluorooctane-1-sulfonic acid (ISO) phorbol 13-acetate 12-myristate (ISO) picoxystrobin (ISO) pirinixic acid (ISO) potassium chromate (ISO) pyrrolidine dithiocarbamate (ISO) quercetin (ISO) rac-lactic acid (ISO) raloxifene (ISO) Rebamipide (EXP) rotenone (EXP) SB 431542 (ISO) silver atom (ISO) silver(0) (ISO) sodium arsenite (ISO) Soman (EXP) sotorasib (ISO) sulforaphane (ISO) sunitinib (ISO) tebufenpyrad (ISO) terbufos (ISO) testosterone (ISO) tetrachloromethane (EXP) thifluzamide (ISO) thioacetamide (EXP) titanium dioxide (ISO) toluene 2,4-diisocyanate (ISO) trametinib (ISO) trichostatin A (ISO) trimellitic anhydride (ISO) valproic acid (EXP,ISO) vincristine (ISO) vorinostat (ISO) zoledronic acid (ISO)
1.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
2.
Map kinase phosphatases (MKP's) are early responsive genes during induction of cerulein hyperstimulation pancreatitis.
Hofken T, etal., Biochem Biophys Res Commun. 2000 Sep 24;276(2):680-5.
3.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
4.
A novel mitogen-activated protein kinase phosphatase. Structure, expression, and regulation.
Misra-Press A, etal., J Biol Chem 1995 Jun 16;270(24):14587-96.
5.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
6.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
7.
GOA pipeline
RGD automated data pipeline
8.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
9.
Inhibition of protein tyrosine/mitogen-activated protein kinase phosphatase activity is associated with D2 dopamine receptor supersensitivity in a rat model of Parkinson's disease.
Zhen X, etal., Mol Pharmacol 2002 Dec;62(6):1356-63.
Dusp4 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 16 64,079,893 - 64,101,396 (-) NCBI GRCr8 mRatBN7.2 16 57,376,659 - 57,398,161 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 16 57,377,229 - 57,398,138 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 16 62,711,691 - 62,721,924 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 16 66,125,603 - 66,135,836 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 16 61,345,654 - 61,355,885 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 61,080,767 - 61,090,973 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 61,078,175 - 61,091,169 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 60,749,903 - 60,769,025 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 16 61,109,626 - 61,119,981 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 16 61,109,700 - 61,120,056 (-) NCBI Celera 16 55,427,894 - 55,438,053 (-) NCBI Celera Cytogenetic Map 16 q12.2 NCBI
DUSP4 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 29,333,064 - 29,350,684 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 29,333,064 - 29,350,684 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 29,190,581 - 29,208,201 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 29,249,530 - 29,264,104 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 8 29,249,538 - 29,262,241 NCBI Celera 8 28,153,208 - 28,167,802 (-) NCBI Celera Cytogenetic Map 8 p12 NCBI HuRef 8 27,734,943 - 27,752,631 (-) NCBI HuRef CHM1_1 8 29,392,567 - 29,410,254 (-) NCBI CHM1_1 T2T-CHM13v2.0 8 29,611,341 - 29,628,961 (-) NCBI T2T-CHM13v2.0
Dusp4 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 8 35,274,448 - 35,289,106 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 8 35,274,451 - 35,287,048 (+) Ensembl GRCm39 Ensembl GRCm38 8 34,807,610 - 34,819,894 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 8 34,807,297 - 34,819,894 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 8 35,870,664 - 35,882,948 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 8 36,276,127 - 36,288,411 (+) NCBI MGSCv36 mm8 Celera 8 37,423,596 - 37,435,832 (+) NCBI Celera Cytogenetic Map 8 A4 NCBI cM Map 8 21.16 NCBI
Dusp4 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955463 5,778,700 - 5,794,282 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955463 5,778,945 - 5,794,282 (-) NCBI ChiLan1.0 ChiLan1.0
DUSP4 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 47,882,880 - 47,900,548 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 23,598,583 - 23,616,218 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 28,623,777 - 28,641,432 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 25,816,714 - 25,834,307 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 8 25,819,989 - 25,834,332 (-) Ensembl panpan1.1 panPan2
DUSP4 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ROS_Cfam_1.0 16 36,828,592 - 36,844,313 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 16 36,828,997 - 36,841,190 (+) Ensembl ROS_Cfam_1.0 Ensembl
Dusp4
DUSP4 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 15 55,491,087 - 55,508,455 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 15 55,491,084 - 55,508,460 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 15 62,906,062 - 62,923,413 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
DUSP4 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 8 27,459,455 - 27,473,811 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 8 27,456,430 - 27,473,352 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666052 14,654,175 - 14,671,595 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Dusp4
.
Predicted Target Of
Count of predictions: 101 Count of miRNA genes: 82 Interacting mature miRNAs: 91 Transcripts: ENSRNOT00000016328 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2300163 Bmd64 Bone mineral density QTL 64 5.3 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 16 37752156 82752156 Rat 1600378 Arunc4 Aerobic running capacity QTL 4 0.03 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 380245 80345693 Rat 70215 Niddm29 Non-insulin dependent diabetes mellitus QTL 29 3.54 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 16 19004435 75226532 Rat 1578768 Stresp22 Stress response QTL 22 2.8 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 16 35288870 80288870 Rat 737826 Alc11 Alcohol consumption QTL 11 3.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 16 4227609 60252231 Rat 2302057 Pia29 Pristane induced arthritis QTL 29 3.6 0.001 blood autoantibody amount (VT:0003725) serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111) 16 21735975 66735975 Rat 7205510 Activ5 Activity QTL 5 3.78 0.00028 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 16 42396345 84729064 Rat 631525 Pia14 Pristane induced arthritis QTL 14 4.4 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 16 55711087 83402471 Rat 7411648 Foco22 Food consumption QTL 22 15 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 16 52726464 84729064 Rat 8694453 Bw172 Body weight QTL 172 8.33 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 16 24325513 69325513 Rat 1298529 Arunc1 Aerobic running capacity QTL 1 4 exercise endurance trait (VT:0002332) maximum distance run on treadmill (CMO:0001406) 16 31951520 60148445 Rat 2312663 Slep9 Serum leptin concentration QTL 9 0.001 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 16 832236 59492508 Rat 2312660 Bw95 Body weight QTL 95 0.05 inguinal fat pad mass (VT:0010424) inguinal fat pad weight to body weight ratio (CMO:0001253) 16 832236 59492508 Rat 6903294 Stl30 Serum triglyceride level QTL 30 2.6 0.0013 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 16 25152793 70152793 Rat 2293690 Bss45 Bone structure and strength QTL 45 5.13 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 16 37752156 82752156 Rat 8694364 Abfw7 Abdominal fat weight QTL 7 12.22 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 16 52726464 84729064 Rat 2312666 Insul16 Insulin level QTL 16 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 16 832236 59492508 Rat 8694429 Bw164 Body weight QTL 164 5 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 16 52726464 84729064 Rat 70205 Gcr3 Gastric cancer resistance QTL 3 2.3 stomach morphology trait (VT:0000470) stomach tumor diameter (CMO:0001889) 16 17696791 82635055 Rat 2312669 Stl23 Serum triglyceride level QTL 23 0.01 blood triglyceride amount (VT:0002644) serum triglyceride level (CMO:0000360) 16 832236 59492508 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000016328 ⟹ ENSRNOP00000016328
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 16 57,377,229 - 57,398,138 (-) Ensembl Rnor_6.0 Ensembl 16 61,078,175 - 61,091,169 (-) Ensembl
RefSeq Acc Id:
NM_022199 ⟹ NP_071535
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 64,079,893 - 64,093,700 (-) NCBI mRatBN7.2 16 57,376,659 - 57,390,467 (-) NCBI Rnor_6.0 16 61,080,767 - 61,090,973 (-) NCBI Rnor_5.0 16 60,749,903 - 60,769,025 (-) NCBI RGSC_v3.4 16 61,109,626 - 61,119,981 (-) RGD Celera 16 55,427,894 - 55,438,053 (-) RGD
Sequence:
ATGGTGACGATGGAGGAACTGCGGGAGATGGACTGCAGCGTGCTCAAAAGGCTGATGAACCGAGATGAGAACGGCGGCACGGCGGGCAGCAGCGGCGGCAGCCACGGCGCCCTGGGGCTGCTGAGCGG
hide sequence
RefSeq Acc Id:
XM_039094803 ⟹ XP_038950731
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 64,079,895 - 64,101,396 (-) NCBI mRatBN7.2 16 57,376,659 - 57,398,161 (-) NCBI
RefSeq Acc Id:
XM_063275682 ⟹ XP_063131752
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 16 64,079,895 - 64,092,779 (-) NCBI
RefSeq Acc Id:
NP_071535 ⟸ NM_022199
- UniProtKB:
Q62767 (UniProtKB/Swiss-Prot), G3V7L2 (UniProtKB/TrEMBL), A6IVN4 (UniProtKB/TrEMBL)
- Sequence:
MVTMEELREMDCSVLKRLMNRDENGGTAGSSGGSHGALGLLSGGKCLLLDCRPFLAHSAGYIRGSVNVRCNTIVRRRAKGSVSLEQILPAEEEVRARLRSGLYSAVIVYDERSPRAESLREDSTVSLV
hide sequence
Ensembl Acc Id:
ENSRNOP00000016328 ⟸ ENSRNOT00000016328
RefSeq Acc Id:
XP_038950731 ⟸ XM_039094803
- Peptide Label:
isoform X1
- UniProtKB:
Q62767 (UniProtKB/Swiss-Prot), G3V7L2 (UniProtKB/TrEMBL), A6IVN4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063131752 ⟸ XM_063275682
- Peptide Label:
isoform X2
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-02-10
Dusp4
dual specificity phosphatase 4
Mkp-2
MAP kinase phosphatase
Symbol and Name updated to reflect Human and Mouse nomenclature
625702 APPROVED
2002-08-07
Mkp-2
MAP kinase phosphatase
Symbol and Name status set to provisional
70820 PROVISIONAL
