Symbol:
Actr2
Name:
actin related protein 2
RGD ID:
1310826
Description:
Enables cytoskeletal protein binding activity. Involved in several processes, including cellular response to trichostatin A; positive regulation of dendritic spine morphogenesis; and response to ethanol. Located in lamellipodium and podosome core. Is active in postsynapse. Orthologous to human ACTR2 (actin related protein 2); PARTICIPATES IN insulin responsive facilitative sugar transporter mediated glucose transport pathway; Rab family mediated signaling pathway; platelet-derived growth factor signaling pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine; 3,4-methylenedioxymethamphetamine.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
actin-like protein 2; actin-related protein 2; ARP2 actin related protein 2 homolog; ARP2 actin-related protein 2 homolog; ARP2 actin-related protein 2 homolog (yeast); LOC289820; MGC95085
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
ACTR2 (actin related protein 2) HGNC
Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
ACTR2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Actr2 (actin related protein 2) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
ACTR2 (actin related protein 2)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Actr2 (actin related protein 2)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
actr2b (actin related protein 2b)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Danio rerio (zebrafish):
actr2a (actin related protein 2a)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
ARP2
Alliance
DIOPT (Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Arp2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
arx-2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
actr2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 14 98,500,119 - 98,535,092 (-) NCBI GRCr8 mRatBN7.2 14 94,296,443 - 94,333,735 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 14 94,296,443 - 94,340,524 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 14 98,639,283 - 98,680,250 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 14 99,879,572 - 99,920,537 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 14 96,346,941 - 96,387,904 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 14 104,338,486 - 104,375,840 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 14 104,340,434 - 104,375,649 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 14 104,072,596 - 104,109,950 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 14 100,848,391 - 100,883,833 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 14 100,867,618 - 100,903,044 (-) NCBI Celera 14 93,318,648 - 93,356,930 (-) NCBI Celera Cytogenetic Map 14 q22 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Actr2 Rat 1,2-dimethylhydrazine multiple interactions ISO Actr2 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of ACTR2 mRNA CTD PMID:22206623 Actr2 Rat 1,2-dimethylhydrazine decreases expression ISO Actr2 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of ACTR2 mRNA CTD PMID:22206623 Actr2 Rat 1,8-cineole multiple interactions ISO Actr2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Rat 17alpha-ethynylestradiol increases expression ISO Actr2 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of ACTR2 mRNA CTD PMID:17942748 Actr2 Rat 17alpha-ethynylestradiol affects expression ISO Actr2 (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of ACTR2 mRNA CTD PMID:17555576 Actr2 Rat 17alpha-ethynylestradiol multiple interactions ISO Actr2 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of ACTR2 mRNA CTD PMID:17942748 Actr2 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Actr2 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of ACTR2 mRNA CTD PMID:17942748 Actr2 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of ACTR2 mRNA CTD PMID:33387578 Actr2 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression EXP 6480464 Tetrachlorodibenzodioxin affects the expression of ACTR2 mRNA CTD PMID:34747641 Actr2 Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of ACTR2 mRNA CTD PMID:32109520 Actr2 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Actr2 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of ACTR2 mRNA CTD PMID:24680724 Actr2 Rat 2,6-dimethoxyphenol multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [Sodium Chloride co-treated with pyrogallol 1 and 3-dimethyl ether] results in decreased expression of and affects the localization of ACTR2 protein CTD PMID:38598786 Actr2 Rat 2-methylcholine affects expression ISO ACTR2 (Homo sapiens) 6480464 beta-methylcholine affects the expression of ACTR2 mRNA CTD PMID:21179406 Actr2 Rat 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine increases expression EXP 6480464 Puromycin Aminonucleoside results in increased expression of ACTR2 mRNA and Puromycin Aminonucleoside results in increased expression of ACTR2 protein CTD PMID:19617259 Actr2 Rat 3,4-methylenedioxymethamphetamine decreases expression EXP 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of ACTR2 mRNA CTD PMID:30071829 Actr2 Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of ACTR2 mRNA CTD PMID:28628672 Actr2 Rat 4,4'-sulfonyldiphenol increases expression ISO Actr2 (Mus musculus) 6480464 bisphenol S results in increased expression of ACTR2 mRNA CTD PMID:39298647 Actr2 Rat 4,4'-sulfonyldiphenol increases expression ISO ACTR2 (Homo sapiens) 6480464 bisphenol S results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Rat actinomycin D multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of ACTR2 protein CTD PMID:38460933 Actr2 Rat aflatoxin B1 increases methylation ISO ACTR2 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of ACTR2 gene CTD PMID:27153756 Actr2 Rat aldehydo-D-glucose multiple interactions ISO Actr2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Rat aldehydo-D-glucose decreases expression ISO Actr2 (Mus musculus) 6480464 Glucose results in decreased expression of ACTR2 protein CTD PMID:31483951 Actr2 Rat all-trans-retinoic acid increases expression ISO ACTR2 (Homo sapiens) 6480464 Tretinoin results in increased expression of ACTR2 mRNA CTD PMID:33167477 Actr2 Rat aluminium oxide multiple interactions ISO Actr2 (Mus musculus) 6480464 [Nanotubes and Carbon co-treated with Aluminum Oxide] results in increased secretion of ACTR2 protein CTD PMID:25598225 Actr2 Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Rat Aroclor 1254 decreases expression ISO Actr2 (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of ACTR2 mRNA CTD PMID:23650126 Actr2 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of ACTR2 mRNA CTD PMID:25181051 more ... Actr2 Rat bisphenol A increases expression ISO ACTR2 (Homo sapiens) 6480464 bisphenol A results in increased expression of ACTR2 protein CTD PMID:37567409 Actr2 Rat bisphenol A decreases expression ISO Actr2 (Mus musculus) 6480464 bisphenol A results in decreased expression of ACTR2 protein CTD PMID:35999755 Actr2 Rat bisphenol A increases expression ISO Actr2 (Mus musculus) 6480464 bisphenol A results in increased expression of ACTR2 mRNA CTD PMID:33221593 Actr2 Rat bisphenol A decreases expression ISO ACTR2 (Homo sapiens) 6480464 bisphenol A results in decreased expression of ACTR2 protein CTD PMID:33376534 Actr2 Rat bisphenol AF increases expression ISO ACTR2 (Homo sapiens) 6480464 bisphenol AF results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Rat Bisphenol B increases expression ISO ACTR2 (Homo sapiens) 6480464 bisphenol B results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Rat bisphenol F multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of ACTR2 mRNA CTD PMID:28628672 Actr2 Rat bisphenol F increases expression ISO ACTR2 (Homo sapiens) 6480464 bisphenol F results in increased expression of ACTR2 protein CTD PMID:34186270 Actr2 Rat cadmium atom decreases expression ISO ACTR2 (Homo sapiens) 6480464 Cadmium results in decreased expression of ACTR2 mRNA CTD PMID:24284285 Actr2 Rat carbon nanotube decreases expression ISO Actr2 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25620056 Actr2 Rat carbon nanotube multiple interactions ISO Actr2 (Mus musculus) 6480464 [Nanotubes and Carbon co-treated with Aluminum Oxide] results in increased secretion of ACTR2 protein CTD PMID:25598225 Actr2 Rat chloropicrin increases expression ISO ACTR2 (Homo sapiens) 6480464 chloropicrin results in increased expression of ACTR2 mRNA CTD PMID:26352163 Actr2 Rat chlorpyrifos decreases expression ISO Actr2 (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of ACTR2 mRNA CTD PMID:37019170 Actr2 Rat cobalt dichloride decreases expression ISO ACTR2 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of ACTR2 mRNA CTD PMID:19376846 Actr2 Rat copper atom multiple interactions ISO Actr2 (Mus musculus) 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in decreased expression of ACTR2 mRNA CTD PMID:15467011 Actr2 Rat copper(0) multiple interactions ISO Actr2 (Mus musculus) 6480464 [ATP7A gene mutant form results in increased abundance of Copper] which results in decreased expression of ACTR2 mRNA CTD PMID:15467011 Actr2 Rat D-glucose multiple interactions ISO Actr2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Rat D-glucose decreases expression ISO Actr2 (Mus musculus) 6480464 Glucose results in decreased expression of ACTR2 protein CTD PMID:31483951 Actr2 Rat dexamethasone multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of ACTR2 mRNA CTD PMID:28628672 Actr2 Rat dextran sulfate decreases expression ISO Actr2 (Mus musculus) 6480464 Dextran Sulfate results in decreased expression of ACTR2 protein CTD PMID:35999755 Actr2 Rat dibutyl phthalate increases expression ISO Actr2 (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of ACTR2 mRNA CTD PMID:21266533 Actr2 Rat dibutyl phthalate increases expression EXP 6480464 Dibutyl Phthalate results in increased expression of ACTR2 mRNA CTD PMID:21266533 Actr2 Rat ethanol decreases expression EXP 6480464 Ethanol results in decreased expression of ACTR2 protein CTD PMID:26185205 Actr2 Rat folic acid multiple interactions ISO Actr2 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of ACTR2 mRNA CTD PMID:22206623 Actr2 Rat fumonisin B1 increases expression ISO Actr2 (Mus musculus) 6480464 fumonisin B1 results in increased expression of ACTR2 mRNA CTD PMID:16221962 Actr2 Rat furfural multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of ACTR2 protein CTD PMID:38598786 Actr2 Rat geldanamycin increases expression ISO ACTR2 (Homo sapiens) 6480464 geldanamycin results in increased expression of ACTR2 mRNA CTD PMID:26705709 Actr2 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of ACTR2 mRNA CTD PMID:22061828 Actr2 Rat glucose multiple interactions ISO Actr2 (Mus musculus) 6480464 Eucalyptol inhibits the reaction [Glucose results in decreased expression of ACTR2 protein] CTD PMID:31483951 Actr2 Rat glucose decreases expression ISO Actr2 (Mus musculus) 6480464 Glucose results in decreased expression of ACTR2 protein CTD PMID:31483951 Actr2 Rat indometacin multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of ACTR2 mRNA CTD PMID:28628672 Actr2 Rat ivermectin decreases expression ISO ACTR2 (Homo sapiens) 6480464 Ivermectin results in decreased expression of ACTR2 protein CTD PMID:32959892 Actr2 Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Rat methotrexate decreases expression ISO ACTR2 (Homo sapiens) 6480464 Methotrexate results in decreased expression of ACTR2 mRNA CTD PMID:25339124 Actr2 Rat N,N-diethyl-m-toluamide multiple interactions EXP 6480464 [Permethrin co-treated with DEET] results in decreased methylation of ACTR2 gene CTD PMID:33148267 Actr2 Rat nickel atom increases expression ISO ACTR2 (Homo sapiens) 6480464 Nickel results in increased expression of ACTR2 mRNA CTD PMID:24768652 and PMID:25583101 Actr2 Rat nitrates multiple interactions ISO Actr2 (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of ACTR2 mRNA CTD PMID:35964746 Actr2 Rat Nutlin-3 multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased secretion of ACTR2 protein CTD PMID:38460933 Actr2 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of ACTR2 mRNA CTD PMID:25729387 Actr2 Rat ozone multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [Air Pollutants results in increased abundance of Ozone] which affects the expression of ACTR2 mRNA CTD PMID:35430440 Actr2 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of ACTR2 mRNA CTD PMID:33387578 Actr2 Rat permethrin multiple interactions EXP 6480464 [Permethrin co-treated with DEET] results in decreased methylation of ACTR2 gene CTD PMID:33148267 Actr2 Rat phenobarbital increases expression EXP 6480464 Phenobarbital results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Rat pirinixic acid increases expression ISO Actr2 (Mus musculus) 6480464 pirinixic acid results in increased expression of ACTR2 mRNA CTD PMID:16221962 Actr2 Rat potassium dichromate decreases expression ISO ACTR2 (Homo sapiens) 6480464 Potassium Dichromate results in decreased expression of ACTR2 protein CTD PMID:23718831 Actr2 Rat propiconazole increases expression EXP 6480464 propiconazole results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Rat resveratrol multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of ACTR2 mRNA CTD PMID:23557933 Actr2 Rat rimonabant multiple interactions ISO Actr2 (Mus musculus) 6480464 Rimonabant inhibits the reaction [Dietary Fats results in increased expression of ACTR2 mRNA] CTD PMID:19030233 Actr2 Rat sodium arsenite decreases expression EXP 6480464 sodium arsenite results in decreased expression of ACTR2 protein CTD PMID:29459688 Actr2 Rat sodium chloride multiple interactions ISO ACTR2 (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of ACTR2 protein more ... CTD PMID:38598786 Actr2 Rat sulfadimethoxine increases expression EXP 6480464 Sulfadimethoxine results in increased expression of ACTR2 mRNA CTD PMID:30047161 Actr2 Rat tamoxifen affects expression ISO Actr2 (Mus musculus) 6480464 Tamoxifen affects the expression of ACTR2 mRNA CTD PMID:17555576 Actr2 Rat tetrachloromethane increases expression ISO Actr2 (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of ACTR2 mRNA CTD PMID:31919559 Actr2 Rat theophylline decreases expression ISO ACTR2 (Homo sapiens) 6480464 Theophylline results in decreased expression of ACTR2 mRNA CTD PMID:16083514 Actr2 Rat thimerosal decreases expression ISO ACTR2 (Homo sapiens) 6480464 Thimerosal results in decreased expression of ACTR2 mRNA CTD PMID:27188386 Actr2 Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of ACTR2 mRNA CTD PMID:34492290 Actr2 Rat thiram decreases expression ISO ACTR2 (Homo sapiens) 6480464 Thiram results in decreased expression of ACTR2 mRNA CTD PMID:38568856 Actr2 Rat titanium dioxide decreases methylation ISO Actr2 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of ACTR2 gene CTD PMID:35295148 Actr2 Rat titanium dioxide increases methylation ISO Actr2 (Mus musculus) 6480464 titanium dioxide results in increased methylation of ACTR2 promoter CTD PMID:35295148 Actr2 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in increased expression of ACTR2 mRNA CTD PMID:25729387 Actr2 Rat trichostatin A increases expression ISO ACTR2 (Homo sapiens) 6480464 trichostatin A results in increased expression of ACTR2 mRNA CTD PMID:24935251 Actr2 Rat trichostatin A decreases expression EXP 6480464 trichostatin A results in decreased expression of ACTR2 protein CTD PMID:12445420 Actr2 Rat uranium atom affects expression ISO ACTR2 (Homo sapiens) 6480464 Uranium affects the expression of ACTR2 mRNA CTD PMID:15672453 Actr2 Rat valproic acid decreases methylation ISO ACTR2 (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of ACTR2 gene CTD PMID:29154799 Actr2 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of ACTR2 mRNA CTD PMID:19015723 Actr2 Rat vincristine increases expression ISO ACTR2 (Homo sapiens) 6480464 Vincristine results in increased expression of ACTR2 mRNA CTD PMID:23649840
Imported Annotations - PID (archival)
1,2-dimethylhydrazine (ISO) 1,8-cineole (ISO) 17alpha-ethynylestradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,6-dimethoxyphenol (ISO) 2-methylcholine (ISO) 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine (EXP) 3,4-methylenedioxymethamphetamine (EXP) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) 6-propyl-2-thiouracil (EXP) actinomycin D (ISO) aflatoxin B1 (ISO) aldehydo-D-glucose (ISO) all-trans-retinoic acid (ISO) aluminium oxide (ISO) amitrole (EXP) Aroclor 1254 (ISO) bisphenol A (EXP,ISO) bisphenol AF (ISO) Bisphenol B (ISO) bisphenol F (ISO) cadmium atom (ISO) carbon nanotube (ISO) chloropicrin (ISO) chlorpyrifos (ISO) cobalt dichloride (ISO) copper atom (ISO) copper(0) (ISO) D-glucose (ISO) dexamethasone (ISO) dextran sulfate (ISO) dibutyl phthalate (EXP,ISO) ethanol (EXP) folic acid (ISO) fumonisin B1 (ISO) furfural (ISO) geldanamycin (ISO) gentamycin (EXP) glucose (ISO) indometacin (ISO) ivermectin (ISO) methimazole (EXP) methotrexate (ISO) N,N-diethyl-m-toluamide (EXP) nickel atom (ISO) nitrates (ISO) Nutlin-3 (ISO) oxaliplatin (EXP) ozone (ISO) paracetamol (EXP) permethrin (EXP) phenobarbital (EXP) pirinixic acid (ISO) potassium dichromate (ISO) propiconazole (EXP) resveratrol (ISO) rimonabant (ISO) sodium arsenite (EXP) sodium chloride (ISO) sulfadimethoxine (EXP) tamoxifen (ISO) tetrachloromethane (ISO) theophylline (ISO) thimerosal (ISO) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) topotecan (EXP) trichostatin A (EXP,ISO) uranium atom (ISO) valproic acid (ISO) vinclozolin (EXP) vincristine (ISO)
Biological Process
actin cytoskeleton organization (IEA,ISO) Arp2/3 complex-mediated actin nucleation (IBA,IEA,ISO,ISS) associative learning (IEP) asymmetric cell division (IEA,ISO) cellular response to trichostatin A (IEP) cellular response to type II interferon (IEA,ISO) cilium assembly (IEA,ISO) cytosolic transport (IEA,ISO) establishment or maintenance of cell polarity (IEA,ISO) meiotic cell cycle (IEA,ISO) meiotic chromosome movement towards spindle pole (IEA,ISO) meiotic cytokinesis (IEA,ISO) positive regulation of dendritic spine morphogenesis (IMP) positive regulation of double-strand break repair via homologous recombination (IEA,ISO,ISS) positive regulation of lamellipodium assembly (IEA,ISO) positive regulation of transcription by RNA polymerase II (IEA,ISO,ISS) regulation of double-strand break repair via nonhomologous end joining (ISO,ISS) response to ethanol (IEP) response to immobilization stress (IEP) spindle localization (IEA,ISO)
Cellular Component
actin cap (IEA,ISO) Arp2/3 protein complex (IBA,IEA,ISO,ISS) cell cortex (IBA,IEA,ISO) cell projection (IEA) cytoplasm (IEA,ISO,ISS) cytoskeleton (IEA) cytosol (IEA) lamellipodium (IDA) nucleus (IEA,ISO,ISS) podosome core (IDA) postsynapse (EXP,IDA) site of double-strand break (IEA,ISO,ISS)
1.
Abl silencing inhibits CAS-mediated process and constriction in resistance arteries.
Anfinogenova Y, etal., Circ Res. 2007 Aug 17;101(4):420-8. Epub 2007 Jul 5.
2.
Phosphorylation of coronin 1B by protein kinase C regulates interaction with Arp2/3 and cell motility.
Cai L, etal., J Biol Chem. 2005 Sep 9;280(36):31913-23. Epub 2005 Jul 18.
3.
F-actin binding is essential for coronin 1B function in vivo.
Cai L, etal., J Cell Sci. 2007 May 15;120(Pt 10):1779-90. Epub 2007 Apr 24.
4.
Arp2/3- and cofilin-coordinated actin dynamics is required for insulin-mediated GLUT4 translocation to the surface of muscle cells.
Chiu TT, etal., Mol Biol Cell. 2010 Oct 15;21(20):3529-39. doi: 10.1091/mbc.E10-04-0316. Epub 2010 Aug 25.
5.
Proteomic analysis of alternative protein tyrosine phosphorylation in 1,2-dichlorovinyl-cysteine-induced cytotoxicity in primary cultured rat renal proximal tubular cells.
de Graauw M, etal., J Pharmacol Exp Ther. 2007 Jul;322(1):89-100. Epub 2007 Apr 18.
6.
N-WASP and cortactin are involved in invadopodium-dependent chemotaxis to EGF in breast tumor cells.
Desmarais V, etal., Cell Motil Cytoskeleton. 2009 Jun;66(6):303-16. doi: 10.1002/cm.20361.
7.
Stress-induced sensitization to cocaine: actin cytoskeleton remodeling within mesocorticolimbic nuclei.
Esparza MA, etal., Eur J Neurosci. 2012 Oct;36(8):3103-17. doi: 10.1111/j.1460-9568.2012.08239.x. Epub 2012 Aug 12.
8.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
9.
Regulation of spine density and morphology by IQGAP1 protein domains.
Jausoro I, etal., PLoS One. 2013;8(2):e56574. doi: 10.1371/journal.pone.0056574. Epub 2013 Feb 18.
10.
Ethanol Attenuates Histiotrophic Nutrition Pathways and Alters the Intracellular Redox Environment and Thiol Proteome during Rat Organogenesis.
Jilek JL, etal., Toxicol Sci. 2015 Oct;147(2):475-89. doi: 10.1093/toxsci/kfv145. Epub 2015 Jul 15.
11.
Phosphorylation of the Arp2/3 complex is necessary to nucleate actin filaments.
LeClaire LL 3rd, etal., J Cell Biol. 2008 Aug 25;182(4):647-54. doi: 10.1083/jcb.200802145.
12.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
13.
Newly identified cytoskeletal components are associated with dynamic changes of podocyte foot processes.
Miao J, etal., Nephrol Dial Transplant. 2009 Nov;24(11):3297-305. doi: 10.1093/ndt/gfp338. Epub 2009 Jul 17.
14.
Involvement of Arp2/3 complex in the process of colorectal carcinogenesis.
Otsubo T, etal., Mod Pathol. 2004 Apr;17(4):461-7.
15.
Semiquantitative proteomic analysis of rat forebrain postsynaptic density fractions by mass spectrometry.
Peng J, etal., J Biol Chem. 2004 May 14;279(20):21003-11. doi: 10.1074/jbc.M400103200. Epub 2004 Mar 12.
16.
PID Annotation Import Pipeline
Pipeline to import Pathway Interaction Database annotations from NCI into RGD
17.
GOA pipeline
RGD automated data pipeline
18.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
19.
Actin filament formation, reorganization and migration are impaired in hepatic stellate cells under influence of trichostatin A, a histone deacetylase inhibitor.
Rombouts K, etal., J Hepatol. 2002 Dec;37(6):788-96.
20.
Regulation of podosome formation, microglial migration and invasion by Ca(2+)-signaling molecules expressed in podosomes.
Siddiqui TA, etal., J Neuroinflammation. 2012 Nov 17;9:250. doi: 10.1186/1742-2094-9-250.
21.
Stimuli associated with the presence or absence of amphetamine regulate cytoskeletal signaling and behavior.
Singer BF, etal., Eur Neuropsychopharmacol. 2016 Oct 6. pii: S0924-977X(16)30835-5. doi: 10.1016/j.euroneuro.2016.09.639.
22.
Relationship between learning and memory deficits and Arp2 expression in the hippocampus in rats with traumatic brain injury.
Xia X, etal., World Neurosurg. 2012 Dec;78(6):689-96. doi: 10.1016/j.wneu.2011.07.042. Epub 2011 Nov 7.
23.
Identification of the shared gene signatures between pulmonary fibrosis and pulmonary hypertension using bioinformatics analysis.
Zhao H, etal., Front Immunol. 2023 Sep 4;14:1197752. doi: 10.3389/fimmu.2023.1197752. eCollection 2023.
Actr2 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 14 98,500,119 - 98,535,092 (-) NCBI GRCr8 mRatBN7.2 14 94,296,443 - 94,333,735 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 14 94,296,443 - 94,340,524 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 14 98,639,283 - 98,680,250 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 14 99,879,572 - 99,920,537 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 14 96,346,941 - 96,387,904 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 14 104,338,486 - 104,375,840 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 14 104,340,434 - 104,375,649 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 14 104,072,596 - 104,109,950 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 14 100,848,391 - 100,883,833 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 14 100,867,618 - 100,903,044 (-) NCBI Celera 14 93,318,648 - 93,356,930 (-) NCBI Celera Cytogenetic Map 14 q22 NCBI
ACTR2 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 65,227,831 - 65,271,253 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 65,227,788 - 65,271,253 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 65,454,965 - 65,498,387 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 65,308,406 - 65,351,891 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 65,366,552 - 65,410,036 NCBI Celera 2 65,301,566 - 65,345,120 (+) NCBI Celera Cytogenetic Map 2 p14 NCBI HuRef 2 65,189,074 - 65,232,629 (+) NCBI HuRef CHM1_1 2 65,386,192 - 65,429,751 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 65,237,506 - 65,280,921 (+) NCBI T2T-CHM13v2.0
Actr2 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 20,012,304 - 20,062,951 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 20,012,304 - 20,062,913 (-) Ensembl GRCm39 Ensembl GRCm38 11 20,062,304 - 20,112,951 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 20,062,304 - 20,112,913 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 19,962,307 - 20,012,954 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 19,962,307 - 20,012,915 (-) NCBI MGSCv36 mm8 Celera 11 22,204,487 - 22,259,500 (-) NCBI Celera Cytogenetic Map 11 A3.1 NCBI cM Map 11 12.88 NCBI
Actr2 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955424 19,293,949 - 19,333,170 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955424 19,293,949 - 19,333,170 (-) NCBI ChiLan1.0 ChiLan1.0
ACTR2 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 12 61,131,388 - 61,179,542 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2A 61,135,339 - 61,180,922 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2A 65,289,675 - 65,333,219 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2A 66,412,786 - 66,456,857 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2A 66,413,011 - 66,456,857 (+) Ensembl panpan1.1 panPan2
ACTR2 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 10 64,696,068 - 64,733,027 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 10 64,696,111 - 64,730,553 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 10 64,582,083 - 64,619,025 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 10 65,705,072 - 65,742,073 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 10 65,705,085 - 65,742,062 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 10 65,383,665 - 65,420,656 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 10 65,691,644 - 65,728,572 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 10 65,986,809 - 66,023,812 (+) NCBI UU_Cfam_GSD_1.0
Actr2 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024406292 18,549,870 - 18,591,068 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936491 9,979,427 - 10,022,043 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936491 9,980,228 - 10,021,417 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
ACTR2 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 3 76,691,280 - 76,729,252 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 3 76,691,275 - 76,729,269 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 3 80,487,347 - 80,525,297 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
ACTR2 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 14 41,740,432 - 41,780,045 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 14 41,739,968 - 41,779,964 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666045 70,111,314 - 70,152,221 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Actr2
.
Predicted Target Of
Count of predictions: 37 Count of miRNA genes: 33 Interacting mature miRNAs: 35 Transcripts: ENSRNOT00000006607 Prediction methods: Microtar, Rnahybrid, Targetscan Result types: miRGate_prediction
1582201 Sffal2 Serum free fatty acids level QTL 2 4 0.0002 blood free fatty acid amount (VT:0001553) serum free fatty acids level (CMO:0000547) 14 92553886 95876975 Rat 631213 Bw60 Body weight QTL60 4.51 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 14 79950921 95876975 Rat 9590294 Uminl4 Urine mineral level QTL 4 5.66 0.001 urine mineral amount (VT:0015086) urine electrolyte level (CMO:0000593) 14 55624247 100624247 Rat 2300197 Scl59 Serum cholesterol level QTL 59 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 14 55147478 100147478 Rat 631523 Pia13 Pristane induced arthritis QTL 13 3.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 14 40793460 98037301 Rat 1582259 Gluco23 Glucose level QTL 23 3.1 0.0008 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 14 70053989 104886043 Rat 634328 Hc5 Hypercalciuria QTL 5 2.3 urine calcium amount (VT:0002985) urine calcium excretion rate (CMO:0000763) 14 58184885 103184885 Rat 1582250 Gluco26 Glucose level QTL 26 3.3 0.0009 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 14 73415323 95876975 Rat 2317879 Alcrsp27 Alcohol response QTL 27 3.3 0.63 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 14 56631369 101631369 Rat 1641900 Alcrsp11 Alcohol response QTL 11 alcohol metabolism trait (VT:0015089) blood ethanol level (CMO:0000535) 14 70053989 104886043 Rat 4889951 Bss92 Bone structure and strength QTL 92 3.9 tibia area (VT:1000281) tibia-fibula cortical bone total cross-sectional area (CMO:0001721) 14 82057471 95876975 Rat 631839 Niddm37 Non-insulin dependent diabetes mellitus QTL 37 3.37 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 14 11030622 95876975 Rat 9589034 Epfw11 Epididymal fat weight QTL 11 6 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 14 55624247 100624247 Rat 1300136 Rf22 Renal function QTL 22 3.9 renal blood flow trait (VT:2000006) absolute change in renal vascular resistance (CMO:0001900) 14 42262529 95023211 Rat 1549834 Scl45 Serum cholesterol level QTL 45 5.8 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 14 50023211 95023211 Rat
RH144671
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 14 94,303,260 - 94,303,437 (+) MAPPER mRatBN7.2 Rnor_6.0 14 104,345,231 - 104,345,407 NCBI Rnor6.0 Rnor_5.0 14 104,079,341 - 104,079,517 UniSTS Rnor5.0 RGSC_v3.4 14 100,853,576 - 100,853,752 UniSTS RGSC3.4 Celera 14 93,323,148 - 93,323,324 UniSTS RH 3.4 Map 14 745.89 UniSTS Cytogenetic Map 14 q22 UniSTS
RH139107
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 14 94,298,334 - 94,298,495 (+) MAPPER mRatBN7.2 Rnor_6.0 14 104,340,379 - 104,340,539 NCBI Rnor6.0 Rnor_5.0 14 104,074,489 - 104,074,649 UniSTS Rnor5.0 RGSC_v3.4 14 100,847,987 - 100,848,147 UniSTS RGSC3.4 Celera 14 93,318,244 - 93,318,404 UniSTS Cytogenetic Map 14 q22 UniSTS
AA818437
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 14 94,298,988 - 94,299,078 (+) MAPPER mRatBN7.2 Rnor_6.0 14 104,341,033 - 104,341,122 NCBI Rnor6.0 Rnor_5.0 14 104,075,143 - 104,075,232 UniSTS Rnor5.0 RGSC_v3.4 14 100,848,641 - 100,848,730 UniSTS RGSC3.4 Celera 14 93,318,898 - 93,318,987 UniSTS RH 3.4 Map 14 746.28 UniSTS Cytogenetic Map 14 q22 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000006607 ⟹ ENSRNOP00000006607
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 14 94,298,758 - 94,333,664 (-) Ensembl Rnor_6.0 Ensembl 14 104,340,434 - 104,375,649 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000101111 ⟹ ENSRNOP00000081949
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 14 94,321,952 - 94,340,524 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000109487 ⟹ ENSRNOP00000083980
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 14 94,296,443 - 94,333,718 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000111423 ⟹ ENSRNOP00000081915
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 14 94,296,919 - 94,333,719 (-) Ensembl
RefSeq Acc Id:
NM_001009268 ⟹ NP_001009268
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 14 98,500,119 - 98,535,092 (-) NCBI mRatBN7.2 14 94,298,739 - 94,333,715 (-) NCBI Rnor_6.0 14 104,340,783 - 104,375,648 (-) NCBI Rnor_5.0 14 104,072,596 - 104,109,950 (-) NCBI RGSC_v3.4 14 100,848,391 - 100,883,833 (-) RGD Celera 14 93,318,648 - 93,356,930 (-) RGD
Sequence:
CGAGGGCGGGGCCGTGTGGAGGAGGAAGCGGGCCAGGCCGGGCGGCGGCTCACCAGGGCGAACCATGGACAGCCAGGGCAGGAAGGTGGTGGTGTGCGACAACGGCACTGGGTTTGTGAAGTGTGGAT
hide sequence
RefSeq Acc Id:
NP_001009268 ⟸ NM_001009268
- UniProtKB:
Q5M7U6 (UniProtKB/Swiss-Prot), A6JQ13 (UniProtKB/TrEMBL), A0A8I6GBC3 (UniProtKB/TrEMBL)
- Sequence:
MDSQGRKVVVCDNGTGFVKCGYAGSNFPEHIFPALVGRPIIRSTTKVGNIEIKDLMVGDEASELRSMLEVNYPMENGIVRNWDDMKHLWDYTFGPEKLNIDTRSCKILLTEPPMNPTKNREKIVEVMF
hide sequence
Ensembl Acc Id:
ENSRNOP00000006607 ⟸ ENSRNOT00000006607
Ensembl Acc Id:
ENSRNOP00000083980 ⟸ ENSRNOT00000109487
Ensembl Acc Id:
ENSRNOP00000081949 ⟸ ENSRNOT00000101111
Ensembl Acc Id:
ENSRNOP00000081915 ⟸ ENSRNOT00000111423
RGD ID: 13699507 Promoter ID: EPDNEW_R10031 Type: initiation region Name: Actr2_1 Description: ARP2 actin related protein 2 homolog SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 14 104,375,614 - 104,375,674 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2019-03-25
Actr2
actin related protein 2
Actr2
ARP2 actin related protein 2 homolog
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2016-07-21
Actr2
ARP2 actin related protein 2 homolog
Actr2
ARP2 actin-related protein 2 homolog (yeast)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-12-06
Actr2
ARP2 actin-related protein 2 homolog (yeast)
Actr2_predicted
ARP2 actin-related protein 2 homolog (yeast) (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Actr2_predicted
ARP2 actin-related protein 2 homolog (yeast) (predicted)
Symbol and Name status set to approved
70820 APPROVED
