Symbol:
Ppy
Name:
pancreatic polypeptide
RGD ID:
3385
Description:
Predicted to enable neuropeptide Y receptor binding activity and neuropeptide hormone activity. Predicted to be involved in feeding behavior and neuropeptide signaling pathway. Predicted to be located in cytoplasm. Predicted to be active in extracellular space. Orthologous to human PPY (pancreatic polypeptide); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; ammonium chloride; bisphenol A.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
pancreatic polypeptide prohormone; pancreatic prohormone; PP
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Is Marker For:
QTLs:
Bp45
Bw21
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 87,554,941 - 87,556,236 (-) NCBI GRCr8 mRatBN7.2 10 87,054,747 - 87,056,044 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 87,054,756 - 87,055,455 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 92,084,611 - 92,085,906 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 91,556,506 - 91,557,781 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 86,949,824 - 86,951,097 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 90,041,582 - 90,043,316 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 90,041,591 - 90,042,877 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 89,831,063 - 89,832,358 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 91,167,958 - 91,169,253 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 91,182,327 - 91,183,623 (-) NCBI Celera 10 85,772,353 - 85,773,648 (-) NCBI Celera Cytogenetic Map 10 q32.1 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Ppy Rat 17alpha-ethynylestradiol increases expression ISO Ppy (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of PPY mRNA CTD PMID:17942748 Ppy Rat 17alpha-ethynylestradiol multiple interactions ISO Ppy (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PPY mRNA CTD PMID:17942748 Ppy Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Ppy (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PPY mRNA CTD PMID:17942748 Ppy Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of PPY mRNA CTD PMID:21215274 Ppy Rat 3,3',4,4',5-pentachlorobiphenyl increases expression ISO Ppy (Mus musculus) 6480464 3 more ... CTD PMID:30312631 Ppy Rat 3,3',4,4',5-pentachlorobiphenyl multiple interactions ISO Ppy (Mus musculus) 6480464 3 more ... CTD PMID:30312631 Ppy Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO PPY (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of PPY mRNA CTD PMID:28628672 Ppy Rat actinomycin D multiple interactions ISO PPY (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of PPY mRNA CTD PMID:38460933 Ppy Rat aflatoxin B1 increases methylation ISO PPY (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of PPY promoter CTD PMID:30157460 Ppy Rat all-trans-retinol multiple interactions ISO Ppy (Mus musculus) 6480464 [Vitamin A co-treated with INHBA protein] results in increased expression of PPY mRNA CTD PMID:17244017 Ppy Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of PPY mRNA CTD PMID:16483693 Ppy Rat Azoxymethane multiple interactions ISO Ppy (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PPY mRNA CTD PMID:29950665 Ppy Rat benzo[a]pyrene affects methylation ISO PPY (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PPY exon CTD PMID:27901495 Ppy Rat benzo[a]pyrene increases methylation ISO PPY (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of PPY promoter CTD PMID:27901495 Ppy Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Ppy (Mus musculus) 6480464 [Streptozocin co-treated with Dietary Fats co-treated with Diethylhexyl Phthalate] results in increased expression of PPY mRNA CTD PMID:33484791 Ppy Rat bis(2-ethylhexyl) phthalate increases expression ISO PPY (Homo sapiens) 6480464 Diethylhexyl Phthalate results in increased expression of PPY mRNA CTD PMID:31163220 Ppy Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PPY mRNA CTD PMID:25181051 Ppy Rat bisphenol A increases methylation ISO Ppy (Mus musculus) 6480464 bisphenol A results in increased methylation of PPY promoter CTD PMID:27312807 Ppy Rat bisphenol A multiple interactions ISO PPY (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of PPY mRNA CTD PMID:28628672 Ppy Rat carbon nanotube increases expression ISO Ppy (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Ppy Rat chlorpyrifos multiple interactions EXP 6480464 Dietary Fats inhibits the reaction [Chlorpyrifos results in increased secretion of PPY protein] CTD PMID:31400786 Ppy Rat chlorpyrifos increases expression ISO Ppy (Mus musculus) 6480464 Chlorpyrifos results in increased expression of PPY mRNA CTD PMID:37019170 Ppy Rat chlorpyrifos increases secretion EXP 6480464 Chlorpyrifos results in increased secretion of PPY protein CTD PMID:31400786 Ppy Rat cisplatin increases expression ISO PPY (Homo sapiens) 6480464 Cisplatin results in increased expression of PPY mRNA CTD PMID:27392435 Ppy Rat cisplatin multiple interactions ISO PPY (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of PPY mRNA CTD PMID:27392435 Ppy Rat clofibrate multiple interactions ISO Ppy (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of PPY mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of PPY mRNA] CTD PMID:17585979 Ppy Rat copper(II) sulfate increases expression ISO PPY (Homo sapiens) 6480464 Copper Sulfate results in increased expression of PPY mRNA CTD PMID:19549813 Ppy Rat dexamethasone multiple interactions ISO PPY (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of PPY mRNA CTD PMID:28628672 Ppy Rat dextran sulfate multiple interactions ISO Ppy (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PPY mRNA CTD PMID:29950665 Ppy Rat ethyl methanesulfonate increases expression ISO PPY (Homo sapiens) 6480464 Ethyl Methanesulfonate results in increased expression of PPY mRNA CTD PMID:23649840 Ppy Rat indometacin multiple interactions ISO PPY (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of PPY mRNA CTD PMID:28628672 Ppy Rat methyl methanesulfonate increases expression ISO PPY (Homo sapiens) 6480464 Methyl Methanesulfonate results in increased expression of PPY mRNA CTD PMID:23649840 Ppy Rat Nutlin-3 multiple interactions ISO PPY (Homo sapiens) 6480464 [Dactinomycin co-treated with nutlin 3] results in increased expression of PPY mRNA CTD PMID:38460933 Ppy Rat orlistat multiple interactions ISO PPY (Homo sapiens) 6480464 orlistat inhibits the reaction [Triglycerides results in increased secretion of PPY protein] CTD PMID:15998659 Ppy Rat ozone decreases expression EXP 6480464 Ozone results in decreased expression of PPY mRNA CTD PMID:26667333 Ppy Rat paracetamol multiple interactions ISO Ppy (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of PPY mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of PPY mRNA] CTD PMID:17585979 Ppy Rat sodium arsenite increases expression ISO PPY (Homo sapiens) 6480464 sodium arsenite results in increased expression of PPY mRNA CTD PMID:38568856 Ppy Rat streptozocin multiple interactions ISO Ppy (Mus musculus) 6480464 [Streptozocin co-treated with Dietary Fats co-treated with Diethylhexyl Phthalate] results in increased expression of PPY mRNA CTD PMID:33484791 Ppy Rat titanium dioxide increases expression ISO Ppy (Mus musculus) 6480464 titanium dioxide results in increased expression of PPY mRNA CTD PMID:27760801 Ppy Rat titanium dioxide multiple interactions ISO Ppy (Mus musculus) 6480464 [titanium dioxide co-treated with Azoxymethane co-treated with Dextran Sulfate] results in decreased expression of PPY mRNA CTD PMID:29950665 Ppy Rat triptonide increases expression ISO Ppy (Mus musculus) 6480464 triptonide results in increased expression of PPY mRNA CTD PMID:33045310 Ppy Rat valproic acid increases methylation ISO PPY (Homo sapiens) 6480464 Valproic Acid results in increased methylation of PPY gene CTD PMID:29154799
17alpha-ethynylestradiol (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) actinomycin D (ISO) aflatoxin B1 (ISO) all-trans-retinol (ISO) ammonium chloride (EXP) Azoxymethane (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) carbon nanotube (ISO) chlorpyrifos (EXP,ISO) cisplatin (ISO) clofibrate (ISO) copper(II) sulfate (ISO) dexamethasone (ISO) dextran sulfate (ISO) ethyl methanesulfonate (ISO) indometacin (ISO) methyl methanesulfonate (ISO) Nutlin-3 (ISO) orlistat (ISO) ozone (EXP) paracetamol (ISO) sodium arsenite (ISO) streptozocin (ISO) titanium dioxide (ISO) triptonide (ISO) valproic acid (ISO)
1.
Locus for the inducible, but not a constitutive, nitric oxide synthase cosegregates with blood pressure in the Dahl salt-sensitive rat.
Deng AY and Rapp JP, J Clin Invest 1995 May;95(5):2170-7
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
4.
Different splice site utilization generates diversity between the rat and human pancreatic polypeptide precursors.
Kopin AS, etal., Arch Biochem Biophys 1988 Dec;267(2):742-8.
5.
Novel quantitative trait loci for blood pressure and related traits on rat chromosomes 1, 10, and 18.
Kovacs P, etal., Biochem Biophys Res Commun 1997 Jun 18;235(2):343-8
6.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
7.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
8.
GOA pipeline
RGD automated data pipeline
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
10.
Comprehensive gene review and curation
RGD comprehensive gene curation
11.
Tentative Sequence Identification Numbers
Tentative Sequence Data IDs. TIGR Gene Index, Rat Data
12.
Mosaic evolution of prepropancreatic polypeptide.
Yamamoto H, etal., J Biol Chem 1986 May 15;261(14):6156-9.
13.
Mosaic evolution of prepropancreatic polypeptide. II. Structural conservation and divergence in pancreatic polypeptide gene.
Yonekura H, etal., J Biol Chem 1988 Feb 25;263(6):2990-7.
Ppy Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 10 87,554,941 - 87,556,236 (-) NCBI GRCr8 mRatBN7.2 10 87,054,747 - 87,056,044 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 10 87,054,756 - 87,055,455 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 10 92,084,611 - 92,085,906 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 10 91,556,506 - 91,557,781 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 10 86,949,824 - 86,951,097 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 10 90,041,582 - 90,043,316 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 10 90,041,591 - 90,042,877 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 10 89,831,063 - 89,832,358 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 10 91,167,958 - 91,169,253 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 10 91,182,327 - 91,183,623 (-) NCBI Celera 10 85,772,353 - 85,773,648 (-) NCBI Celera Cytogenetic Map 10 q32.1 NCBI
PPY Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 17 43,940,804 - 43,944,215 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 17 43,940,804 - 43,942,476 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 17 42,018,172 - 42,019,844 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 17 39,373,698 - 39,375,359 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 17 39,373,698 - 39,374,548 NCBI Celera 17 38,726,213 - 38,727,874 (-) NCBI Celera Cytogenetic Map 17 q21.31 NCBI HuRef 17 37,782,442 - 37,784,103 (-) NCBI HuRef CHM1_1 17 42,253,758 - 42,255,419 (-) NCBI CHM1_1 T2T-CHM13v2.0 17 44,793,351 - 44,796,763 (-) NCBI T2T-CHM13v2.0
Ppy Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 11 101,990,757 - 101,992,145 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 11 101,990,756 - 101,992,145 (-) Ensembl GRCm39 Ensembl GRCm38 11 102,099,931 - 102,101,319 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 11 102,099,930 - 102,101,319 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 11 101,961,245 - 101,962,614 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 11 101,916,021 - 101,917,390 (-) NCBI MGSCv36 mm8 Celera 11 113,805,823 - 113,807,218 (-) NCBI Celera Cytogenetic Map 11 D NCBI cM Map 11 65.48 NCBI
Ppy Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955451 17,155,876 - 17,156,214 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955451 17,155,681 - 17,156,829 (-) NCBI ChiLan1.0 ChiLan1.0
PPY Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 19 20,963,508 - 20,965,182 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 17 22,927,788 - 22,929,460 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 17 13,452,839 - 13,454,513 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 17 13,619,132 - 13,620,788 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 17 13,619,936 - 13,620,788 (+) Ensembl panpan1.1 panPan2
PPY Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 9 19,394,185 - 19,395,750 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 9 19,394,183 - 19,395,750 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 9 18,784,564 - 18,785,316 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 9 20,089,261 - 20,090,853 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 9 20,090,101 - 20,090,853 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 9 18,943,380 - 18,944,132 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 9 19,126,341 - 19,127,093 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 9 19,271,259 - 19,272,011 (+) NCBI UU_Cfam_GSD_1.0
Ppy
PPY Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 12 19,217,806 - 19,218,559 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 12 19,217,649 - 19,218,680 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 12 19,451,675 - 19,455,138 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PPY Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 16 62,450,284 - 62,453,995 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 16 62,453,141 - 62,453,871 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666077 33,225,253 - 33,228,638 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Ppy
.
Predicted Target Of
Count of predictions: 112 Count of miRNA genes: 97 Interacting mature miRNAs: 105 Transcripts: ENSRNOT00000028318 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1549846 Scl47 Serum cholesterol level QTL 47 3.6 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 50574707 95574707 Rat 1298069 Bp168 Blood pressure QTL 168 5.5 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 10 26521957 98003205 Rat 61449 Ciaa2 CIA Autoantibody QTL 2 7.1 blood autoantibody amount (VT:0003725) calculated serum anti-type 2 collagen antibody titer (CMO:0001279) 10 63221094 107211142 Rat 631555 Bp134 Blood pressure QTL 134 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 80515287 91230079 Rat 61325 Aia5 Adjuvant induced arthritis QTL 5 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1298078 Stresp5 Stress response QTL 5 2.99 0.00025 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 10 42045676 104670812 Rat 1549831 Bss6 Bone structure and strength QTL 6 4 lumbar vertebra strength trait (VT:0010574) vertebra ultimate force (CMO:0001678) 10 57576521 102576521 Rat 70164 Bw21 Body weight QTL 21 4.36 0.00005 body mass (VT:0001259) body weight (CMO:0000012) 10 53797494 98952626 Rat 4889948 Bss91 Bone structure and strength QTL 91 4 tibia area (VT:1000281) tibia midshaft total cross-sectional area (CMO:0001715) 10 82564856 92369470 Rat 2298548 Neuinf7 Neuroinflammation QTL 7 3.4 nervous system integrity trait (VT:0010566) spinal cord RT1-B protein level (CMO:0002132) 10 72224939 107211142 Rat 1579919 Bp281 Blood pressure QTL 281 0.01 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 74372084 94965338 Rat 1302404 Cia27 Collagen induced arthritis QTL 27 2.6 0.0045 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 10 76452683 107211142 Rat 1300107 Rf18 Renal function QTL 18 3.41 urine output (VT:0003620) timed urine volume (CMO:0000260) 10 78775516 98279596 Rat 8694173 Bw149 Body weight QTL 149 4.38 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 10 44441699 89441699 Rat 2300218 Hpcl2 Hepatic cholesterol level QTL 2 liver cholesterol amount (VT:0010498) liver cholesterol level (CMO:0001597) 10 45029650 95600334 Rat 2317754 Glom25 Glomerulus QTL 25 3.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 82685200 107211142 Rat 1554317 Bmd4 Bone mineral density QTL 4 9.4 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 10 19816042 99406971 Rat 70171 Cari1 Carrageenan-induced inflammation QTL 1 4.9 0.0005 hypodermis integrity trait (VT:0010550) inflammatory exudate volume (CMO:0001429) 10 53797385 107211142 Rat 10450495 Bp383 Blood pressure QTL 383 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 94965338 Rat 61354 Pia10 Pristane induced arthritis QTL 10 0.01 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 2292617 Ept18 Estrogen-induced pituitary tumorigenesis QTL 18 3.9 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 10 73453136 96120911 Rat 2301967 Cm73 Cardiac mass QTL 73 4.55 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 10 14487011 89062041 Rat 2313103 Bss80 Bone structure and strength QTL 80 2 0.0001 tibia strength trait (VT:1000284) tibia midshaft endosteal cross-sectional area (CMO:0001716) 10 62057807 107057807 Rat 2293646 Bss25 Bone structure and strength QTL 25 10.96 0.0001 femur morphology trait (VT:0000559) femur cross-sectional area (CMO:0001661) 10 69738412 107211142 Rat 2303118 Mamtr7 Mammary tumor resistance QTL 7 0.003 mammary gland integrity trait (VT:0010552) mammary tumor growth rate (CMO:0000344) 10 9658275 104670812 Rat 70188 BpQTLcluster1 Blood pressure QTL cluster 1 4.864 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 42323132 87323132 Rat 2300172 Bmd57 Bone mineral density QTL 57 9.8 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 10 69738412 107211142 Rat 70193 Mcs7 Mammary carcinoma susceptibility QTL 7 2.38 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 10 72224939 107211142 Rat 2313105 Bss79 Bone structure and strength QTL 79 1.8 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 10 62057807 107057807 Rat 9589030 Epfw9 Epididymal fat weight QTL 9 19.24 0.001 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 10 44441699 89441699 Rat 1357344 Bp249 Blood pressure QTL 249 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 66743655 98003205 Rat 2316949 Gluco60 Glucose level QTL 60 3.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 10 14487011 107057807 Rat 70198 BpQTLcluster9 Blood pressure QTL cluster 9 2.94 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 42323132 87323132 Rat 2306970 Anxrr22 Anxiety related response QTL 22 5.95 fear/anxiety-related behavior trait (VT:1000241) number of periods of voluntary immobility (CMO:0001045) 10 61345276 98211570 Rat 1359017 Hrtrt21 Heart rate QTL 21 2.4 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 10 51772940 96772940 Rat 2293663 Bss33 Bone structure and strength QTL 33 9.34 0.0001 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 10 69738412 107211142 Rat 7387312 Bw125 Body weight QTL 125 3 0.0047 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight (CMO:0000356) 10 64890616 107211142 Rat 2312672 Insul15 Insulin level QTL 15 0.01 blood insulin amount (VT:0001560) serum insulin level (CMO:0000358) 10 57134272 102134272 Rat 6893357 Bw102 Body weight QTL 102 0.5 0.36 body mass (VT:0001259) body weight (CMO:0000012) 10 80515287 101325465 Rat 2317029 Aia19 Adjuvant induced arthritis QTL 19 2.98 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 10 66978955 107211142 Rat 2303589 Bw87 Body weight QTL 87 2 body mass (VT:0001259) body weight (CMO:0000012) 10 81285008 107211142 Rat 724556 Pur2 Proteinuria QTL 2 5.5 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 10 22427500 90627625 Rat 2306793 Ean5 Experimental allergic neuritis QTL 5 4.7 nervous system integrity trait (VT:0010566) IFNG-secreting splenocyte count (CMO:0002122) 10 72552416 93995749 Rat 61387 Bp1 Blood pressure QTL 1 5.1 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 51770177 107211142 Rat 2306792 Ean4 Experimental allergic neuritis QTL 4 4 nervous system integrity trait (VT:0010566) IFNG-secreting splenocyte count (CMO:0002122) 10 84022321 93995963 Rat 2317039 Aia6 Adjuvant induced arthritis QTL 6 4.31 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 10 66978955 107211142 Rat 61396 Bp9 Blood pressure QTL 9 4.8 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68420376 107211142 Rat 1358915 Stresp7 Stress response QTL 7 3.52 blood norepinephrine amount (VT:0005663) plasma norepinephrine level (CMO:0001010) 10 78899655 87307728 Rat 1331791 Cm31 Cardiac mass QTL 31 3.84606 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 29299504 107211142 Rat 70364 Bp72 Blood pressure QTL 72 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 51121100 96121100 Rat 10450498 Bp384 Blood pressure QTL 384 0.002 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 67750049 107211142 Rat 4889492 Pancm2 Pancreatic morphology QTL 2 3.2 pancreatic beta cell morphology trait (VT:0005217) ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814) 10 76748906 107211142 Rat 6893366 Bw106 Body weight QTL 106 0.3 0.47 body mass (VT:0001259) body weight (CMO:0000012) 10 70199100 107211142 Rat 2293698 Bss43 Bone structure and strength QTL 43 5.33 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra cross-sectional area (CMO:0001689) 10 59209888 104209888 Rat 631530 Tls3 T-lymphoma susceptibility QTL 3 0 0.0001 thymus integrity trait (VT:0010555) percentage of study population developing T-cell lymphomas during a period of time (CMO:0001911) 10 51774612 95600334 Rat 1354608 Cm33 Cardiac mass QTL 33 2.8 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 10 54809292 99809292 Rat 1558643 Cm44 Cardiac mass QTL 44 4.8 0.0000368 heart mass (VT:0007028) heart wet weight (CMO:0000069) 10 61345276 99703528 Rat 631535 Cm51 Cardiac mass QTL 51 3 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 10 51786282 91669536 Rat 631267 Cia20 Collagen induced arthritis QTL 20 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 23444813 104060283 Rat 1576308 Schws1 Schwannoma susceptibility QTL 1 0.0041 nervous system integrity trait (VT:0010566) percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017) 10 40035094 102359817 Rat 631269 Cia22 Collagen induced arthritis QTL 22 8.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 631268 Cia21 Collagen induced arthritis QTL 21 3.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 14487011 104060283 Rat 631270 Cia23 Collagen induced arthritis QTL 23 3.9 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 40035094 104060283 Rat 7411614 Foco18 Food consumption QTL 18 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 10 44441699 89441699 Rat 6893336 Cm75 Cardiac mass QTL 75 0.1 0.87 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 10 61345276 99703528 Rat 631547 Bp87 Blood pressure QTL 87 4.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 47369470 92369470 Rat 61427 Cia16 Collagen induced arthritis QTL 16 3.2 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 6357896 96121100 Rat 12880055 Am11 Aortic mass QTL 11 0.004 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 10 84007272 95933025 Rat 2292438 Bp311 Blood pressure QTL 311 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 10 76246085 107211142 Rat 2312662 Slep8 Serum leptin concentration QTL 8 0.05 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 10 57134272 102134272 Rat 2301398 Kidm38 Kidney mass QTL 38 0.002 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 10 84007272 95933025 Rat 1600367 Mcs15 Mammary carcinoma susceptibility QTL 15 4.5 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 10 85565469 103884409 Rat 1358188 Ept9 Estrogen-induced pituitary tumorigenesis QTL 9 3.9 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 10 73453136 96120911 Rat 631537 Oia4 Oil induced arthritis QTL 4 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 75631887 87055282 Rat 631538 Oia5 Oil induced arthritis QTL 5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 10 87055121 107211142 Rat 1642980 Bp300 Blood pressure QTL 300 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 68383129 107211142 Rat 631542 Bp82 Blood pressure QTL 82 6.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 10 26521957 98952741 Rat 2312668 Scl65 Serum cholesterol level QTL 65 0.001 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 10 57134272 102134272 Rat
D10Wox17
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 87,055,121 - 87,055,282 (+) MAPPER mRatBN7.2 Rnor_6.0 10 90,041,957 - 90,042,115 NCBI Rnor6.0 Rnor_5.0 10 89,831,438 - 89,831,596 UniSTS Rnor5.0 RGSC_v3.4 10 91,168,332 - 91,168,491 RGD RGSC3.4 RGSC_v3.4 10 91,168,333 - 91,168,491 UniSTS RGSC3.4 RGSC_v3.1 10 91,182,702 - 91,182,861 RGD Celera 10 85,772,728 - 85,772,886 UniSTS RH 3.4 Map 10 887.4 UniSTS RH 3.4 Map 10 887.4 RGD RH 2.0 Map 10 991.0 RGD Cytogenetic Map 10 q32.1 UniSTS
D10Arb15
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 10 87,555,254 - 87,555,512 (+) Marker Load Pipeline mRatBN7.2 10 87,055,060 - 87,055,320 (+) MAPPER mRatBN7.2 Rnor_6.0 10 90,041,896 - 90,042,153 NCBI Rnor6.0 Rnor_5.0 10 89,831,377 - 89,831,634 UniSTS Rnor5.0 RGSC_v3.4 10 91,168,271 - 91,168,529 RGD RGSC3.4 RGSC_v3.4 10 91,168,272 - 91,168,529 UniSTS RGSC3.4 RGSC_v3.1 10 91,182,641 - 91,182,899 RGD Celera 10 85,772,667 - 85,772,924 UniSTS Cytogenetic Map 10 q32.1 UniSTS
D10Hmgc2
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 87,055,108 - 87,055,287 (+) MAPPER mRatBN7.2 Rnor_6.0 10 90,041,944 - 90,042,120 NCBI Rnor6.0 Rnor_5.0 10 89,831,425 - 89,831,601 UniSTS Rnor5.0 RGSC_v3.4 10 91,166,191 - 91,170,740 RGD RGSC3.4 RGSC_v3.4 10 91,168,320 - 91,168,496 UniSTS RGSC3.4 Celera 10 85,772,715 - 85,772,891 UniSTS RH 3.4 Map 10 880.2 UniSTS RH 3.4 Map 10 880.2 RGD Cytogenetic Map 10 q32.1 UniSTS
RH94822
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 87,055,426 - 87,055,637 (+) MAPPER mRatBN7.2 Rnor_6.0 10 90,042,260 - 90,042,470 NCBI Rnor6.0 Rnor_5.0 10 89,831,741 - 89,831,951 UniSTS Rnor5.0 RGSC_v3.4 10 91,168,636 - 91,168,846 UniSTS RGSC3.4 Celera 10 85,773,031 - 85,773,241 UniSTS Cytogenetic Map 10 q32.1 UniSTS
Ppy
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 10 87,055,267 - 87,055,458 (+) MAPPER mRatBN7.2 Rnor_6.0 10 90,042,101 - 90,042,291 NCBI Rnor6.0 Rnor_5.0 10 89,831,582 - 89,831,772 UniSTS Rnor5.0 RGSC_v3.4 10 91,168,477 - 91,168,667 UniSTS RGSC3.4 Celera 10 85,772,872 - 85,773,062 UniSTS Cytogenetic Map 10 q32.1 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
8
15
7
32
48
22
9
22
1
69
25
6
14
15
26
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000028318 ⟹ ENSRNOP00000028318
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 10 87,054,756 - 87,055,455 (-) Ensembl Rnor_6.0 Ensembl 10 90,041,591 - 90,042,877 (-) Ensembl
RefSeq Acc Id:
NM_012626 ⟹ NP_036758
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 10 87,554,941 - 87,556,236 (-) NCBI mRatBN7.2 10 87,054,747 - 87,056,044 (-) NCBI Rnor_6.0 10 90,041,582 - 90,042,877 (-) NCBI Rnor_5.0 10 89,831,063 - 89,832,358 (-) NCBI RGSC_v3.4 10 91,167,958 - 91,169,253 (-) RGD Celera 10 85,772,353 - 85,773,648 (-) RGD
Sequence:
AGTCCAGCAGAAGGTAGGTGTCTGGGTCCAATACCCACTCGCTCAGGACACAGGATGGCCGTCGCATACTACTGCCTCTCCCTGTTTCTCCTATCCACTTGGGTGGCTCTGCTGCTACAGCCCCTGCA
hide sequence
RefSeq Acc Id:
NP_036758 ⟸ NM_012626
- Peptide Label:
precursor
- UniProtKB:
P06303 (UniProtKB/Swiss-Prot), A6HJG4 (UniProtKB/TrEMBL)
- Sequence:
MAVAYYCLSLFLLSTWVALLLQPLQGAWGAPLEPMYPGDYATHEQRAQYETQLRRYINTLTRPRYGKRDEDTAGLPGRQLPPCTSLLVGLMPCAAARS
hide sequence
Ensembl Acc Id:
ENSRNOP00000028318 ⟸ ENSRNOT00000028318
RGD ID: 13697772 Promoter ID: EPDNEW_R8297 Type: single initiation site Name: Ppy_1 Description: pancreatic polypeptide SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 10 90,042,877 - 90,042,937 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2002-06-10
Ppy
pancreatic polypeptide
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_expression
synthesized in pancreatic islets of Langerhans
729653
gene_protein
36 amino acids
729653
