Symbol:
Cacna1c
Name:
calcium voltage-gated channel subunit alpha1 C
RGD ID:
2245
Description:
Enables several functions, including high voltage-gated calcium channel activity; protein phosphatase 2A binding activity; and transmembrane transporter binding activity. Involved in several processes, including calcium ion transport; nervous system development; and positive regulation of transport. Located in several cellular components, including T-tubule; Z disc; and postsynaptic density. Part of L-type voltage-gated calcium channel complex. Is active in glutamatergic synapse; postsynaptic membrane; and presynaptic membrane. Biomarker of alcohol dependence. Human ortholog(s) of this gene implicated in Brugada syndrome 3; Timothy syndrome; long QT syndrome 8; and neurodevelopmental disorder with hypotonia, language delay, and skeletal defects with or without seizures. Orthologous to human CACNA1C (calcium voltage-gated channel subunit alpha1 C); PARTICIPATES IN acebutolol pharmacodynamics pathway; adrenergic beta receptor agonist and beta-blocker pharmacodynamics pathway; amiodarone pharmacodynamics pathway; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 2,4,6-trinitrobenzenesulfonic acid.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
brain class C; Ca channel voltage-dependent L type alpha 1c subunit; Ca channel, voltage-dependent, L type, alpha 1c subunit; calcium channel, L type, alpha-1 polypeptide, isoform 1, cardiac muscle; calcium channel, voltage-dependent, alpha 1C subunit; calcium channel, voltage-dependent, L type, alpha 1C subunit; L-type calcium channel alpha-1 subunit; RATIVS302; RBC; voltage-dependent L-type calcium channel subunit alpha-1C; voltage-gated calcium channel subunit alpha Cav1.2
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
CACNA1C (calcium voltage-gated channel subunit alpha1 C) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, Treefam
Mus musculus (house mouse):
Cacna1c (calcium channel, voltage-dependent, L type, alpha 1C subunit) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Cacna1c (calcium voltage-gated channel subunit alpha1 C) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
CACNA1C (calcium voltage-gated channel subunit alpha1 C) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
CACNA1C (calcium voltage-gated channel subunit alpha1 C) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Cacna1c (calcium voltage-gated channel subunit alpha1 C) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
CACNA1C (calcium voltage-gated channel subunit alpha1 C) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
CACNA1C (calcium voltage-gated channel subunit alpha1 C) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Cacna1c (calcium voltage-gated channel subunit alpha1 C) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
CACNA1D (calcium voltage-gated channel subunit alpha1 D) HGNC
OrthoDB
Homo sapiens (human):
WWOX (WW domain containing oxidoreductase) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
CACNA1C (calcium voltage-gated channel subunit alpha1 C)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Cacna1c (calcium channel, voltage-dependent, L type, alpha 1C subunit)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
cacna1c (calcium channel, voltage-dependent, L type, alpha 1C subunit)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
CCH1
Alliance
DIOPT (Hieranoid|OMA|OrthoFinder|OrthoInspector|PANTHER)
Drosophila melanogaster (fruit fly):
Ca-alpha1D
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
egl-19
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
cacna1c
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Allele / Splice:
Cacna1cem1Sage
Genetic Models:
SD-Cacna1cem1Sage
Candidate Gene For:
Coreg2
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 153,431,169 - 154,051,932 (-) NCBI GRCr8 mRatBN7.2 4 151,764,138 - 152,379,454 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 151,764,138 - 152,379,648 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 158,028,661 - 158,645,825 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 153,812,328 - 154,429,518 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 152,435,662 - 153,052,854 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 150,635,808 - 151,270,790 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 150,641,066 - 150,829,913 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 216,562,477 - 217,184,927 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 154,895,691 - 155,517,389 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 155,140,531 - 155,762,230 (-) NCBI Celera 4 140,633,057 - 141,244,304 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Cacna1c Rat (+)-pilocarpine decreases expression ISO Cacna1c (Mus musculus) 6480464 Pilocarpine results in decreased expression of CACNA1C protein CTD PMID:17265461 Cacna1c Rat (+)-pilocarpine increases expression ISO Cacna1c (Mus musculus) 6480464 Pilocarpine results in increased expression of CACNA1C protein CTD PMID:17265461 Cacna1c Rat (S)-nicotine increases expression ISO Cacna1c (Mus musculus) 6480464 Nicotine results in increased expression of CACNA1C protein CTD PMID:11756415 Cacna1c Rat 1,2-dimethylhydrazine decreases expression ISO Cacna1c (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of CACNA1C mRNA CTD PMID:22206623 Cacna1c Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Cacna1c (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of CACNA1C mRNA CTD PMID:19465110 Cacna1c Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of CACNA1C mRNA CTD PMID:32109520 Cacna1c Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Cacna1c (Mus musculus) 6480464 Tetrachlorodibenzodioxin promotes the reaction [AHR protein binds to CACNA1C promoter] CTD PMID:19654925 Cacna1c Rat 2,3,7,8-Tetrachlorodibenzofuran decreases expression EXP 6480464 2 more ... CTD PMID:32109520 Cacna1c Rat 2,4,6-trinitrobenzenesulfonic acid increases expression EXP 6480464 Trinitrobenzenesulfonic Acid results in increased expression of CACNA1C mRNA and Trinitrobenzenesulfonic Acid results in increased expression of CACNA1C protein CTD PMID:23537331 Cacna1c Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Cacna1c (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Cacna1c Rat 2-(3,4-dimethoxyphenyl)-5-\{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino\}-2-(propan-2-yl)pentanenitrile multiple interactions EXP 6480464 Mevalonic Acid inhibits the reaction [Verapamil results in decreased expression of CACNA1C mRNA] and Mevalonic Acid inhibits the reaction [Verapamil results in decreased expression of CACNA1C protein] CTD PMID:19791473 Cacna1c Rat 2-(3,4-dimethoxyphenyl)-5-\{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino\}-2-(propan-2-yl)pentanenitrile multiple interactions ISO Cacna1c (Mus musculus) 6480464 Verapamil inhibits the reaction [Iron-Dextran Complex affects the expression of CACNA1C protein] CTD PMID:27095094 Cacna1c Rat 2-(3,4-dimethoxyphenyl)-5-\{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino\}-2-(propan-2-yl)pentanenitrile increases response to substance ISO CACNA1C (Homo sapiens) 6480464 CACNA1C gene polymorphism results in increased susceptibility to Verapamil CTD PMID:20031608 Cacna1c Rat 2-(3,4-dimethoxyphenyl)-5-\{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino\}-2-(propan-2-yl)pentanenitrile decreases expression EXP 6480464 Verapamil results in decreased expression of CACNA1C mRNA and Verapamil results in decreased expression of CACNA1C protein CTD PMID:19791473 Cacna1c Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO CACNA1C (Homo sapiens) 6480464 tetrabromobisphenol A results in increased expression of CACNA1C mRNA CTD PMID:35321852 Cacna1c Rat 4,4'-sulfonyldiphenol increases expression ISO Cacna1c (Mus musculus) 6480464 bisphenol S results in increased expression of CACNA1C mRNA CTD PMID:30951980 Cacna1c Rat 4,4'-sulfonyldiphenol affects methylation ISO Cacna1c (Mus musculus) 6480464 bisphenol S affects the methylation of CACNA1C gene CTD PMID:31683443 Cacna1c Rat 4-nitrophenol decreases expression ISO Cacna1c (Mus musculus) 6480464 4-nitrophenol results in decreased expression of CACNA1C mRNA CTD PMID:34673133 Cacna1c Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of CACNA1C mRNA CTD PMID:31881176 Cacna1c Rat aconitine decreases expression EXP 6480464 Aconitine results in decreased expression of CACNA1C protein CTD PMID:33236894 Cacna1c Rat aflatoxin B1 decreases methylation ISO CACNA1C (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of CACNA1C gene CTD PMID:27153756 Cacna1c Rat aflatoxin B1 decreases expression ISO CACNA1C (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of CACNA1C mRNA CTD PMID:32234424 Cacna1c Rat aflatoxin B1 increases methylation ISO CACNA1C (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of CACNA1C exon and Aflatoxin B1 results in increased methylation of CACNA1C intron CTD PMID:30157460 Cacna1c Rat Aflatoxin B2 alpha increases methylation ISO CACNA1C (Homo sapiens) 6480464 aflatoxin B2 results in increased methylation of CACNA1C exon and aflatoxin B2 results in increased methylation of CACNA1C intron CTD PMID:30157460 Cacna1c Rat all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of CACNA1C mRNA CTD PMID:23056435 Cacna1c Rat allethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of CACNA1C protein and Allethrins inhibits the reaction [CACNA1C protein results in increased transport of Calcium] CTD PMID:14634047 and PMID:34896426 Cacna1c Rat amiodarone decreases expression ISO Cacna1c (Mus musculus) 6480464 Amiodarone results in decreased expression of CACNA1C mRNA CTD PMID:15520326 Cacna1c Rat amphetamine increases expression EXP 6480464 Amphetamine results in increased expression of CACNA1C mRNA and Amphetamine results in increased expression of CACNA1C protein CTD PMID:15329393 Cacna1c Rat androgen antagonist multiple interactions EXP 6480464 [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben co-treated with Androgen Antagonists co-treated with Acetaminophen] affects the expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat arsane affects methylation ISO CACNA1C (Homo sapiens) 6480464 Arsenic affects the methylation of CACNA1C gene CTD PMID:25304211 Cacna1c Rat arsenic atom affects methylation ISO CACNA1C (Homo sapiens) 6480464 Arsenic affects the methylation of CACNA1C gene CTD PMID:25304211 Cacna1c Rat arsenous acid decreases expression ISO Cacna1c (Mus musculus) 6480464 Arsenic Trioxide results in decreased expression of CACNA1C mRNA CTD PMID:24831965 Cacna1c Rat astragaloside IV multiple interactions ISO CACNA1C (Homo sapiens) 6480464 astragaloside A inhibits the reaction [[Iron-Dextran Complex results in increased abundance of Iron] which results in increased expression of CACNA1C protein] CTD PMID:33285147 Cacna1c Rat atenolol increases response to substance ISO CACNA1C (Homo sapiens) 6480464 CACNA1C gene polymorphism results in increased susceptibility to Atenolol CTD PMID:20031608 Cacna1c Rat atrazine affects methylation EXP 6480464 Atrazine affects the methylation of CACNA1C gene CTD PMID:35440735 Cacna1c Rat Bardoxolone methyl decreases activity ISO CACNA1C (Homo sapiens) 6480464 bardoxolone methyl results in decreased activity of CACNA1C protein CTD PMID:28790194 Cacna1c Rat barium(0) increases transport EXP 6480464 CACNA1C protein results in increased transport of Barium CTD PMID:17569661 Cacna1c Rat benzo[a]pyrene multiple interactions ISO Cacna1c (Mus musculus) 6480464 Benzo(a)pyrene promotes the reaction [AHR protein binds to CACNA1C promoter] CTD PMID:19654925 Cacna1c Rat benzo[a]pyrene increases methylation ISO Cacna1c (Mus musculus) 6480464 Benzo(a)pyrene results in increased methylation of CACNA1C intron CTD PMID:27901495 Cacna1c Rat benzo[a]pyrene affects methylation ISO CACNA1C (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of CACNA1C 3' UTR more ... CTD PMID:27901495 and PMID:30157460 Cacna1c Rat benzo[a]pyrene affects methylation ISO Cacna1c (Mus musculus) 6480464 Benzo(a)pyrene affects the methylation of CACNA1C exon and Benzo(a)pyrene affects the methylation of CACNA1C intron CTD PMID:27901495 Cacna1c Rat benzo[a]pyrene increases methylation ISO CACNA1C (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of CACNA1C promoter CTD PMID:27901495 Cacna1c Rat benzo[a]pyrene decreases expression ISO CACNA1C (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased expression of CACNA1C mRNA CTD PMID:22316170 Cacna1c Rat benzo[e]pyrene affects methylation ISO CACNA1C (Homo sapiens) 6480464 benzo(e)pyrene affects the methylation of CACNA1C intron CTD PMID:30157460 Cacna1c Rat benzo[e]pyrene increases methylation ISO CACNA1C (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of CACNA1C exon CTD PMID:30157460 Cacna1c Rat bis(2-ethylhexyl) phthalate increases expression EXP 6480464 Diethylhexyl Phthalate results in increased expression of CACNA1C mRNA CTD PMID:20920545 Cacna1c Rat bis(2-ethylhexyl) phthalate multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono-(2-ethylhexyl)phthalate] which results in increased methylation of CACNA1C gene CTD PMID:33872906 Cacna1c Rat bis(2-ethylhexyl) phthalate multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat bisphenol A increases expression ISO CACNA1C (Homo sapiens) 6480464 bisphenol A results in increased expression of CACNA1C mRNA CTD PMID:17989879 Cacna1c Rat bisphenol A decreases expression ISO Cacna1c (Mus musculus) 6480464 bisphenol A results in decreased expression of CACNA1C mRNA CTD PMID:32156529 Cacna1c Rat bisphenol A multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of CACNA1C gene CTD PMID:31601247 Cacna1c Rat bisphenol A decreases methylation ISO CACNA1C (Homo sapiens) 6480464 bisphenol A results in decreased methylation of CACNA1C gene CTD PMID:31601247 Cacna1c Rat bisphenol A decreases expression ISO CACNA1C (Homo sapiens) 6480464 bisphenol A results in decreased expression of CACNA1C mRNA CTD PMID:36385337 Cacna1c Rat bisphenol A multiple interactions ISO Cacna1c (Mus musculus) 6480464 [bisphenol A co-treated with Streptozocin] results in decreased expression of CACNA1C mRNA CTD PMID:29935216 Cacna1c Rat bisphenol A increases expression ISO Cacna1c (Mus musculus) 6480464 bisphenol A results in increased expression of CACNA1C mRNA CTD PMID:30951980 more ... Cacna1c Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of CACNA1C mRNA CTD PMID:30816183 Cacna1c Rat bisphenol A increases methylation ISO Cacna1c (Mus musculus) 6480464 bisphenol A results in increased methylation of CACNA1C promoter CTD PMID:27312807 Cacna1c Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of CACNA1C mRNA CTD PMID:25181051 Cacna1c Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben co-treated with Androgen Antagonists co-treated with Acetaminophen] affects the expression of CACNA1C mRNA and [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben] results in decreased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat bisphenol F increases expression ISO Cacna1c (Mus musculus) 6480464 bisphenol F results in increased expression of CACNA1C mRNA CTD PMID:30951980 Cacna1c Rat butanal increases expression ISO CACNA1C (Homo sapiens) 6480464 butyraldehyde results in increased expression of CACNA1C mRNA CTD PMID:26079696 Cacna1c Rat Butylparaben multiple interactions EXP 6480464 [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben co-treated with Androgen Antagonists co-treated with Acetaminophen] affects the expression of CACNA1C mRNA and [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben] results in decreased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat cadmium atom affects expression ISO CACNA1C (Homo sapiens) 6480464 Cadmium affects the expression of CACNA1C mRNA CTD PMID:36321828 Cacna1c Rat cadmium atom multiple interactions ISO Cacna1c (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of CACNA1C mRNA CTD PMID:37325564 Cacna1c Rat cadmium atom multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of CACNA1C mRNA CTD PMID:35301059 Cacna1c Rat cadmium dichloride increases expression ISO CACNA1C (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of CACNA1C mRNA CTD PMID:38568856 Cacna1c Rat cadmium dichloride multiple interactions ISO Cacna1c (Mus musculus) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of CACNA1C mRNA CTD PMID:37325564 Cacna1c Rat cadmium dichloride multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Cadmium Chloride results in increased abundance of Cadmium] which results in decreased expression of CACNA1C mRNA CTD PMID:35301059 Cacna1c Rat calcium atom multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [CACNA1C protein co-treated with CACNB3 protein] results in increased transport of Calcium more ... CTD PMID:12181424 Cacna1c Rat calcium atom multiple interactions EXP 6480464 Allethrins inhibits the reaction [CACNA1C protein results in increased transport of Calcium] CTD PMID:14634047 Cacna1c Rat calcium atom increases transport EXP 6480464 CACNA1C protein results in increased transport of Calcium CTD PMID:14634047 Cacna1c Rat calcium atom increases transport ISO CACNA1C (Homo sapiens) 6480464 CACNA1C protein results in increased transport of Calcium CTD PMID:15299022 Cacna1c Rat calcium(0) multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [CACNA1C protein co-treated with CACNB3 protein] results in increased transport of Calcium more ... CTD PMID:12181424 Cacna1c Rat calcium(0) multiple interactions EXP 6480464 Allethrins inhibits the reaction [CACNA1C protein results in increased transport of Calcium] CTD PMID:14634047 Cacna1c Rat calcium(0) increases transport EXP 6480464 CACNA1C protein results in increased transport of Calcium CTD PMID:14634047 Cacna1c Rat calcium(0) increases transport ISO CACNA1C (Homo sapiens) 6480464 CACNA1C protein results in increased transport of Calcium CTD PMID:15299022 Cacna1c Rat cantharidin decreases expression ISO Cacna1c (Mus musculus) 6480464 Cantharidin results in decreased expression of CACNA1C mRNA CTD PMID:36907384 Cacna1c Rat CGP 52608 multiple interactions ISO CACNA1C (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to CACNA1C gene] CTD PMID:28238834 Cacna1c Rat chloroprene decreases expression ISO Cacna1c (Mus musculus) 6480464 Chloroprene results in decreased expression of CACNA1C mRNA CTD PMID:23125180 Cacna1c Rat chlorpyrifos decreases expression EXP 6480464 Chlorpyrifos results in decreased expression of CACNA1C mRNA CTD PMID:18668222 Cacna1c Rat cisplatin decreases expression ISO Cacna1c (Mus musculus) 6480464 Cisplatin results in decreased expression of CACNA1C mRNA CTD PMID:21151649 Cacna1c Rat crizotinib decreases activity ISO CACNA1C (Homo sapiens) 6480464 crizotinib results in decreased activity of CACNA1C protein CTD PMID:23707608 Cacna1c Rat cyhalothrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of CACNA1C protein CTD PMID:34896426 Cacna1c Rat cypermethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of CACNA1C protein CTD PMID:34896426 Cacna1c Rat DDE multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat deferiprone multiple interactions ISO CACNA1C (Homo sapiens) 6480464 Deferiprone inhibits the reaction [[Iron-Dextran Complex results in increased abundance of Iron] which results in increased expression of CACNA1C protein] CTD PMID:33285147 Cacna1c Rat diarsenic trioxide decreases expression ISO Cacna1c (Mus musculus) 6480464 Arsenic Trioxide results in decreased expression of CACNA1C mRNA CTD PMID:24831965 Cacna1c Rat dibutyl phthalate multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat diltiazem multiple interactions ISO Cacna1c (Mus musculus) 6480464 Diltiazem inhibits the reaction [Iron-Dextran Complex affects the expression of CACNA1C protein] CTD PMID:27095094 Cacna1c Rat dioxygen multiple interactions EXP 6480464 [Oxygen deficiency co-treated with Blood Glucose deficiency co-treated with Particulate Matter] results in decreased expression of CACNA1C mRNA CTD PMID:33729688 Cacna1c Rat disodium selenite multiple interactions ISO Cacna1c (Mus musculus) 6480464 [ptaquiloside co-treated with Sodium Selenite] results in decreased expression of CACNA1C mRNA CTD PMID:23274088 Cacna1c Rat doxorubicin affects methylation EXP 6480464 Doxorubicin affects the methylation of CACNA1C gene CTD PMID:28962528 Cacna1c Rat doxorubicin decreases expression ISO CACNA1C (Homo sapiens) 6480464 Doxorubicin results in decreased expression of CACNA1C mRNA CTD PMID:29803840 Cacna1c Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of CACNA1C mRNA CTD PMID:31464424 Cacna1c Rat enzacamene multiple interactions EXP 6480464 [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben co-treated with Androgen Antagonists co-treated with Acetaminophen] affects the expression of CACNA1C mRNA and [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben] results in decreased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat epoxiconazole multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat epoxiconazole increases expression ISO Cacna1c (Mus musculus) 6480464 epoxiconazole results in increased expression of CACNA1C mRNA CTD PMID:35436446 Cacna1c Rat ethanol increases expression ISO Cacna1c (Mus musculus) 6480464 Ethanol results in increased expression of CACNA1C mRNA CTD PMID:30319688 Cacna1c Rat ethanol multiple interactions EXP 6480464 Ethanol deficiency affects the reaction [Ethanol results in increased expression of CACNA1C mRNA] CTD PMID:27905406 Cacna1c Rat ethanol increases expression EXP 6480464 Ethanol results in increased expression of CACNA1C mRNA and Ethanol results in increased expression of CACNA1C protein CTD PMID:27905406 Cacna1c Rat ethanol multiple interactions ISO Cacna1c (Mus musculus) 6480464 ferrostatin-1 inhibits the reaction [Ethanol results in decreased expression of CACNA1C mRNA] CTD PMID:34864093 Cacna1c Rat ethanol decreases expression ISO Cacna1c (Mus musculus) 6480464 Ethanol results in decreased expression of CACNA1C mRNA and Ethanol results in decreased expression of CACNA1C protein CTD PMID:34864093 Cacna1c Rat ethanol affects expression ISO Cacna1c (Mus musculus) 6480464 Ethanol affects the expression of CACNA1C mRNA CTD PMID:30319688 Cacna1c Rat ezogabine affects activity ISO CACNA1C (Homo sapiens) 6480464 ezogabine affects the activity of CACNA1C protein CTD PMID:28641963 Cacna1c Rat fenvalerate increases expression EXP 6480464 fenvalerate results in increased expression of CACNA1C mRNA CTD PMID:30307764 Cacna1c Rat fenvalerate multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in decreased expression of CACNA1C protein CTD PMID:34896426 Cacna1c Rat ferrostatin-1 multiple interactions ISO Cacna1c (Mus musculus) 6480464 ferrostatin-1 inhibits the reaction [Ethanol results in decreased expression of CACNA1C mRNA] CTD PMID:34864093 Cacna1c Rat formaldehyde decreases expression EXP 6480464 Formaldehyde results in decreased expression of CACNA1C protein CTD PMID:30974163 Cacna1c Rat fulvestrant increases methylation ISO CACNA1C (Homo sapiens) 6480464 Fulvestrant results in increased methylation of CACNA1C gene CTD PMID:31601247 Cacna1c Rat fulvestrant multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [bisphenol A co-treated with Fulvestrant] results in decreased methylation of CACNA1C gene CTD PMID:31601247 Cacna1c Rat furan increases expression EXP 6480464 furan results in increased expression of CACNA1C mRNA CTD PMID:27387713 Cacna1c Rat iron atom multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Iron-Dextran Complex results in increased abundance of Iron] which results in increased expression of CACNA1C protein more ... CTD PMID:33285147 Cacna1c Rat iron dextran multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Iron-Dextran Complex results in increased abundance of Iron] which results in increased expression of CACNA1C protein more ... CTD PMID:33285147 Cacna1c Rat iron dextran affects expression ISO Cacna1c (Mus musculus) 6480464 Iron-Dextran Complex affects the expression of CACNA1C protein CTD PMID:27095094 Cacna1c Rat iron dextran multiple interactions ISO Cacna1c (Mus musculus) 6480464 Diltiazem inhibits the reaction [Iron-Dextran Complex affects the expression of CACNA1C protein] more ... CTD PMID:27095094 Cacna1c Rat iron(0) multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Iron-Dextran Complex results in increased abundance of Iron] which results in increased expression of CACNA1C protein more ... CTD PMID:33285147 Cacna1c Rat isoprenaline increases expression EXP 6480464 Isoproterenol results in increased expression of CACNA1C mRNA CTD PMID:17526999 Cacna1c Rat lead(0) affects expression ISO CACNA1C (Homo sapiens) 6480464 Lead affects the expression of CACNA1C mRNA CTD PMID:28903495 Cacna1c Rat linsidomine multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [linsidomine co-treated with Peroxynitrous Acid] results in increased nitrosation of CACNA1C protein CTD PMID:17551092 Cacna1c Rat linuron multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat malathion increases expression ISO CACNA1C (Homo sapiens) 6480464 Malathion results in increased expression of CACNA1C mRNA CTD PMID:37047231 Cacna1c Rat maneb multiple interactions ISO Cacna1c (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of CACNA1C mRNA CTD PMID:36117858 Cacna1c Rat methamphetamine decreases methylation ISO Cacna1c (Mus musculus) 6480464 Methamphetamine results in decreased methylation of CACNA1C promoter CTD PMID:26307267 Cacna1c Rat methamphetamine increases expression EXP 6480464 Methamphetamine results in increased expression of CACNA1C mRNA CTD PMID:35863504 Cacna1c Rat methamphetamine increases expression ISO Cacna1c (Mus musculus) 6480464 Methamphetamine results in increased expression of CACNA1C mRNA and Methamphetamine results in increased expression of CACNA1C protein CTD PMID:26307267 Cacna1c Rat methapyrilene increases methylation ISO CACNA1C (Homo sapiens) 6480464 Methapyrilene results in increased methylation of CACNA1C exon CTD PMID:30157460 Cacna1c Rat methapyrilene affects methylation ISO CACNA1C (Homo sapiens) 6480464 Methapyrilene affects the methylation of CACNA1C intron CTD PMID:30157460 Cacna1c Rat methotrexate increases expression ISO CACNA1C (Homo sapiens) 6480464 Methotrexate results in increased expression of CACNA1C mRNA CTD PMID:21678067 Cacna1c Rat methotrexate decreases expression ISO CACNA1C (Homo sapiens) 6480464 Methotrexate results in decreased expression of CACNA1C mRNA CTD PMID:24449571 Cacna1c Rat methoxychlor affects methylation EXP 6480464 Methoxychlor affects the methylation of CACNA1C gene CTD PMID:35440735 Cacna1c Rat methylene blue multiple interactions ISO Cacna1c (Mus musculus) 6480464 Methylene Blue inhibits the reaction [Sodium Cyanide results in increased phosphorylation of CACNA1C protein] CTD PMID:31173149 Cacna1c Rat mevalonic acid multiple interactions EXP 6480464 Mevalonic Acid inhibits the reaction [Simvastatin results in decreased expression of CACNA1C mRNA] more ... CTD PMID:19791473 Cacna1c Rat mono(2-ethylhexyl) phthalate multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono-(2-ethylhexyl)phthalate] which results in increased methylation of CACNA1C gene CTD PMID:33872906 Cacna1c Rat N-nitrosodiethylamine increases expression ISO Cacna1c (Mus musculus) 6480464 Diethylnitrosamine results in increased expression of CACNA1C mRNA CTD PMID:24535843 Cacna1c Rat nefazodone affects activity ISO CACNA1C (Homo sapiens) 6480464 nefazodone affects the activity of CACNA1C protein CTD PMID:26821276 Cacna1c Rat nicotine increases expression ISO Cacna1c (Mus musculus) 6480464 Nicotine results in increased expression of CACNA1C protein CTD PMID:11756415 Cacna1c Rat nifedipine affects response to substance ISO Cacna1c (Mus musculus) 6480464 CACNA1C protein affects the susceptibility to Nifedipine CTD PMID:18441296 Cacna1c Rat nifedipine multiple interactions ISO CACNA1C (Homo sapiens) 6480464 Nifedipine inhibits the reaction [[Potassium Chloride co-treated with CACNA1C protein alternative form] results in increased phosphorylation of CREB1 protein] CTD PMID:20128810 Cacna1c Rat nimodipine multiple interactions ISO Cacna1c (Mus musculus) 6480464 Nimodipine inhibits the reaction [Iron-Dextran Complex affects the expression of CACNA1C protein] CTD PMID:27095094 Cacna1c Rat Nor-9-carboxy-delta9-THC multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Cannabinoids results in increased abundance of 11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid] which affects the methylation of CACNA1C gene CTD PMID:30521419 Cacna1c Rat paracetamol multiple interactions EXP 6480464 [bisphenol A co-treated with enzacamene co-treated with octylmethoxycinnamate co-treated with butylparaben co-treated with Androgen Antagonists co-treated with Acetaminophen] affects the expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of CACNA1C mRNA CTD PMID:33387578 Cacna1c Rat paraquat increases expression EXP 6480464 Paraquat results in increased expression of CACNA1C mRNA CTD PMID:18198484 Cacna1c Rat paraquat multiple interactions ISO Cacna1c (Mus musculus) 6480464 [Maneb co-treated with Paraquat] results in decreased expression of CACNA1C mRNA CTD PMID:36117858 Cacna1c Rat peroxynitrous acid multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [linsidomine co-treated with Peroxynitrous Acid] results in increased nitrosation of CACNA1C protein more ... CTD PMID:17551092 and PMID:20128810 Cacna1c Rat peroxynitrous acid increases metabolic processing ISO CACNA1C (Homo sapiens) 6480464 Peroxynitrous Acid results in increased metabolism of CACNA1C protein alternative form CTD PMID:20128810 Cacna1c Rat pioglitazone multiple interactions ISO Cacna1c (Mus musculus) 6480464 [N-nitroso-tris-chloroethylurea co-treated with pioglitazone] results in decreased expression of CACNA1C mRNA CTD PMID:27935865 Cacna1c Rat potassium chloride multiple interactions ISO CACNA1C (Homo sapiens) 6480464 [Potassium Chloride co-treated with CACNA1C protein alternative form] results in increased phosphorylation of CREB1 protein more ... CTD PMID:20128810 Cacna1c Rat pregabalin affects localization EXP 6480464 Pregabalin affects the localization of CACNA1C protein CTD PMID:22949532 Cacna1c Rat prochloraz multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat procymidone multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat progesterone increases expression EXP 6480464 Progesterone results in increased expression of CACNA1C mRNA CTD PMID:20726854 Cacna1c Rat Ptaquiloside multiple interactions ISO Cacna1c (Mus musculus) 6480464 [ptaquiloside co-treated with Sodium Selenite] results in decreased expression of CACNA1C mRNA CTD PMID:23274088 Cacna1c Rat pyrethrins decreases expression EXP 6480464 Pyrethrins results in decreased expression of CACNA1C protein CTD PMID:34896426 Cacna1c Rat resveratrol decreases expression ISO Cacna1c (Mus musculus) 6480464 resveratrol results in decreased expression of CACNA1C mRNA CTD PMID:22610192 Cacna1c Rat rotenone increases expression EXP 6480464 Rotenone results in increased expression of CACNA1C mRNA CTD PMID:31585160 Cacna1c Rat rotenone multiple interactions EXP 6480464 [3-bromo-2-oxopropionic acid co-treated with Rotenone] results in increased expression of CACNA1C mRNA CTD PMID:31585160 Cacna1c Rat silver atom decreases expression ISO Cacna1c (Mus musculus) 6480464 Silver results in decreased expression of CACNA1C mRNA CTD PMID:27131904 Cacna1c Rat silver(0) decreases expression ISO Cacna1c (Mus musculus) 6480464 Silver results in decreased expression of CACNA1C mRNA CTD PMID:27131904 Cacna1c Rat simvastatin multiple interactions EXP 6480464 Mevalonic Acid inhibits the reaction [Simvastatin results in decreased expression of CACNA1C mRNA] and Mevalonic Acid inhibits the reaction [Simvastatin results in decreased expression of CACNA1C protein] CTD PMID:19791473 Cacna1c Rat simvastatin decreases expression EXP 6480464 Simvastatin results in decreased expression of CACNA1C mRNA and Simvastatin results in decreased expression of CACNA1C protein CTD PMID:19791473 Cacna1c Rat sodium arsenate increases expression ISO Cacna1c (Mus musculus) 6480464 sodium arsenate results in increased expression of CACNA1C mRNA CTD PMID:21795629 Cacna1c Rat sodium arsenite affects methylation ISO CACNA1C (Homo sapiens) 6480464 sodium arsenite affects the methylation of CACNA1C gene CTD PMID:28589171 Cacna1c Rat sodium arsenite increases expression ISO CACNA1C (Homo sapiens) 6480464 sodium arsenite results in increased expression of CACNA1C mRNA CTD PMID:38568856 Cacna1c Rat sodium arsenite decreases expression ISO CACNA1C (Homo sapiens) 6480464 sodium arsenite results in decreased expression of CACNA1C mRNA CTD PMID:21776218 Cacna1c Rat sodium cyanide increases phosphorylation ISO Cacna1c (Mus musculus) 6480464 Sodium Cyanide results in increased phosphorylation of CACNA1C protein CTD PMID:31173149 Cacna1c Rat sodium cyanide multiple interactions ISO Cacna1c (Mus musculus) 6480464 [Sodium Cyanide results in increased activity of PRKCE protein] which results in increased phosphorylation of CACNA1C protein and Methylene Blue inhibits the reaction [Sodium Cyanide results in increased phosphorylation of CACNA1C protein] CTD PMID:31173149 Cacna1c Rat sodium disulfite decreases expression EXP 6480464 sodium metabisulfite results in decreased expression of CACNA1C mRNA and sodium metabisulfite results in decreased expression of CACNA1C protein CTD PMID:25463229 and PMID:26015265 Cacna1c Rat streptozocin multiple interactions ISO Cacna1c (Mus musculus) 6480464 [bisphenol A co-treated with Streptozocin] results in decreased expression of CACNA1C mRNA and [octylphenol co-treated with Streptozocin] results in decreased expression of CACNA1C mRNA CTD PMID:29935216 Cacna1c Rat streptozocin increases expression ISO Cacna1c (Mus musculus) 6480464 Streptozocin results in increased expression of CACNA1C mRNA CTD PMID:29935216 Cacna1c Rat sulfur dioxide decreases expression EXP 6480464 Sulfur Dioxide results in decreased expression of CACNA1C mRNA and Sulfur Dioxide results in decreased expression of CACNA1C protein CTD PMID:26112951 Cacna1c Rat sunitinib decreases activity ISO CACNA1C (Homo sapiens) 6480464 sunitinib results in decreased activity of CACNA1C protein CTD PMID:23707608 Cacna1c Rat sunitinib multiple interactions ISO Cacna1c (Mus musculus) 6480464 PIK3CA protein inhibits the reaction [Sunitinib results in decreased expression of CACNA1C protein] CTD PMID:31025080 Cacna1c Rat sunitinib decreases expression ISO Cacna1c (Mus musculus) 6480464 Sunitinib results in decreased expression of CACNA1C protein CTD PMID:31025080 Cacna1c Rat sunitinib decreases expression ISO CACNA1C (Homo sapiens) 6480464 Sunitinib results in decreased expression of CACNA1C mRNA CTD PMID:31533062 Cacna1c Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of CACNA1C mRNA CTD PMID:31150632 Cacna1c Rat thalidomide decreases expression ISO Cacna1c (Mus musculus) 6480464 Thalidomide results in decreased expression of CACNA1C mRNA CTD PMID:26006729 and PMID:26217789 Cacna1c Rat titanium dioxide decreases methylation ISO Cacna1c (Mus musculus) 6480464 titanium dioxide results in decreased methylation of CACNA1C gene CTD PMID:35295148 Cacna1c Rat titanium dioxide increases methylation ISO Cacna1c (Mus musculus) 6480464 titanium dioxide results in increased methylation of CACNA1C gene CTD PMID:35295148 Cacna1c Rat torcetrapib increases expression ISO CACNA1C (Homo sapiens) 6480464 torcetrapib results in increased expression of CACNA1C mRNA CTD PMID:20498617 Cacna1c Rat trichloroethene decreases expression ISO CACNA1C (Homo sapiens) 6480464 Trichloroethylene results in decreased expression of CACNA1C mRNA CTD PMID:25847060 Cacna1c Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of CACNA1C mRNA CTD PMID:33387578 Cacna1c Rat triphenyl phosphate affects expression ISO CACNA1C (Homo sapiens) 6480464 triphenyl phosphate affects the expression of CACNA1C mRNA CTD PMID:37042841 Cacna1c Rat triptonide decreases expression ISO Cacna1c (Mus musculus) 6480464 triptonide results in decreased expression of CACNA1C mRNA CTD PMID:33045310 Cacna1c Rat tunicamycin increases expression ISO Cacna1c (Mus musculus) 6480464 Tunicamycin results in increased expression of CACNA1C mRNA CTD PMID:17127020 Cacna1c Rat valproic acid decreases methylation ISO CACNA1C (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of CACNA1C gene CTD PMID:29154799 Cacna1c Rat valproic acid increases methylation ISO CACNA1C (Homo sapiens) 6480464 Valproic Acid results in increased methylation of CACNA1C gene CTD PMID:29501571 Cacna1c Rat valproic acid affects splicing EXP 6480464 Valproic Acid affects the splicing of CACNA1C mRNA CTD PMID:29427782 Cacna1c Rat valproic acid decreases expression EXP 6480464 Valproic Acid results in decreased expression of CACNA1C mRNA CTD PMID:29427782 Cacna1c Rat verapamil increases response to substance ISO CACNA1C (Homo sapiens) 6480464 CACNA1C gene polymorphism results in increased susceptibility to Verapamil CTD PMID:20031608 Cacna1c Rat verapamil multiple interactions ISO Cacna1c (Mus musculus) 6480464 Verapamil inhibits the reaction [Iron-Dextran Complex affects the expression of CACNA1C protein] CTD PMID:27095094 Cacna1c Rat verapamil decreases expression EXP 6480464 Verapamil results in decreased expression of CACNA1C mRNA and Verapamil results in decreased expression of CACNA1C protein CTD PMID:19791473 Cacna1c Rat verapamil multiple interactions EXP 6480464 Mevalonic Acid inhibits the reaction [Verapamil results in decreased expression of CACNA1C mRNA] and Mevalonic Acid inhibits the reaction [Verapamil results in decreased expression of CACNA1C protein] CTD PMID:19791473 Cacna1c Rat vinclozolin multiple interactions EXP 6480464 [Dibutyl Phthalate co-treated with Diethylhexyl Phthalate co-treated with vinclozolin co-treated with prochloraz co-treated with procymidone co-treated with Linuron co-treated with epoxiconazole co-treated with Dichlorodiphenyl Dichloroethylene] results in increased expression of CACNA1C mRNA CTD PMID:25607892 Cacna1c Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of CACNA1C mRNA CTD PMID:23034163 Cacna1c Rat zinc atom increases expression EXP 6480464 Zinc results in increased expression of CACNA1C mRNA CTD PMID:15159208 and PMID:17074742 Cacna1c Rat zinc sulfate increases expression EXP 6480464 Zinc Sulfate results in increased expression of CACNA1C mRNA CTD PMID:17074742 Cacna1c Rat zinc(0) increases expression EXP 6480464 Zinc results in increased expression of CACNA1C mRNA CTD PMID:15159208 and PMID:17074742
Imported Annotations - SMPDB
Imported Annotations - KEGG (archival)
(+)-pilocarpine (ISO) (S)-nicotine (ISO) 1,2-dimethylhydrazine (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 2,4,6-trinitrobenzenesulfonic acid (EXP) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 2-(3,4-dimethoxyphenyl)-5-\{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino\}-2-(propan-2-yl)pentanenitrile (EXP,ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 4,4'-sulfonyldiphenol (ISO) 4-nitrophenol (ISO) acetamide (EXP) aconitine (EXP) aflatoxin B1 (ISO) Aflatoxin B2 alpha (ISO) all-trans-retinoic acid (EXP) allethrin (EXP) amiodarone (ISO) amphetamine (EXP) androgen antagonist (EXP) arsane (ISO) arsenic atom (ISO) arsenous acid (ISO) astragaloside IV (ISO) atenolol (ISO) atrazine (EXP) Bardoxolone methyl (ISO) barium(0) (EXP) benzo[a]pyrene (ISO) benzo[e]pyrene (ISO) bis(2-ethylhexyl) phthalate (EXP,ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) butanal (ISO) Butylparaben (EXP) cadmium atom (ISO) cadmium dichloride (ISO) calcium atom (EXP,ISO) calcium(0) (EXP,ISO) cantharidin (ISO) CGP 52608 (ISO) chloroprene (ISO) chlorpyrifos (EXP) cisplatin (ISO) crizotinib (ISO) cyhalothrin (EXP) cypermethrin (EXP) DDE (EXP) deferiprone (ISO) diarsenic trioxide (ISO) dibutyl phthalate (EXP) diltiazem (ISO) dioxygen (EXP) disodium selenite (ISO) doxorubicin (EXP,ISO) endosulfan (EXP) enzacamene (EXP) epoxiconazole (EXP,ISO) ethanol (EXP,ISO) ezogabine (ISO) fenvalerate (EXP) ferrostatin-1 (ISO) formaldehyde (EXP) fulvestrant (ISO) furan (EXP) iron atom (ISO) iron dextran (ISO) iron(0) (ISO) isoprenaline (EXP) lead(0) (ISO) linsidomine (ISO) linuron (EXP) malathion (ISO) maneb (ISO) methamphetamine (EXP,ISO) methapyrilene (ISO) methotrexate (ISO) methoxychlor (EXP) methylene blue (ISO) mevalonic acid (EXP) mono(2-ethylhexyl) phthalate (ISO) N-nitrosodiethylamine (ISO) nefazodone (ISO) nicotine (ISO) nifedipine (ISO) nimodipine (ISO) Nor-9-carboxy-delta9-THC (ISO) paracetamol (EXP) paraquat (EXP,ISO) peroxynitrous acid (ISO) pioglitazone (ISO) potassium chloride (ISO) pregabalin (EXP) prochloraz (EXP) procymidone (EXP) progesterone (EXP) Ptaquiloside (ISO) pyrethrins (EXP) resveratrol (ISO) rotenone (EXP) silver atom (ISO) silver(0) (ISO) simvastatin (EXP) sodium arsenate (ISO) sodium arsenite (ISO) sodium cyanide (ISO) sodium disulfite (EXP) streptozocin (ISO) sulfur dioxide (EXP) sunitinib (ISO) tetrachloromethane (EXP) thalidomide (ISO) titanium dioxide (ISO) torcetrapib (ISO) trichloroethene (EXP,ISO) triphenyl phosphate (ISO) triptonide (ISO) tunicamycin (ISO) valproic acid (EXP,ISO) verapamil (EXP,ISO) vinclozolin (EXP) zinc atom (EXP) zinc sulfate (EXP) zinc(0) (EXP)
Biological Process
adult walking behavior (ISO) axon development (IEP) calcium ion import (IMP) calcium ion import across plasma membrane (IBA,ISO) calcium ion transmembrane transport (IEA,ISO) calcium ion transmembrane transport via high voltage-gated calcium channel (IDA,IMP,ISO,ISS) calcium ion transport (IEA,IMP,ISO) calcium ion transport into cytosol (ISS) calcium-ion regulated exocytosis (ISO) camera-type eye development (ISO) cardiac conduction (ISO,ISS) cardiac muscle cell action potential involved in contraction (ISO,ISS) cell communication involved in cardiac conduction (ISO) cellular response to amyloid-beta (IEP) cerebral cortex development (IEP) chemical synaptic transmission (ISO) corpus callosum development (IEP) embryonic forelimb morphogenesis (ISO) establishment of localization in cell (ISO) exocytosis (IMP) glucose homeostasis (ISO) growth hormone secretion (ISO) heart development (ISO) immune system development (ISO) insulin secretion (ISO) intracellular calcium ion homeostasis (ISO) membrane depolarization during atrial cardiac muscle cell action potential (ISO,ISS) membrane depolarization during AV node cell action potential (ISO,ISS) membrane depolarization during cardiac muscle cell action potential (ISO,ISS) monoatomic ion transmembrane transport (IEA) monoatomic ion transport (IEA) optic nerve development (IEP) positive regulation of adenylate cyclase activity (ISO,ISS) positive regulation of calcium ion transmembrane transport via high voltage-gated calcium channel (IMP) positive regulation of cytosolic calcium ion concentration (ISO) positive regulation of insulin secretion (IMP) positive regulation of membrane depolarization (IMP) regulation of blood pressure (ISO) regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (ISS) regulation of heart rate by cardiac conduction (ISO,ISS) regulation of organ growth (ISO) regulation of vasoconstriction (ISO) regulation of ventricular cardiac muscle cell action potential (ISO,ISS) response to alcohol (IEP) response to nutrient levels (IEP) smooth muscle contraction (ISO) smooth muscle contraction involved in micturition (ISO) transmembrane transport (IEA) visual learning (ISO)
Cellular Component
axon (IDA) axon cytoplasm (ISO) basal pole of outer hair cell (ISO) basolateral plasma membrane (ISO) caveolar macromolecular signaling complex (ISO) cell projection (IEA) cell surface (IDA) cilium (ISO) cytoplasm (ISO) dendrite (IDA,IEA,ISO) dendritic shaft (ISO) glutamatergic synapse (IDA) L-type voltage-gated calcium channel complex (IDA,ISO,ISS) membrane (IEA,ISO) monoatomic ion channel complex (IEA) neuron projection terminus (ISO) neuronal cell body (IDA,ISO) nucleoplasm (ISO) nucleus (IDA) perikaryon (IEA) plasma membrane (IEA,ISO,ISS) postsynaptic density (IDA,ISO) postsynaptic density membrane (IEA) postsynaptic membrane (IDA,IEA) presynaptic membrane (IDA) protein-containing complex (IDA) sarcolemma (IDA,IEA) somatodendritic compartment (IEA) synapse (IEA) T-tubule (IDA,IEA,ISO,TAS) voltage-gated calcium channel complex (IBA,IDA,IEA,ISO,TAS) Z disc (IDA,ISO)
Molecular Function
alpha-actinin binding (ISO,ISS) calcium channel activity (IEA) calmodulin binding (IEA,ISO) enzyme binding (ISO) high voltage-gated calcium channel activity (IDA,ISO) metal ion binding (IEA) monoatomic ion channel activity (IEA) protein binding (IPI,ISO) protein domain specific binding (IPI) protein phosphatase 2A binding (IPI) translation initiation factor binding (IPI) transmembrane transporter binding (IPI) voltage-gated calcium channel activity (IDA,IEA,IMP,ISO,TAS) voltage-gated calcium channel activity involved in AV node cell action potential (ISO,ISS) voltage-gated calcium channel activity involved in cardiac muscle cell action potential (ISO,ISS)
1.
Multiple calcium channel transcripts in rat osteosarcoma cells: selective activation of alpha 1D isoform by parathyroid hormone.
Barry EL, etal., Proc Natl Acad Sci U S A 1995 Nov 21;92(24):10914-8.
2.
BKCa-Cav channel complexes mediate rapid and localized Ca2+-activated K+ signaling.
Berkefeld H, etal., Science. 2006 Oct 27;314(5799):615-20.
3.
Sex-specific effects of Cacna1c haploinsufficiency on object recognition, spatial memory, and reversal learning capabilities in rats.
Braun MD, etal., Neurobiol Learn Mem. 2018 Nov;155:543-555. doi: 10.1016/j.nlm.2018.05.012. Epub 2018 May 23.
4.
Eukaryotic translation initiation factor 3 subunit e controls intracellular calcium homeostasis by regulation of cav1.2 surface expression.
Buda P, etal., PLoS One. 2013 May 30;8(5):e64462. doi: 10.1371/journal.pone.0064462. Print 2013.
5.
Voltage-gated calcium channels.
Catterall WA Cold Spring Harb Perspect Biol. 2011 Aug 1;3(8):a003947. doi: 10.1101/cshperspect.a003947.
6.
Structural basis of the alpha1-beta subunit interaction of voltage-gated Ca2+ channels.
Chen YH, etal., Nature. 2004 Jun 10;429(6992):675-80. Epub 2004 May 30.
7.
Direct interaction of the rab3 effector rim with ca2+ channels, snap-25, and synaptotagmin.
Coppola T, etal., J Biol Chem 2001 Aug 31;276(35):32756-62.
8.
A new promoter for alpha(1C) subunit of human L-type cardiac calcium channel Ca(V)1.2.
Dai B, etal., Biochem Biophys Res Commun 2002 Aug 16;296(2):429.
9.
Stimulation of 5-HT(2) receptors in prefrontal pyramidal neurons inhibits Ca(v)1.2 L type Ca(2+) currents via a PLCbeta/IP3/calcineurin signaling cascade.
Day M, etal., J Neurophysiol 2002 May;87(5):2490-504.
10.
Evidence for multiple Src binding sites on the alpha1c L-type Ca2+ channel and their roles in activity regulation.
Dubuis E, etal., Cardiovasc Res. 2006 Feb 1;69(2):391-401. Epub 2005 Dec 13.
11.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
12.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
13.
Integrin receptor activation triggers converging regulation of Cav1.2 calcium channels by c-Src and protein kinase A pathways.
Gui P, etal., J Biol Chem. 2006 May 19;281(20):14015-25. Epub 2006 Mar 22.
14.
Binding of protein phosphatase 2A to the L-type calcium channel Cav1.2 next to Ser1928, its main PKA site, is critical for Ser1928 dephosphorylation.
Hall DD, etal., Biochemistry. 2006 Mar 14;45(10):3448-59.
15.
Coexpression of high-voltage-activated ion channels Kv3.4 and Cav1.2 in pioneer axons during pathfinding in the developing rat forebrain.
Huang CY, etal., J Comp Neurol. 2012 Nov 1;520(16):3650-72. doi: 10.1002/cne.23119.
16.
Beta-adrenergic regulation requires direct anchoring of PKA to cardiac CaV1.2 channels via a leucine zipper interaction with A kinase-anchoring protein 15.
Hulme JT, etal., Proc Natl Acad Sci U S A 2003 Oct 28;100(22):13093-8. Epub 2003 Oct 20.
17.
CSN5/Jab1 inhibits cardiac L-type Ca2+ channel activity through protein-protein interactions.
Kameda K, etal., J Mol Cell Cardiol. 2006 Apr;40(4):562-9. Epub 2006 Feb 14.
18.
Silencing of Cav1.2 gene in neonatal cardiomyocytes by lentiviral delivered shRNA.
Karnabi E, etal., Biochem Biophys Res Commun. 2009 Jul 10;384(4):409-14. doi: 10.1016/j.bbrc.2009.04.150. Epub 2009 May 5.
19.
Effects of amyloid-ß peptides on voltage-gated L-type Ca(V)1.2 and Ca(V)1.3 Ca(2+) channels.
Kim S and Rhim H, Mol Cells. 2011 Sep;32(3):289-94. doi: 10.1007/s10059-011-0075-x. Epub 2011 Aug 4.
20.
Cacna1c haploinsufficiency leads to pro-social 50-kHz ultrasonic communication deficits in rats.
Kisko TM, etal., Dis Model Mech. 2018 Jun 20;11(6). pii: dmm.034116. doi: 10.1242/dmm.034116.
21.
cDNA cloning of a dihydropyridine-sensitive calcium channel from rat aorta. Evidence for the existence of alternatively spliced forms.
Koch WJ, etal., J Biol Chem 1990 Oct 15;265(29):17786-91.
22.
Upregulation of the CaV 1.1-ryanodine receptor complex in a rat model of critical illness myopathy.
Kraner SD, etal., Am J Physiol Regul Integr Comp Physiol. 2011 Jun;300(6):R1384-91. Epub 2011 Apr 6.
23.
Expression of voltage-gated Ca2+ channel subtypes in cultured astrocytes.
Latour I, etal., Glia 2003 Mar;41(4):347-53.
24.
Ca(V)1.2 and Ca(V)1.3 L-type calcium channels regulate the resting membrane potential but not the expression of calcium transporters in differentiated PC12 cells.
Lichvárová L and Lacinová L, Gen Physiol Biophys. 2015 Apr;34(2):157-65. doi: 10.4149/gpb_2014045. Epub 2015 Feb 12.
25.
Spontaneous regenerative activity in mammalian retinal bipolar cells: roles of multiple subtypes of voltage-dependent Ca2+ channels.
Ma YP and Pan ZH, Vis Neurosci 2003 Mar-Apr;20(2):131-9.
26.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
27.
The alterations of Ca2+/calmodulin/CaMKII/CaV1.2 signaling in experimental models of Alzheimer's disease and vascular dementia.
Min D, etal., Neurosci Lett. 2013 Mar 22;538:60-5. doi: 10.1016/j.neulet.2013.02.001. Epub 2013 Feb 8.
28.
Skeletal and cardiac ryanodine receptors bind to the Ca(2+)-sensor region of dihydropyridine receptor alpha(1C) subunit.
Mouton J, etal., FEBS Lett. 2001 Sep 21;505(3):441-4.
29.
Voltage-gated calcium channels in adult rat inferior colliculus neurons.
N'Gouemo P and Morad M, Neuroscience 2003;120(3):815-26.
30.
Alcohol Withdrawal-Induced Seizure Susceptibility is Associated with an Upregulation of CaV1.3 Channels in the Rat Inferior Colliculus.
N'Gouemo P, etal., Int J Neuropsychopharmacol. 2015 Jan 2;18(7):pyu123. doi: 10.1093/ijnp/pyu123.
31.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
32.
CaV1.2 rather than CaV1.3 is coupled to glucose-stimulated insulin secretion in INS-1 832/13 cells.
Nitert MD, etal., J Mol Endocrinol. 2008 Jul;41(1):1-11. doi: 10.1677/JME-07-0133.
33.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
34.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
35.
SMPDB Annotation Import Pipeline
Pipeline to import SMPDB annotations from SMPDB into RGD
36.
Chromosomal mapping of a major quantitative trait locus regulating compensatory renal growth in the rat.
Pravenec M, etal., J Am Soc Nephrol 2000 Jul;11(7):1261-5
37.
Effects of Cacna1c haploinsufficiency on social interaction behavior and 50-kHz ultrasonic vocalizations in adult female rats.
Redecker TM, etal., Behav Brain Res. 2019 Jul 23;367:35-52. doi: 10.1016/j.bbr.2019.03.032. Epub 2019 Mar 19.
38.
GOA pipeline
RGD automated data pipeline
39.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
40.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
41.
New therapeutic targets in cardiology: arrhythmias and Ca2+/calmodulin-dependent kinase II (CaMKII).
Rokita AG and Anderson ME, Circulation. 2012 Oct 23;126(17):2125-39. doi: 10.1161/CIRCULATIONAHA.112.124990.
42.
Distribution of proteins implicated in excitation-contraction coupling in rat ventricular myocytes.
Scriven DR, etal., Biophys J. 2000 Nov;79(5):2682-91.
43.
Caveolin-3 is adjacent to a group of extradyadic ryanodine receptors.
Scriven DR, etal., Biophys J. 2005 Sep;89(3):1893-901. Epub 2005 Jun 24.
44.
Distinct calcium channels are generated by alternative splicing and are differentially expressed in the mammalian CNS.
Snutch TP, etal., Neuron 1991 Jul;7(1):45-57.
45.
Severe arrhythmia disorder caused by cardiac L-type calcium channel mutations.
Splawski I, etal., Proc Natl Acad Sci U S A. 2005 Jun 7;102(23):8089-96; discussion 8086-8. Epub 2005 Apr 29.
46.
Physical and functional interaction between calcineurin and the cardiac L-type Ca2+ channel.
Tandan S, etal., Circ Res. 2009 Jul 2;105(1):51-60. doi: 10.1161/CIRCRESAHA.109.199828. Epub 2009 May 28.
47.
Caldendrin, a neuron-specific modulator of Cav/1.2 (L-type) Ca2+ channels.
Tippens AL and Lee A, J Biol Chem. 2007 Mar 16;282(11):8464-73. Epub 2007 Jan 15.
48.
Ultrastructural evidence for pre- and postsynaptic localization of Cav1.2 L-type Ca2+ channels in the rat hippocampus.
Tippens AL, etal., J Comp Neurol. 2008 Feb 1;506(4):569-83.
49.
Differential Roles for L-Type Calcium Channel Subtypes in Alcohol Dependence.
Uhrig S, etal., Neuropsychopharmacology. 2017 Apr;42(5):1058-1069. doi: 10.1038/npp.2016.266. Epub 2016 Dec 1.
50.
Quantitative trait loci for estrogen-dependent pituitary tumor growth in the rat.
Wendell DL and Gorski J, Mamm Genome 1997;8(11):823-9
51.
The levels of Pdx1/insulin, Cacna1c and Cacna1d, and β-cell mass in a rat model of intrauterine undernutrition.
Xu YP, etal., J Matern Fetal Neonatal Med. 2011 Mar;24(3):437-43. doi: 10.3109/14767058.2010.497571. Epub 2010 Sep 27.
52.
Cloning of a functional splice variant of L-type calcium channel beta 2 subunit from rat heart.
Yamada Y, etal., J Biol Chem 2001 Dec 14;276(50):47163-70.
53.
The role of voltage-gated calcium channels in pancreatic beta-cell physiology and pathophysiology.
Yang SN and Berggren PO, Endocr Rev. 2006 Oct;27(6):621-76. Epub 2006 Jul 25.
54.
Ca2+-binding protein-1 facilitates and forms a postsynaptic complex with Cav1.2 (L-type) Ca2+ channels.
Zhou H, etal., J Neurosci. 2004 May 12;24(19):4698-708.
Cacna1c Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 4 153,431,169 - 154,051,932 (-) NCBI GRCr8 mRatBN7.2 4 151,764,138 - 152,379,454 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 4 151,764,138 - 152,379,648 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 4 158,028,661 - 158,645,825 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 4 153,812,328 - 154,429,518 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 4 152,435,662 - 153,052,854 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 4 150,635,808 - 151,270,790 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 4 150,641,066 - 150,829,913 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 4 216,562,477 - 217,184,927 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 4 154,895,691 - 155,517,389 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 4 155,140,531 - 155,762,230 (-) NCBI Celera 4 140,633,057 - 141,244,304 (-) NCBI Celera Cytogenetic Map 4 q42 NCBI
CACNA1C Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 1,970,780 - 2,697,950 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 1,970,772 - 2,697,950 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 2,162,153 - 2,807,116 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 2,032,725 - 2,677,376 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 12 2,032,724 - 2,672,368 NCBI Celera 12 3,770,102 - 4,421,688 (+) NCBI Celera Cytogenetic Map 12 p13.33 NCBI HuRef 12 2,016,425 - 2,664,566 (+) NCBI HuRef CHM1_1 12 2,161,408 - 2,806,152 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 1,965,666 - 2,703,402 (+) NCBI T2T-CHM13v2.0
Cacna1c Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 6 118,564,201 - 119,174,345 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 6 118,564,201 - 119,173,851 (-) Ensembl GRCm39 Ensembl GRCm38 6 118,587,240 - 119,197,384 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 118,587,240 - 119,196,890 (-) Ensembl GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 6 118,587,240 - 119,196,418 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 6 118,542,314 - 119,146,427 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 6 118,558,083 - 119,074,173 (-) NCBI MGSCv36 mm8 MGSCv36 6 119,385,868 - 119,901,054 (-) NCBI MGSCv36 mm8 Celera 6 120,420,625 - 121,028,854 (-) NCBI Celera Cytogenetic Map 6 F1 NCBI cM Map 6 55.86 NCBI
Cacna1c Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955454 4,490,923 - 5,198,506 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955454 4,573,647 - 5,199,046 (+) NCBI ChiLan1.0 ChiLan1.0
CACNA1C Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 7,594,561 - 8,246,448 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 7,591,331 - 8,243,218 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 2,166,672 - 2,817,827 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 2,031,317 - 2,745,113 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 2,114,140 - 2,744,826 (+) Ensembl panpan1.1 panPan2
CACNA1C Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 27 44,007,363 - 44,748,251 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 27 44,008,020 - 44,746,429 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 27 1,930,129 - 2,677,673 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 27 44,377,759 - 45,118,301 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 27 44,471,385 - 45,116,929 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 27 44,305,678 - 45,048,124 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 27 44,278,568 - 45,019,930 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 27 1,287,600 - 2,035,369 (-) NCBI UU_Cfam_GSD_1.0
Cacna1c Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404945 106,316,518 - 106,936,642 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936606 2,168,625 - 2,865,758 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936606 2,168,104 - 2,867,560 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
CACNA1C Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 5 69,275,176 - 69,454,459 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 5 69,016,954 - 69,448,428 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 5 71,339,366 - 71,731,255 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
CACNA1C Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 2,107,722 - 2,753,970 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 2,508,705 - 2,752,991 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666063 5,568,387 - 6,218,696 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Cacna1c
.
Predicted Target Of
Count of predictions: 306 Count of miRNA genes: 90 Interacting mature miRNAs: 95 Transcripts: ENSRNOT00000009268, ENSRNOT00000041571, ENSRNOT00000051846, ENSRNOT00000052017 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
6478754 Anxrr43 Anxiety related response QTL 43 0.14035 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 144639524 182687754 Rat 724558 Plsm2 Polydactyly-luxate syndrome (PLS) morphotypes QTL 2 0.0003 hindlimb integrity trait (VT:0010563) hind foot phalanges count (CMO:0001949) 4 132422778 177422778 Rat 1582237 Kidm34 Kidney mass QTL 34 4 0.0001 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 4 148090542 168069246 Rat 61446 Coreg2 Compensatory renal growth QTL 2 3.5 kidney mass (VT:0002707) compensatory renal growth score (CMO:0001894) 4 148423102 157580971 Rat 6478693 Anxrr32 Anxiety related response QTL 32 0.00092 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 144639524 182687754 Rat 10755501 Bp390 Blood pressure QTL 390 2.5 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 4 26775591 168368347 Rat 6478763 Anxrr46 Anxiety related response QTL 46 0.07428 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 6478760 Anxrr45 Anxiety related response QTL 45 0.06717 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 110870972 155870972 Rat 631683 Bp116 Blood pressure QTL 116 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 4 124303370 169303370 Rat 61451 Ciaa4 CIA Autoantibody QTL 4 3.1 blood autoantibody amount (VT:0003725) calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281) 4 126395976 167139601 Rat 1331802 Srn5 Serum renin concentration QTL 5 3.045 renin activity (VT:0005581) plasma renin activity level (CMO:0000116) 4 119428175 157578333 Rat 1331738 Bp209 Blood pressure QTL 209 2.979 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 4 138503169 179293946 Rat 6478700 Anxrr33 Anxiety related response QTL 33 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 1298524 Oia8 Oil induced arthritis QTL 8 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 738009 Sach4 Saccharine consumption QTL 4 4.9 0.000016 consumption behavior trait (VT:0002069) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 4 59948935 154902892 Rat 1549827 Scl46 Serum cholesterol level QTL 46 3.5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 4 132396220 177396220 Rat 7207480 Bss105 Bone structure and strength QTL 105 8.1 femur strength trait (VT:0010010) femur midshaft polar moment of inertia (CMO:0001669) 4 109827074 154827074 Rat 634335 Anxrr16 Anxiety related response QTL 16 7.22 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 4 93308457 167139447 Rat 737821 Hcar9 Hepatocarcinoma resistance QTL 9 3.7 liver integrity trait (VT:0010547) volume of individual liver tumorous lesion (CMO:0001078) 4 109866907 167139601 Rat 7411558 Bw133 Body weight QTL 133 13.84 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 4 125590636 170590636 Rat 6478778 Anxrr51 Anxiety related response QTL 51 0.25384 locomotor behavior trait (VT:0001392) measurement of voluntary locomotion into, out of or within a discrete space in an experimental apparatus (CMO:0000957) 4 124778595 169778595 Rat 10401796 Kidm48 Kidney mass QTL 48 kidney mass (VT:0002707) both kidneys wet weight (CMO:0000085) 4 145568712 182687754 Rat 6478718 Anxrr34 Anxiety related response QTL 34 0.00896 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 61406 Scwia1 Streptococcal cell wall induced arthritis QTL 1 2.3 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 4 106805662 151805662 Rat 631511 Pia7 Pristane induced arthritis QTL 7 4.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 1549832 Bss3 Bone structure and strength QTL 3 11 femur morphology trait (VT:0000559) femur midshaft cortical cross-sectional area (CMO:0001663) 4 109827074 154827074 Rat 70177 Xhs1 X-ray hypersensitivity QTL 1 25.1 intestine integrity trait (VT:0010554) post-insult time to onset of moribundity (CMO:0001896) 4 82798864 152731274 Rat 634347 Hcar8 Hepatocarcinoma resistance QTL 8 5.8 liver integrity trait (VT:0010547) liver tumorous lesion area to total liver area ratio (CMO:0001075) 4 123143783 168143783 Rat 738031 Alc14 Alcohol consumption QTL 14 7.6 0.00003 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1576316 Ept5 Estrogen-induced pituitary tumorigenesis QTL 5 3.8 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 4 83428419 177635233 Rat 2303623 Vencon2 Ventilatory control QTL 2 3.8 respiration trait (VT:0001943) minute ventilation (CMO:0000132) 4 135204660 180204660 Rat 1576305 Emca6 Estrogen-induced mammary cancer QTL 6 5.8 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 4 44463720 155883716 Rat 1578674 Bmd12 Bone mineral density QTL 12 3.8 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 4 135699135 180699135 Rat 738016 Alc16 Alcohol consumption QTL 16 3.6 0.00015 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 4 59948935 154902892 Rat 1358202 Gluco11 Glucose level QTL 11 2.4 0.02 adipocyte glucose uptake trait (VT:0004185) absolute change in adipocyte glucose uptake (CMO:0000873) 4 85379421 167139601 Rat 61422 Cia13 Collagen induced arthritis QTL 13 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 132642577 167139601 Rat 634342 Cia24 Collagen induced arthritis QTL 24 4.5 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 146565735 175236377 Rat 737978 Pia23 Pristane induced arthritis QTL 23 5.3 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 131730738 167139601 Rat 61362 Oia2 Oil induced arthritis QTL 2 0.001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 4 138503169 173369699 Rat 631674 Iddm14 Insulin dependent diabetes mellitus QTL 14 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 4 64528739 157573521 Rat 12798519 Anxrr54 Anxiety related response QTL 54 2.54 0.05 locomotor behavior trait (VT:0001392) distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493) 4 114627026 159627026 Rat 2293659 Bmd35 Bone mineral density QTL 35 4.5 0.0001 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 4 137755016 181392681 Rat 1331759 Hrtrt13 Heart rate QTL 13 3.54628 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 4 110275411 168266883 Rat 724535 Cm18 Cardiac mass QTL 18 2.6 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 4 118856416 163856416 Rat 2316958 Gluco58 Glucose level QTL 58 10 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 4 11320076 180699135 Rat 6478748 Anxrr42 Anxiety related response QTL 42 0.28008 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 144639524 182687754 Rat 12798525 Anxrr57 Anxiety related response QTL 57 3.21 0.05 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 4 147278504 167139601 Rat
D4Arb4
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 151,805,502 - 151,805,662 (+) MAPPER mRatBN7.2 Rnor_6.0 4 150,682,435 - 150,682,594 NCBI Rnor6.0 Rnor_5.0 4 216,606,296 - 216,606,455 UniSTS Rnor5.0 RGSC_v3.4 4 154,937,067 - 154,937,227 RGD RGSC3.4 RGSC_v3.4 4 154,937,068 - 154,937,227 UniSTS RGSC3.4 RGSC_v3.1 4 155,181,908 - 155,182,068 RGD Celera 4 140,674,416 - 140,674,575 UniSTS Cytogenetic Map 4 q42 UniSTS
D4Mgh30
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 151,805,495 - 151,805,620 (+) MAPPER mRatBN7.2 Rnor_6.0 4 150,682,428 - 150,682,552 NCBI Rnor6.0 Rnor_5.0 4 216,606,289 - 216,606,413 UniSTS Rnor5.0 RGSC_v3.4 4 154,937,060 - 154,937,185 RGD RGSC3.4 RGSC_v3.4 4 154,937,061 - 154,937,185 UniSTS RGSC3.4 RGSC_v3.1 4 155,181,901 - 155,182,026 RGD Celera 4 140,674,409 - 140,674,533 UniSTS RH 3.4 Map 4 971.0 UniSTS RH 3.4 Map 4 971.0 RGD RH 2.0 Map 4 962.7 RGD Cytogenetic Map 4 q42 UniSTS
D4Rat137
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 4 153,884,444 - 153,884,686 (+) Marker Load Pipeline Rnor_6.0 4 151,102,607 - 151,102,848 NCBI Rnor6.0 Rnor_5.0 4 217,018,694 - 217,018,935 UniSTS Rnor5.0 RGSC_v3.4 4 155,346,853 - 155,347,095 RGD RGSC3.4 RGSC_v3.4 4 155,346,854 - 155,347,095 UniSTS RGSC3.4 RGSC_v3.1 4 155,591,694 - 155,591,936 RGD Celera 4 141,077,421 - 141,077,662 UniSTS RH 3.4 Map 4 982.1 RGD RH 3.4 Map 4 982.1 UniSTS RH 2.0 Map 4 975.2 RGD SHRSP x BN Map 4 75.9099 RGD Cytogenetic Map 4 q42 UniSTS
D4Got269
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 152,006,437 - 152,006,685 (+) MAPPER mRatBN7.2 Rnor_6.0 4 150,885,590 - 150,885,837 NCBI Rnor6.0 Rnor_5.0 4 216,806,463 - 216,806,710 UniSTS Rnor5.0 RGSC_v3.4 4 155,138,808 - 155,139,055 UniSTS RGSC3.4 Celera 4 140,874,330 - 140,874,573 UniSTS Cytogenetic Map 4 q42 UniSTS
BF387868
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 151,917,968 - 151,918,181 (+) MAPPER mRatBN7.2 Rnor_6.0 4 150,796,460 - 150,796,672 NCBI Rnor6.0 Rnor_5.0 4 216,717,763 - 216,717,975 UniSTS Rnor5.0 RGSC_v3.4 4 155,050,033 - 155,050,245 UniSTS RGSC3.4 Celera 4 140,786,880 - 140,787,092 UniSTS RH 3.4 Map 4 972.3 UniSTS Cytogenetic Map 4 q42 UniSTS
RH144194
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 152,136,086 - 152,136,242 (+) MAPPER mRatBN7.2 Rnor_6.0 4 151,017,204 - 151,017,359 NCBI Rnor6.0 Rnor_5.0 4 216,935,551 - 216,935,706 UniSTS Rnor5.0 RGSC_v3.4 4 155,269,083 - 155,269,238 UniSTS RGSC3.4 Celera 4 141,003,665 - 141,003,820 UniSTS RH 3.4 Map 4 975.1 UniSTS Cytogenetic Map 4 q42 UniSTS
RH144587
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 152,380,229 - 152,380,383 (+) MAPPER mRatBN7.2 Rnor_6.0 4 151,269,935 - 151,270,088 NCBI Rnor6.0 Rnor_5.0 4 217,185,703 - 217,185,856 UniSTS Rnor5.0 RGSC_v3.4 4 155,518,165 - 155,518,318 UniSTS RGSC3.4 Celera 4 141,245,080 - 141,245,233 UniSTS RH 3.4 Map 4 973.9 UniSTS Cytogenetic Map 4 q42 UniSTS
RH138902
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 152,174,992 - 152,175,163 (+) MAPPER mRatBN7.2 Rnor_6.0 4 151,056,101 - 151,056,271 NCBI Rnor6.0 Rnor_5.0 4 216,974,448 - 216,974,618 UniSTS Rnor5.0 RGSC_v3.4 4 155,308,706 - 155,308,876 UniSTS RGSC3.4 Celera 4 141,042,560 - 141,042,730 UniSTS RH 3.4 Map 4 984.5 UniSTS Cytogenetic Map 4 q42 UniSTS
BE119369
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 152,046,482 - 152,046,687 (+) MAPPER mRatBN7.2 Rnor_6.0 4 150,925,629 - 150,925,833 NCBI Rnor6.0 Rnor_5.0 4 216,846,502 - 216,846,706 UniSTS Rnor5.0 RGSC_v3.4 4 155,178,850 - 155,179,054 UniSTS RGSC3.4 Celera 4 140,914,365 - 140,914,569 UniSTS RH 3.4 Map 4 986.5 UniSTS Cytogenetic Map 4 q42 UniSTS
UniSTS:259196
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 4 153,515,111 - 153,515,650 (+) Marker Load Pipeline mRatBN7.2 4 151,842,824 - 151,843,363 (+) MAPPER mRatBN7.2 Rnor_6.0 4 150,719,769 - 150,720,307 NCBI Rnor6.0 Rnor_5.0 4 216,643,630 - 216,644,168 UniSTS Rnor5.0 RGSC_v3.4 4 154,974,388 - 154,974,926 UniSTS RGSC3.4 Celera 4 140,711,716 - 140,712,254 UniSTS Cytogenetic Map 4 q42 UniSTS
UniSTS:495979
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 4 151,918,691 - 151,918,782 (+) MAPPER mRatBN7.2 Rnor_6.0 4 150,797,183 - 150,797,273 NCBI Rnor6.0 Rnor_5.0 4 216,718,486 - 216,718,576 UniSTS Rnor5.0 RGSC_v3.4 4 155,050,756 - 155,050,846 UniSTS RGSC3.4 Celera 4 140,787,603 - 140,787,693 UniSTS Cytogenetic Map 4 q42 UniSTS
This gene Cacna1c is modified in the following models/strains:
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
89
88
57
25
57
6
216
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000041571 ⟹ ENSRNOP00000051397
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 151,765,017 - 151,951,258 (-) Ensembl Rnor_6.0 Ensembl 4 150,642,427 - 150,829,913 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000051846 ⟹ ENSRNOP00000048580
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 151,764,138 - 151,952,153 (-) Ensembl Rnor_6.0 Ensembl 4 150,641,066 - 150,829,741 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000052017 ⟹ ENSRNOP00000048790
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 151,765,606 - 151,951,258 (-) Ensembl Rnor_6.0 Ensembl 4 150,642,534 - 150,829,741 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000106776 ⟹ ENSRNOP00000094898
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 151,764,138 - 152,379,648 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000113714 ⟹ ENSRNOP00000094626
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 151,764,138 - 152,379,648 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000114413 ⟹ ENSRNOP00000077418
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 4 151,765,664 - 151,915,607 (-) Ensembl
RefSeq Acc Id:
NM_012517 ⟹ NP_036649
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,436,427 - 154,051,748 (-) NCBI mRatBN7.2 4 151,764,138 - 152,379,454 (-) NCBI Rnor_6.0 4 150,641,066 - 151,269,159 (-) NCBI Rnor_5.0 4 216,562,477 - 217,184,927 (-) NCBI RGSC_v3.4 4 154,895,691 - 155,517,389 (-) RGD Celera 4 140,633,057 - 141,244,304 (-) RGD
Sequence:
CAGAATTCTAAATCTGAGAGCAAAAGCTCAAATTCACTGCCAAGCGATAAGGCCGTATGAGATTTTATGGCCTTCAAACGTGGCCACAGACATTGTTTCTGAGTTTTTAAAAAGTACAAGGAAAAATA
hide sequence
RefSeq Acc Id:
XM_063285482 ⟹ XP_063141552
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285483 ⟹ XP_063141553
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285484 ⟹ XP_063141554
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285485 ⟹ XP_063141555
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285486 ⟹ XP_063141556
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285487 ⟹ XP_063141557
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285488 ⟹ XP_063141558
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285489 ⟹ XP_063141559
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285490 ⟹ XP_063141560
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285491 ⟹ XP_063141561
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285492 ⟹ XP_063141562
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285493 ⟹ XP_063141563
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285494 ⟹ XP_063141564
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 153,958,915 (-) NCBI
RefSeq Acc Id:
XM_063285495 ⟹ XP_063141565
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285496 ⟹ XP_063141566
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285497 ⟹ XP_063141567
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285498 ⟹ XP_063141568
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285499 ⟹ XP_063141569
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285500 ⟹ XP_063141570
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285501 ⟹ XP_063141571
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285502 ⟹ XP_063141572
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285503 ⟹ XP_063141573
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285504 ⟹ XP_063141574
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285505 ⟹ XP_063141575
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285506 ⟹ XP_063141576
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285507 ⟹ XP_063141577
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285508 ⟹ XP_063141578
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
XM_063285509 ⟹ XP_063141579
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 153,915,089 (-) NCBI
RefSeq Acc Id:
XM_063285510 ⟹ XP_063141580
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 153,551,328 (-) NCBI
RefSeq Acc Id:
XM_063285511 ⟹ XP_063141581
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 153,526,472 (-) NCBI
RefSeq Acc Id:
XM_063285512 ⟹ XP_063141582
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 4 153,431,169 - 154,051,932 (-) NCBI
RefSeq Acc Id:
NP_036649 ⟸ NM_012517
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
- Sequence:
MIRAFAQPSTPPYQPLSSCLSEDTERKFKGKVVHEAQLNCFYISPGGSNYGSPRPAHANMNANAAAGLAPEHIPTPGAALSWQAAIDAARQAKLMGSAGNATISTVSSTQRKRQQYGKPKKQGGTTAT
hide sequence
Ensembl Acc Id:
ENSRNOP00000048580 ⟸ ENSRNOT00000051846
Ensembl Acc Id:
ENSRNOP00000051397 ⟸ ENSRNOT00000041571
Ensembl Acc Id:
ENSRNOP00000048790 ⟸ ENSRNOT00000052017
Ensembl Acc Id:
ENSRNOP00000077418 ⟸ ENSRNOT00000114413
Ensembl Acc Id:
ENSRNOP00000094898 ⟸ ENSRNOT00000106776
Ensembl Acc Id:
ENSRNOP00000094626 ⟸ ENSRNOT00000113714
RefSeq Acc Id:
XP_063141576 ⟸ XM_063285506
- Peptide Label:
isoform X25
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141569 ⟸ XM_063285499
- Peptide Label:
isoform X18
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141582 ⟸ XM_063285512
- Peptide Label:
isoform X31
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141573 ⟸ XM_063285503
- Peptide Label:
isoform X22
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141578 ⟸ XM_063285508
- Peptide Label:
isoform X27
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141570 ⟸ XM_063285500
- Peptide Label:
isoform X19
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141574 ⟸ XM_063285504
- Peptide Label:
isoform X23
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141561 ⟸ XM_063285491
- Peptide Label:
isoform X10
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141562 ⟸ XM_063285492
- Peptide Label:
isoform X11
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141557 ⟸ XM_063285487
- Peptide Label:
isoform X6
- UniProtKB:
A0PJ39 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141565 ⟸ XM_063285495
- Peptide Label:
isoform X14
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141553 ⟸ XM_063285483
- Peptide Label:
isoform X2
- UniProtKB:
A0PJ39 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141575 ⟸ XM_063285505
- Peptide Label:
isoform X24
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141568 ⟸ XM_063285498
- Peptide Label:
isoform X17
- UniProtKB:
F1M5G9 (UniProtKB/TrEMBL), Q8VHT3 (UniProtKB/TrEMBL), A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141571 ⟸ XM_063285501
- Peptide Label:
isoform X20
- UniProtKB:
Q8VHT2 (UniProtKB/TrEMBL), A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141577 ⟸ XM_063285507
- Peptide Label:
isoform X26
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141567 ⟸ XM_063285497
- Peptide Label:
isoform X16
- UniProtKB:
F1LMN0 (UniProtKB/TrEMBL), Q71QJ6 (UniProtKB/TrEMBL), A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141572 ⟸ XM_063285502
- Peptide Label:
isoform X21
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141563 ⟸ XM_063285493
- Peptide Label:
isoform X12
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141566 ⟸ XM_063285496
- Peptide Label:
isoform X15
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141559 ⟸ XM_063285489
- Peptide Label:
isoform X8
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141560 ⟸ XM_063285490
- Peptide Label:
isoform X9
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141558 ⟸ XM_063285488
- Peptide Label:
isoform X7
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141555 ⟸ XM_063285485
- Peptide Label:
isoform X4
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141556 ⟸ XM_063285486
- Peptide Label:
isoform X5
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141552 ⟸ XM_063285482
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I6ANR4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141554 ⟸ XM_063285484
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I6GKU9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141564 ⟸ XM_063285494
- Peptide Label:
isoform X13
- UniProtKB:
A0SLC4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141579 ⟸ XM_063285509
- Peptide Label:
isoform X28
- UniProtKB:
A0PJ39 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141580 ⟸ XM_063285510
- Peptide Label:
isoform X29
- UniProtKB:
A0A8I5YBT4 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063141581 ⟸ XM_063285511
- Peptide Label:
isoform X30
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2016-02-11
Cacna1c
calcium voltage-gated channel subunit alpha1 C
Cacna1c
calcium channel, voltage-dependent, L type, alpha 1C subunit
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2004-09-10
Cacna1c
calcium channel, voltage-dependent, L type, alpha 1C subunit
calcium channel, voltage-dependent, alpha 1C subunit
Name updated
1299863 APPROVED
2002-11-06
Cacna1c
calcium channel, voltage-dependent, alpha 1C subunit
Ca channel, voltage-dependent, L type, alpha 1c subunit
Name updated
625702 APPROVED
2002-06-10
Cacna1c
Ca channel, voltage-dependent, L type, alpha 1c subunit
Symbol and Name status set to approved
70586 APPROVED
Note Type
Note
Reference
gene_expression
expressed in kidney proximal tubule epithelial cells
61074
gene_expression
expressed in osteoblasts
634679
gene_function
subunit of an L-type Ca2+ channel
625474
gene_process
may mediate compensatory renal growth
61074
gene_process
may be involved in the transduction of extracellular signals regulating bone metabolism
634679
gene_transcript
promoter region contains putative response elements for MEF-2, Nkx2.5, NFAT and CRE binding protein 1
625537
gene_transcript
8.6 kb mRNA
634679
