Symbol:
Mrpl46
Name:
mitochondrial ribosomal protein L46
RGD ID:
1309123
Description:
Predicted to be a structural constituent of ribosome. Predicted to be located in several cellular components, including cytosol; mitochondrion; and nucleoplasm. Predicted to be part of mitochondrial large ribosomal subunit. Orthologous to human MRPL46 (mitochondrial ribosomal protein L46); INTERACTS WITH 2,4,6-trinitrotoluene; 2,4-dinitrotoluene; 2,6-dinitrotoluene.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
39S ribosomal protein L46, mitochondrial; L46mt; large ribosomal subunit protein mL46; LOC293054; MRP-L46
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 142,108,266 - 142,117,030 (-) NCBI GRCr8 mRatBN7.2 1 132,698,872 - 132,707,639 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 132,698,601 - 132,707,628 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 140,612,742 - 140,621,494 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 147,782,153 - 147,790,903 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 140,699,844 - 140,708,594 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 140,469,557 - 140,477,634 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 140,469,280 - 140,477,796 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 141,445,108 - 141,453,185 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 134,498,789 - 134,507,602 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 134,577,134 - 134,585,945 (-) NCBI Celera 1 124,770,162 - 124,778,922 (-) NCBI Celera Cytogenetic Map 1 q31 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mrpl46 Rat (-)-epigallocatechin 3-gallate multiple interactions ISO MRPL46 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of MRPL46 mRNA CTD PMID:22079256 Mrpl46 Rat (1->4)-beta-D-glucan multiple interactions ISO Mrpl46 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of MRPL46 mRNA CTD PMID:36331819 Mrpl46 Rat 1,2-dimethylhydrazine multiple interactions ISO Mrpl46 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of MRPL46 mRNA CTD PMID:22206623 Mrpl46 Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Mrpl46 (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Mrpl46 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Mrpl46 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of MRPL46 mRNA CTD PMID:21570461 Mrpl46 Rat 2,4,6-trinitrotoluene affects expression EXP 6480464 Trinitrotoluene affects the expression of MRPL46 mRNA CTD PMID:21346803 Mrpl46 Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of MRPL46 mRNA CTD PMID:21346803 Mrpl46 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of MRPL46 mRNA CTD PMID:21346803 Mrpl46 Rat 2-hydroxypropanoic acid decreases expression ISO MRPL46 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of MRPL46 mRNA CTD PMID:30851411 Mrpl46 Rat 4,4'-sulfonyldiphenol increases expression ISO Mrpl46 (Mus musculus) 6480464 bisphenol S results in increased expression of MRPL46 mRNA CTD PMID:39298647 Mrpl46 Rat 4,4'-sulfonyldiphenol affects expression ISO MRPL46 (Homo sapiens) 6480464 bisphenol S affects the expression of MRPL46 protein CTD PMID:31945527 Mrpl46 Rat acetylsalicylic acid increases expression ISO MRPL46 (Homo sapiens) 6480464 Aspirin results in increased expression of MRPL46 mRNA CTD PMID:15928584 Mrpl46 Rat aconitine decreases expression EXP 6480464 Aconitine results in decreased expression of MRPL46 protein CTD PMID:33236894 Mrpl46 Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of MRPL46 mRNA CTD PMID:28959563 Mrpl46 Rat aflatoxin B1 decreases methylation ISO MRPL46 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of MRPL46 gene CTD PMID:27153756 Mrpl46 Rat aristolochic acid A increases expression ISO MRPL46 (Homo sapiens) 6480464 aristolochic acid I results in increased expression of MRPL46 mRNA CTD PMID:33212167 Mrpl46 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of MRPL46 mRNA CTD PMID:25181051 more ... Mrpl46 Rat bisphenol A decreases expression ISO Mrpl46 (Mus musculus) 6480464 bisphenol A results in decreased expression of MRPL46 mRNA CTD PMID:33221593 Mrpl46 Rat bisphenol F increases expression ISO Mrpl46 (Mus musculus) 6480464 bisphenol F results in increased expression of MRPL46 mRNA CTD PMID:38685157 Mrpl46 Rat cadmium dichloride decreases expression ISO MRPL46 (Homo sapiens) 6480464 Cadmium Chloride results in decreased expression of MRPL46 mRNA CTD PMID:38568856 Mrpl46 Rat carbon nanotube increases expression ISO Mrpl46 (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 Mrpl46 Rat CGP 52608 multiple interactions ISO MRPL46 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to MRPL46 gene] CTD PMID:28238834 Mrpl46 Rat chromium(6+) affects expression ISO Mrpl46 (Mus musculus) 6480464 chromium hexavalent ion affects the expression of MRPL46 mRNA CTD PMID:28472532 Mrpl46 Rat clobetasol increases expression ISO Mrpl46 (Mus musculus) 6480464 Clobetasol results in increased expression of MRPL46 mRNA CTD PMID:27462272 Mrpl46 Rat clofibrate multiple interactions ISO Mrpl46 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of MRPL46 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of MRPL46 mRNA] CTD PMID:17585979 Mrpl46 Rat copper(II) sulfate decreases expression ISO MRPL46 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of MRPL46 mRNA CTD PMID:19549813 Mrpl46 Rat cyclosporin A decreases expression ISO MRPL46 (Homo sapiens) 6480464 Cyclosporine results in decreased expression of MRPL46 mRNA CTD PMID:25562108 Mrpl46 Rat Dibutyl phosphate affects expression ISO MRPL46 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of MRPL46 mRNA CTD PMID:37042841 Mrpl46 Rat dicrotophos decreases expression ISO MRPL46 (Homo sapiens) 6480464 dicrotophos results in decreased expression of MRPL46 mRNA CTD PMID:28302478 Mrpl46 Rat epoxiconazole increases expression ISO Mrpl46 (Mus musculus) 6480464 epoxiconazole results in increased expression of MRPL46 mRNA CTD PMID:35436446 Mrpl46 Rat ethanol affects splicing ISO Mrpl46 (Mus musculus) 6480464 Ethanol affects the splicing of MRPL46 mRNA CTD PMID:30319688 Mrpl46 Rat ethanol increases expression ISO Mrpl46 (Mus musculus) 6480464 Ethanol results in increased expression of MRPL46 mRNA CTD PMID:30319688 Mrpl46 Rat fenthion decreases expression ISO Mrpl46 (Mus musculus) 6480464 Fenthion results in decreased expression of MRPL46 mRNA CTD PMID:34813904 Mrpl46 Rat finasteride increases expression EXP 6480464 Finasteride results in increased expression of MRPL46 mRNA CTD PMID:24136188 Mrpl46 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of MRPL46 mRNA CTD PMID:24136188 Mrpl46 Rat folic acid multiple interactions ISO Mrpl46 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of MRPL46 mRNA CTD PMID:22206623 Mrpl46 Rat furan increases methylation EXP 6480464 furan results in increased methylation of MRPL46 gene CTD PMID:22079235 Mrpl46 Rat glyphosate decreases expression EXP 6480464 Glyphosate results in decreased expression of MRPL46 mRNA CTD PMID:26302742 Mrpl46 Rat ivermectin decreases expression ISO MRPL46 (Homo sapiens) 6480464 Ivermectin results in decreased expression of MRPL46 protein CTD PMID:32959892 Mrpl46 Rat lipopolysaccharide multiple interactions ISO MRPL46 (Homo sapiens) 6480464 [Acetaminophen co-treated with Lipopolysaccharides] results in decreased expression of MRPL46 mRNA CTD PMID:31059760 Mrpl46 Rat lipopolysaccharide decreases expression ISO MRPL46 (Homo sapiens) 6480464 Lipopolysaccharides results in decreased expression of MRPL46 mRNA CTD PMID:31059760 Mrpl46 Rat methidathion decreases expression ISO Mrpl46 (Mus musculus) 6480464 methidathion results in decreased expression of MRPL46 mRNA CTD PMID:34813904 Mrpl46 Rat p-toluidine decreases expression EXP 6480464 4-toluidine results in decreased expression of MRPL46 mRNA CTD PMID:27638505 Mrpl46 Rat paracetamol multiple interactions ISO Mrpl46 (Mus musculus) 6480464 [Clofibrate co-treated with Acetaminophen] affects the expression of MRPL46 mRNA and PPARA affects the reaction [[Clofibrate co-treated with Acetaminophen] affects the expression of MRPL46 mRNA] CTD PMID:17585979 Mrpl46 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of MRPL46 mRNA CTD PMID:33387578 Mrpl46 Rat paracetamol multiple interactions ISO MRPL46 (Homo sapiens) 6480464 [Acetaminophen co-treated with Lipopolysaccharides] results in decreased expression of MRPL46 mRNA CTD PMID:31059760 Mrpl46 Rat paracetamol decreases expression ISO MRPL46 (Homo sapiens) 6480464 Acetaminophen results in decreased expression of MRPL46 mRNA CTD PMID:21420995 more ... Mrpl46 Rat paracetamol affects expression ISO Mrpl46 (Mus musculus) 6480464 Acetaminophen affects the expression of MRPL46 mRNA CTD PMID:17562736 Mrpl46 Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Mrpl46 (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in increased expression of MRPL46 mRNA CTD PMID:36331819 Mrpl46 Rat perfluorooctanoic acid increases expression ISO MRPL46 (Homo sapiens) 6480464 perfluorooctanoic acid results in increased expression of MRPL46 protein CTD PMID:26879310 Mrpl46 Rat pirinixic acid multiple interactions ISO MRPL46 (Homo sapiens) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of MRPL46 mRNA CTD PMID:19710929 Mrpl46 Rat pirinixic acid increases expression ISO Mrpl46 (Mus musculus) 6480464 pirinixic acid results in increased expression of MRPL46 mRNA CTD PMID:23811191 Mrpl46 Rat potassium chromate multiple interactions ISO MRPL46 (Homo sapiens) 6480464 [potassium chromate(VI) co-treated with epigallocatechin gallate] results in decreased expression of MRPL46 mRNA CTD PMID:22079256 Mrpl46 Rat potassium chromate decreases expression ISO MRPL46 (Homo sapiens) 6480464 potassium chromate(VI) results in decreased expression of MRPL46 mRNA CTD PMID:22079256 Mrpl46 Rat rac-lactic acid decreases expression ISO MRPL46 (Homo sapiens) 6480464 Lactic Acid results in decreased expression of MRPL46 mRNA CTD PMID:30851411 Mrpl46 Rat resveratrol increases expression ISO Mrpl46 (Mus musculus) 6480464 resveratrol results in increased expression of MRPL46 mRNA CTD PMID:22610192 Mrpl46 Rat resveratrol multiple interactions ISO MRPL46 (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of MRPL46 mRNA CTD PMID:23557933 Mrpl46 Rat sodium arsenite decreases expression ISO MRPL46 (Homo sapiens) 6480464 sodium arsenite results in decreased expression of MRPL46 mRNA CTD PMID:38568856 Mrpl46 Rat sodium arsenite multiple interactions ISO MRPL46 (Homo sapiens) 6480464 sodium arsenite promotes the reaction [MRPL46 protein binds to CAPRIN1 protein] CTD PMID:33939924 Mrpl46 Rat sodium fluoride increases expression ISO Mrpl46 (Mus musculus) 6480464 Sodium Fluoride results in increased expression of MRPL46 protein CTD PMID:28918527 Mrpl46 Rat sunitinib decreases expression ISO MRPL46 (Homo sapiens) 6480464 Sunitinib results in decreased expression of MRPL46 mRNA CTD PMID:31533062 Mrpl46 Rat trichostatin A affects expression ISO MRPL46 (Homo sapiens) 6480464 trichostatin A affects the expression of MRPL46 mRNA CTD PMID:28542535 Mrpl46 Rat triphenyl phosphate affects expression ISO MRPL46 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of MRPL46 mRNA CTD PMID:37042841 Mrpl46 Rat valproic acid increases expression ISO MRPL46 (Homo sapiens) 6480464 Valproic Acid results in increased expression of MRPL46 mRNA CTD PMID:29154799 Mrpl46 Rat valproic acid affects expression ISO MRPL46 (Homo sapiens) 6480464 Valproic Acid affects the expression of MRPL46 mRNA CTD PMID:25979313
(-)-epigallocatechin 3-gallate (ISO) (1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4,6-trinitrotoluene (EXP) 2,4-dinitrotoluene (EXP) 2,6-dinitrotoluene (EXP) 2-hydroxypropanoic acid (ISO) 4,4'-sulfonyldiphenol (ISO) acetylsalicylic acid (ISO) aconitine (EXP) acrylamide (EXP) aflatoxin B1 (ISO) aristolochic acid A (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) cadmium dichloride (ISO) carbon nanotube (ISO) CGP 52608 (ISO) chromium(6+) (ISO) clobetasol (ISO) clofibrate (ISO) copper(II) sulfate (ISO) cyclosporin A (ISO) Dibutyl phosphate (ISO) dicrotophos (ISO) epoxiconazole (ISO) ethanol (ISO) fenthion (ISO) finasteride (EXP) flutamide (EXP) folic acid (ISO) furan (EXP) glyphosate (EXP) ivermectin (ISO) lipopolysaccharide (ISO) methidathion (ISO) p-toluidine (EXP) paracetamol (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (ISO) pirinixic acid (ISO) potassium chromate (ISO) rac-lactic acid (ISO) resveratrol (ISO) sodium arsenite (ISO) sodium fluoride (ISO) sunitinib (ISO) trichostatin A (ISO) triphenyl phosphate (ISO) valproic acid (ISO)
Mrpl46 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 1 142,108,266 - 142,117,030 (-) NCBI GRCr8 mRatBN7.2 1 132,698,872 - 132,707,639 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 1 132,698,601 - 132,707,628 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 1 140,612,742 - 140,621,494 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 1 147,782,153 - 147,790,903 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 1 140,699,844 - 140,708,594 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 1 140,469,557 - 140,477,634 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 1 140,469,280 - 140,477,796 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 1 141,445,108 - 141,453,185 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 1 134,498,789 - 134,507,602 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 1 134,577,134 - 134,585,945 (-) NCBI Celera 1 124,770,162 - 124,778,922 (-) NCBI Celera Cytogenetic Map 1 q31 NCBI
MRPL46 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 15 88,459,478 - 88,467,388 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 15 88,459,477 - 88,467,390 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 15 89,002,709 - 89,010,619 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 15 86,803,714 - 86,811,623 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 15 86,803,713 - 86,811,623 NCBI Celera 15 65,403,257 - 65,411,181 (-) NCBI Celera Cytogenetic Map 15 q25.3 NCBI HuRef 15 65,114,744 - 65,122,668 (-) NCBI HuRef CHM1_1 15 88,844,502 - 88,852,426 (-) NCBI CHM1_1 T2T-CHM13v2.0 15 86,214,077 - 86,221,987 (-) NCBI T2T-CHM13v2.0
Mrpl46 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 7 78,425,089 - 78,432,837 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 7 78,424,984 - 78,433,279 (-) Ensembl GRCm39 Ensembl GRCm38 7 78,775,341 - 78,783,089 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 7 78,775,236 - 78,783,531 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 7 85,920,227 - 85,927,975 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 7 78,648,854 - 78,656,602 (-) NCBI MGSCv36 mm8 Celera 7 76,188,573 - 76,196,320 (-) NCBI Celera Cytogenetic Map 7 D2 NCBI cM Map 7 44.8 NCBI
Mrpl46 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955416 16,445,700 - 16,453,279 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955416 16,445,563 - 16,453,391 (+) NCBI ChiLan1.0 ChiLan1.0
MRPL46 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 16 78,007,259 - 78,015,178 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 15 81,711,780 - 81,719,699 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 15 67,151,616 - 67,159,521 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 15 86,359,187 - 86,367,113 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 15 86,359,188 - 86,367,113 (-) Ensembl panpan1.1 panPan2
MRPL46 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 3 51,695,618 - 51,705,609 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 3 51,695,618 - 51,705,997 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 3 54,332,133 - 54,342,167 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 3 52,115,555 - 52,125,593 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 3 52,088,377 - 52,125,578 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 3 51,637,861 - 51,647,877 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 3 51,847,981 - 51,858,006 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 3 52,187,065 - 52,197,103 (-) NCBI UU_Cfam_GSD_1.0
Mrpl46 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024408640 131,836,708 - 131,845,934 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936483 14,488,666 - 14,497,747 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936483 14,488,549 - 14,497,772 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MRPL46 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 1 191,321,999 - 191,331,319 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 1 191,321,990 - 191,331,320 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 1 212,754,938 - 212,764,270 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
MRPL46 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 29 7,025,380 - 7,033,219 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 29 7,025,442 - 7,033,219 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666059 39,816,337 - 39,824,123 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mrpl46
.
Predicted Target Of
Count of predictions: 36 Count of miRNA genes: 33 Interacting mature miRNAs: 35 Transcripts: ENSRNOT00000067172 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
61442 Strs1 Sensitivity to stroke QTL 1 7.4 cerebrum integrity trait (VT:0010549) post-insult time to onset of cerebrovascular lesion (CMO:0002343) 1 121767634 166767634 Rat 1578780 Cm52 Cardiac mass QTL 52 3.3 0.0001 heart mass (VT:0007028) heart wet weight (CMO:0000069) 1 81591954 219808434 Rat 1578654 Bss10 Bone structure and strength QTL 10 4 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 1 49393172 159356837 Rat 1598866 Bp287 Blood pressure QTL 287 5.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121006655 166006655 Rat 1578770 Stresp23 Stress response QTL 23 kidney sympathetic nerve activity (VT:0004050) stimulated renal sympathetic nerve activity to basal renal sympathetic nerve activity ratio (CMO:0001786) 1 123350408 182418476 Rat 9590300 Scort16 Serum corticosterone level QTL 16 4.39 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 1 103111621 148111621 Rat 2298545 Neuinf8 Neuroinflammation QTL 8 4.6 nervous system integrity trait (VT:0010566) spinal cord beta-2 microglobulin mRNA level (CMO:0002125) 1 57336763 151090257 Rat 7794788 Mcs32 Mammary carcinoma susceptibility QTL 32 2.61 mammary gland integrity trait (VT:0010552) mammary tumor incidence/prevalence measurement (CMO:0000946) 1 115540693 238914717 Rat 631199 Cm23 Cardiac mass QTL 23 4.6 0.0004 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 115585465 172949803 Rat 2313402 Anxrr24 Anxiety related response QTL 24 aggression-related behavior trait (VT:0015014) tameness/aggressiveness composite score (CMO:0002136) 1 48963584 144267916 Rat 1598850 Bp297 Blood pressure QTL 297 2.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121006655 166006655 Rat 631570 Bp94 Blood pressure QTL 94 0.0001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123479780 142990467 Rat 152025235 Bw194 Body weight QTL 194 4.86 body mass (VT:0001259) 1 123556856 242907031 Rat 152025232 Bw192 Body weight QTL 192 3.93 body mass (VT:0001259) 1 117917486 196963478 Rat 724521 Uae1 Urinary albumin excretion QTL 1 3.8 0.0001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 1 90508614 173018436 Rat 1358902 Bw47 Body weight QTL 47 1.67 body mass (VT:0001259) body weight (CMO:0000012) 1 90508614 180359386 Rat 61346 Rf2 Renal disease susceptibility QTL 2 3.7 urine protein amount (VT:0005160) urine protein level (CMO:0000591) 1 99267916 144267916 Rat 8655649 Arrd1 Age-related retinal degeneration QTL 1 4.89 retinal layer morphology trait (VT:0003727) percentage of study population developing retinopathy during a period of time (CMO:0002453) 1 100357752 183970443 Rat 1300153 Bp171 Blood pressure QTL 171 3.37 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 90664883 143200202 Rat 2317833 Alcrsp19 Alcohol response QTL 19 12.4 0.001 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 1 100979852 145979852 Rat 731168 Bp154 Blood pressure QTL 154 3.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94642644 214537671 Rat 631202 Gluco13 Glucose level QTL 13 0.0001 blood glucose amount (VT:0000188) blood glucose level area under curve (AUC) (CMO:0000350) 1 131763437 159756369 Rat 631205 Bp196 Blood pressure QTL 196 4 0.0001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118944897 199050459 Rat 1300158 Bp173 Blood pressure QTL 173 3.48 arterial blood pressure trait (VT:2000000) blood pressure time series experimental set point of the baroreceptor response (CMO:0002593) 1 115540693 185145286 Rat 1641897 Alcrsp1 Alcohol response QTL 1 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 1 100979852 145979852 Rat 1331749 Hrtrt11 Heart rate QTL 11 2.973 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 1 94494440 198211706 Rat 1331751 Bp199 Blood pressure QTL 199 3.60022 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 1 94494440 181830018 Rat 2293142 Bp314 Blood pressure QTL 314 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 92184926 137184926 Rat 9685799 Bp375 Blood pressure QTL 375 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 2293140 Bp313 Blood pressure QTL 313 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 121833674 166833674 Rat 9685802 Bp376 Blood pressure QTL 376 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 126540680 171540680 Rat 724529 Cm16 Cardiac mass QTL 16 2.7 heart mass (VT:0007028) calculated heart weight (CMO:0000073) 1 87580395 150700247 Rat 61370 Mcs3 Mammary carcinoma susceptibility QTL 3 2.15 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 1 102268556 147268556 Rat 1641895 Bp298 Blood pressure QTL 298 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 123350408 182418476 Rat 70209 Niddm23 Non-insulin dependent diabetes mellitus QTL 23 2.82 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 94494440 198324465 Rat 631496 Bp97 Blood pressure QTL 97 3.08 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 106047847 151047847 Rat 634314 Niddm44 Non-insulin dependent diabetes mellitus QTL 44 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 49393289 199050459 Rat 2303591 Gluco41 Glucose level QTL 41 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 1 102168504 147168504 Rat 1331793 Bp200 Blood pressure QTL 200 3.71601 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 94494440 172949803 Rat 2313060 Bss71 Bone structure and strength QTL 71 2.6 0.0001 long bone metaphysis morphology trait (VT:0000133) tibia midshaft total cross-sectional area (CMO:0001715) 1 118944747 163944747 Rat 1354591 Cm36 Cardiac mass QTL 36 4.1 heart left ventricle mass (VT:0007031) calculated heart weight (CMO:0000073) 1 102813953 201278233 Rat 7421630 Bp362 Blood pressure QTL 362 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 1 118608292 241799120 Rat 70225 Bp58 Blood pressure QTL 58 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32356093 162846471 Rat 10059597 Bp377 Blood pressure QTL 377 3.42 0.025 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 32737458 199368955 Rat 61399 Tcat1 Tongue tumor resistance QTL 1 3.3 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 5 mm (CMO:0001879) 1 99267916 144267916 Rat 724567 Tcas6 Tongue tumor susceptibility QTL 6 6.85 tongue integrity trait (VT:0010553) number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950) 1 92948896 144267916 Rat 738006 Anxrr14 Anxiety related response QTL 14 4 0.00035 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 1354615 Cm32 Cardiac mass QTL 32 5.2 heart left ventricle mass (VT:0007031) heart left ventricle wet weight (CMO:0000071) 1 102813953 201278233 Rat 634348 Bp138 Blood pressure QTL 138 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 168883176 Rat 8694370 Bw154 Body weight QTL 154 8.91 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 1 103111621 148111621 Rat 738028 Anxrr12 Anxiety related response QTL 12 4.9 0.00001 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 1 130636910 175636910 Rat 1354623 Rf46 Renal function QTL 46 3.8 blood creatinine amount (VT:0005328) plasma creatinine level (CMO:0000537) 1 102813953 151162766 Rat 631654 Bp107 Blood pressure QTL 107 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 125611501 170611501 Rat 631544 Bp84 Blood pressure QTL 84 5.6 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350408 181759564 Rat 152025212 Bw190 Body weight QTL 190 5.7 body mass (VT:0001259) 1 123556856 196963478 Rat 631549 Bp89 Blood pressure QTL 89 5.7 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 1 123350581 201284552 Rat 1358189 Cstrr1 Cold stress response QTL 1 0.0001 catecholamine amount (VT:0010543) urine norepinephrine level (CMO:0001629) 1 123350408 182418476 Rat 1354606 Bp246 Blood pressure QTL 246 3.6 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 1 102813953 218753816 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000067172 ⟹ ENSRNOP00000061438
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 1 132,698,601 - 132,707,628 (-) Ensembl Rnor_6.0 Ensembl 1 140,469,280 - 140,477,796 (-) Ensembl
RefSeq Acc Id:
NM_001013068 ⟹ NP_001013086
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 1 142,108,266 - 142,117,030 (-) NCBI mRatBN7.2 1 132,698,872 - 132,707,639 (-) NCBI Rnor_6.0 1 140,469,557 - 140,477,634 (-) NCBI Rnor_5.0 1 141,445,108 - 141,453,185 (-) NCBI RGSC_v3.4 1 134,498,789 - 134,507,602 (-) RGD Celera 1 124,770,162 - 124,778,922 (-) RGD
Sequence:
CGCGGTACTTTGTGGGAAGACGGAAAGATGGCGGCGCCCATAGGGCGTACTCTTTTAGGGGTGGCTAAGGGCTGGCGGCAGCTTGACAGACTCTGGGCAGGTAGTTCTCGTGGCCTGTCCCTTGAGGC
hide sequence
RefSeq Acc Id:
NP_001013086 ⟸ NM_001013068
- UniProtKB:
Q5RK00 (UniProtKB/Swiss-Prot), A6JC25 (UniProtKB/TrEMBL)
- Sequence:
MAAPIGRTLLGVAKGWRQLDRLWAGSSRGLSLEAAPSSSRSPWRLSGALCLQRPPLITKPLTPLQEEMAGLLQQVEVERSLYSDHELRALDEAQRLAKKKADLYDEEQDQDVTLAQDLEDMWEQEFLQ
hide sequence
Ensembl Acc Id:
ENSRNOP00000061438 ⟸ ENSRNOT00000067172
RGD ID: 13690120 Promoter ID: EPDNEW_R645 Type: multiple initiation site Name: Mrpl46_1 Description: mitochondrial ribosomal protein L46 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 1 140,477,628 - 140,477,688 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2005-12-06
Mrpl46
mitochondrial ribosomal protein L46
Mrpl46_predicted
mitochondrial ribosomal protein L46 (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Mrpl46_predicted
mitochondrial ribosomal protein L46 (predicted)
Symbol and Name status set to approved
70820 APPROVED
