Symbol:
Pfdn6
Name:
prefoldin subunit 6
RGD ID:
1303006
Description:
Predicted to enable amyloid-beta binding activity; protein-folding chaperone binding activity; and unfolded protein binding activity. Predicted to be involved in chaperone-mediated protein complex assembly; negative regulation of amyloid fibril formation; and protein folding. Predicted to be part of RPAP3/R2TP/prefoldin-like complex and prefoldin complex. Predicted to be active in cytoplasm. Orthologous to human PFDN6 (prefoldin subunit 6); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 4,4'-sulfonyldiphenol.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
Ke2; MHC class II region expressed gene KE2; prefoldin 6
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
PFDN6 (prefoldin subunit 6) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Pfdn6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Pfdn6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
PFDN6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
PFDN6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Pfdn6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
PFDN6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
PFDN6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Pfdn6 (prefoldin subunit 6) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Mus musculus (house mouse):
Pfdn6 (prefoldin subunit 6)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Homo sapiens (human):
PFDN6 (prefoldin subunit 6)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
pfdn6 (prefoldin subunit 6)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
pfd-6
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|SonicParanoid)
Drosophila melanogaster (fruit fly):
Pfdn6
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
YKE2
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER)
Xenopus tropicalis (tropical clawed frog):
pfdn6
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 20 4,947,844 - 4,949,318 (+) NCBI GRCr8 mRatBN7.2 20 4,945,959 - 4,947,433 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 20 4,945,959 - 4,947,433 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 20 5,669,442 - 5,670,913 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 20 5,031,187 - 5,032,658 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 20 5,511,980 - 5,513,454 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 20 5,455,974 - 5,457,448 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 20 5,455,974 - 5,457,444 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 20 7,514,586 - 7,516,060 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 20 5,097,725 - 5,099,199 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 20 5,097,988 - 5,099,417 (+) NCBI Celera 20 6,530,176 - 6,531,651 (+) NCBI Celera Cytogenetic Map 20 p12 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Pfdn6 Rat 1,2-dimethylhydrazine increases expression ISO Pfdn6 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of PFDN6 mRNA CTD PMID:22206623 Pfdn6 Rat 1,2-dimethylhydrazine multiple interactions ISO Pfdn6 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of PFDN6 mRNA CTD PMID:22206623 Pfdn6 Rat 17alpha-ethynylestradiol multiple interactions ISO Pfdn6 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PFDN6 mRNA CTD PMID:17942748 Pfdn6 Rat 17alpha-ethynylestradiol increases expression ISO Pfdn6 (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of PFDN6 mRNA CTD PMID:17942748 Pfdn6 Rat 17beta-estradiol decreases expression ISO Pfdn6 (Mus musculus) 6480464 Estradiol results in decreased expression of PFDN6 mRNA CTD PMID:39298647 Pfdn6 Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Pfdn6 (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Pfdn6 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of PFDN6 mRNA CTD PMID:21215274 more ... Pfdn6 Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Pfdn6 (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of PFDN6 mRNA CTD PMID:17942748 Pfdn6 Rat 2,3,7,8-Tetrachlorodibenzofuran increases expression EXP 6480464 2 more ... CTD PMID:32109520 Pfdn6 Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of PFDN6 mRNA CTD PMID:36041667 Pfdn6 Rat aflatoxin B1 decreases expression ISO PFDN6 (Homo sapiens) 6480464 Aflatoxin B1 results in decreased expression of PFDN6 mRNA CTD PMID:21641981 Pfdn6 Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of PFDN6 mRNA CTD PMID:16483693 Pfdn6 Rat antirheumatic drug increases expression ISO PFDN6 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of PFDN6 mRNA CTD PMID:24449571 Pfdn6 Rat arsenite(3-) multiple interactions ISO PFDN6 (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to PFDN6 mRNA] CTD PMID:32406909 Pfdn6 Rat benzalkonium chloride affects response to substance ISO PFDN6 (Homo sapiens) 6480464 PFDN6 SNP affects the susceptibility to Benzalkonium Compounds CTD PMID:27258892 Pfdn6 Rat benzo[a]pyrene affects methylation ISO PFDN6 (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of PFDN6 promoter CTD PMID:27901495 Pfdn6 Rat bis(2-ethylhexyl) phthalate increases expression ISO Pfdn6 (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of PFDN6 mRNA CTD PMID:33754040 Pfdn6 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of PFDN6 mRNA CTD PMID:25181051 Pfdn6 Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of PFDN6 mRNA CTD PMID:36041667 Pfdn6 Rat bisphenol A decreases methylation ISO PFDN6 (Homo sapiens) 6480464 bisphenol A results in decreased methylation of PFDN6 gene CTD PMID:31601247 Pfdn6 Rat bisphenol A decreases expression ISO Pfdn6 (Mus musculus) 6480464 bisphenol A results in decreased expression of PFDN6 mRNA CTD PMID:35598803 Pfdn6 Rat bisphenol A decreases expression ISO PFDN6 (Homo sapiens) 6480464 bisphenol A results in decreased expression of PFDN6 mRNA CTD PMID:29275510 Pfdn6 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of PFDN6 mRNA CTD PMID:29097150 Pfdn6 Rat bisphenol F decreases expression ISO Pfdn6 (Mus musculus) 6480464 bisphenol F results in decreased expression of PFDN6 mRNA CTD PMID:38685157 Pfdn6 Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of PFDN6 mRNA CTD PMID:36041667 Pfdn6 Rat Brodifacoum decreases expression EXP 6480464 bromfenacoum results in decreased expression of PFDN6 protein CTD PMID:28903499 Pfdn6 Rat carbon nanotube increases expression ISO Pfdn6 (Mus musculus) 6480464 Nanotubes and Carbon results in increased expression of PFDN6 mRNA CTD PMID:25554681 Pfdn6 Rat CGP 52608 multiple interactions ISO PFDN6 (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to PFDN6 gene] CTD PMID:28238834 Pfdn6 Rat clobetasol increases expression ISO Pfdn6 (Mus musculus) 6480464 Clobetasol results in increased expression of PFDN6 mRNA CTD PMID:27462272 Pfdn6 Rat cobalt dichloride decreases expression ISO PFDN6 (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of PFDN6 mRNA CTD PMID:19376846 Pfdn6 Rat copper(II) sulfate decreases expression ISO PFDN6 (Homo sapiens) 6480464 Copper Sulfate results in decreased expression of PFDN6 mRNA CTD PMID:19549813 Pfdn6 Rat Cuprizon decreases expression EXP 6480464 Cuprizone results in decreased expression of PFDN6 mRNA CTD PMID:26577399 Pfdn6 Rat DDE increases expression ISO PFDN6 (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene results in increased expression of PFDN6 mRNA CTD PMID:38568856 Pfdn6 Rat dextran sulfate multiple interactions ISO Pfdn6 (Mus musculus) 6480464 evodiamine inhibits the reaction [Dextran Sulfate results in increased expression of PFDN6 protein] CTD PMID:35362542 Pfdn6 Rat dextran sulfate increases expression ISO Pfdn6 (Mus musculus) 6480464 Dextran Sulfate results in increased expression of PFDN6 protein CTD PMID:35362542 Pfdn6 Rat Dibutyl phosphate affects expression ISO PFDN6 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of PFDN6 mRNA CTD PMID:37042841 Pfdn6 Rat dibutyl phthalate decreases expression ISO Pfdn6 (Mus musculus) 6480464 Dibutyl Phthalate results in decreased expression of PFDN6 mRNA CTD PMID:17361019 and PMID:21266533 Pfdn6 Rat diethylstilbestrol decreases expression ISO PFDN6 (Homo sapiens) 6480464 Diethylstilbestrol results in decreased expression of PFDN6 mRNA CTD PMID:36621641 Pfdn6 Rat epoxiconazole decreases expression ISO Pfdn6 (Mus musculus) 6480464 epoxiconazole results in decreased expression of PFDN6 mRNA CTD PMID:35436446 Pfdn6 Rat Evodiamine multiple interactions ISO Pfdn6 (Mus musculus) 6480464 evodiamine inhibits the reaction [Dextran Sulfate results in increased expression of PFDN6 protein] CTD PMID:35362542 Pfdn6 Rat finasteride increases expression EXP 6480464 Finasteride results in increased expression of PFDN6 mRNA CTD PMID:24136188 Pfdn6 Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of PFDN6 mRNA CTD PMID:24136188 Pfdn6 Rat folic acid multiple interactions ISO Pfdn6 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of PFDN6 mRNA CTD PMID:22206623 Pfdn6 Rat ivermectin decreases expression ISO PFDN6 (Homo sapiens) 6480464 Ivermectin results in decreased expression of PFDN6 protein CTD PMID:32959892 Pfdn6 Rat nefazodone increases expression EXP 6480464 nefazodone results in increased expression of PFDN6 mRNA CTD PMID:24136188 Pfdn6 Rat paracetamol decreases expression EXP 6480464 Acetaminophen results in decreased expression of PFDN6 mRNA CTD PMID:33387578 Pfdn6 Rat pirinixic acid decreases expression ISO Pfdn6 (Mus musculus) 6480464 pirinixic acid results in decreased expression of PFDN6 mRNA CTD PMID:21318169 Pfdn6 Rat pirinixic acid multiple interactions ISO Pfdn6 (Mus musculus) 6480464 PPARA protein affects the reaction [pirinixic acid results in decreased expression of PFDN6 mRNA] CTD PMID:21318169 Pfdn6 Rat sodium arsenite increases expression ISO PFDN6 (Homo sapiens) 6480464 sodium arsenite results in increased expression of PFDN6 mRNA CTD PMID:28595984 and PMID:34032870 Pfdn6 Rat sulindac increases expression EXP 6480464 Sulindac results in increased expression of PFDN6 mRNA CTD PMID:24136188 Pfdn6 Rat tert-butyl hydroperoxide increases expression ISO PFDN6 (Homo sapiens) 6480464 tert-Butylhydroperoxide results in increased expression of PFDN6 mRNA CTD PMID:15336504 Pfdn6 Rat tetrachloromethane decreases expression EXP 6480464 Carbon Tetrachloride results in decreased expression of PFDN6 mRNA CTD PMID:33387578 Pfdn6 Rat thalidomide decreases expression ISO Pfdn6 (Mus musculus) 6480464 Thalidomide results in decreased expression of PFDN6 mRNA CTD PMID:26217789 Pfdn6 Rat thiram decreases expression ISO PFDN6 (Homo sapiens) 6480464 Thiram results in decreased expression of PFDN6 mRNA CTD PMID:38568856 Pfdn6 Rat titanium dioxide decreases methylation ISO Pfdn6 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of PFDN6 promoter alternative form CTD PMID:35295148 Pfdn6 Rat triptonide increases expression ISO Pfdn6 (Mus musculus) 6480464 triptonide results in increased expression of PFDN6 mRNA CTD PMID:33045310 Pfdn6 Rat urethane decreases expression ISO PFDN6 (Homo sapiens) 6480464 Urethane results in decreased expression of PFDN6 mRNA CTD PMID:28818685 Pfdn6 Rat valproic acid increases methylation ISO PFDN6 (Homo sapiens) 6480464 Valproic Acid results in increased methylation of PFDN6 gene CTD PMID:29154799 Pfdn6 Rat valproic acid affects expression ISO PFDN6 (Homo sapiens) 6480464 Valproic Acid affects the expression of PFDN6 mRNA CTD PMID:25979313 Pfdn6 Rat vinclozolin affects expression EXP 6480464 vinclozolin affects the expression of PFDN6 mRNA CTD PMID:19015723
1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,3,7,8-Tetrachlorodibenzofuran (EXP) 4,4'-sulfonyldiphenol (EXP) aflatoxin B1 (ISO) ammonium chloride (EXP) antirheumatic drug (ISO) arsenite(3-) (ISO) benzalkonium chloride (ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (EXP,ISO) Brodifacoum (EXP) carbon nanotube (ISO) CGP 52608 (ISO) clobetasol (ISO) cobalt dichloride (ISO) copper(II) sulfate (ISO) Cuprizon (EXP) DDE (ISO) dextran sulfate (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) diethylstilbestrol (ISO) epoxiconazole (ISO) Evodiamine (ISO) finasteride (EXP) flutamide (EXP) folic acid (ISO) ivermectin (ISO) nefazodone (EXP) paracetamol (EXP) pirinixic acid (ISO) sodium arsenite (ISO) sulindac (EXP) tert-butyl hydroperoxide (ISO) tetrachloromethane (EXP) thalidomide (ISO) thiram (ISO) titanium dioxide (ISO) triptonide (ISO) urethane (ISO) valproic acid (ISO) vinclozolin (EXP)
Pfdn6 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 20 4,947,844 - 4,949,318 (+) NCBI GRCr8 mRatBN7.2 20 4,945,959 - 4,947,433 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 20 4,945,959 - 4,947,433 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 20 5,669,442 - 5,670,913 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 20 5,031,187 - 5,032,658 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 20 5,511,980 - 5,513,454 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 20 5,455,974 - 5,457,448 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 20 5,455,974 - 5,457,444 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 20 7,514,586 - 7,516,060 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 20 5,097,725 - 5,099,199 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 20 5,097,988 - 5,099,417 (+) NCBI Celera 20 6,530,176 - 6,531,651 (+) NCBI Celera Cytogenetic Map 20 p12 NCBI
PFDN6 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 6 33,289,197 - 33,290,934 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 6 33,289,302 - 33,298,401 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 6 33,257,374 - 33,258,711 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 6 33,365,356 - 33,366,689 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 6 33,365,355 - 33,366,689 NCBI Celera 6 34,811,736 - 34,813,069 (+) NCBI Celera Cytogenetic Map 6 p21.32 NCBI HuRef 6 32,999,008 - 33,000,345 (+) NCBI HuRef CHM1_1 6 33,259,314 - 33,260,651 (+) NCBI CHM1_1 T2T-CHM13v2.0 6 33,110,554 - 33,112,296 (+) NCBI T2T-CHM13v2.0
Pfdn6 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 17 34,157,883 - 34,159,317 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 17 34,157,795 - 34,159,317 (-) Ensembl GRCm39 Ensembl GRCm38 17 33,938,909 - 33,940,343 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 17 33,938,821 - 33,940,343 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 17 34,075,854 - 34,077,288 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 17 33,549,377 - 33,550,759 (-) NCBI MGSCv36 mm8 Celera 17 36,691,821 - 36,693,255 (-) NCBI Celera Cytogenetic Map 17 B1 NCBI cM Map 17 17.98 NCBI
Pfdn6 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955437 1,848,571 - 1,849,824 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955437 1,848,571 - 1,849,824 (+) NCBI ChiLan1.0 ChiLan1.0
PFDN6 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 5 47,767,049 - 47,768,838 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 6 43,638,721 - 43,640,506 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 6 32,861,793 - 32,863,234 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 6 33,975,889 - 33,977,304 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 6 33,975,992 - 33,983,245 (+) Ensembl panpan1.1 panPan2
PFDN6 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 12 2,729,562 - 2,730,858 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 12 2,729,562 - 2,737,163 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 12 2,810,481 - 2,811,777 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 12 3,060,976 - 3,062,272 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 12 3,060,976 - 3,068,578 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 12 2,728,205 - 2,729,498 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 12 2,809,691 - 2,810,986 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 12 2,884,403 - 2,885,699 (+) NCBI UU_Cfam_GSD_1.0
Pfdn6 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404946 38,383,438 - 38,384,733 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936476 25,575,534 - 25,576,818 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936476 25,575,534 - 25,576,827 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
PFDN6 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 7 29,653,679 - 29,654,945 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 7 29,653,569 - 29,654,957 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 7 34,157,268 - 34,158,709 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
PFDN6 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 17 38,786,556 - 38,787,913 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 17 38,786,045 - 38,787,613 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666044 33,124,206 - 33,125,566 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Pfdn6
.
Predicted Target Of
Count of predictions: 48 Count of miRNA genes: 44 Interacting mature miRNAs: 48 Transcripts: ENSRNOT00000000553 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2306850 Pia40 Pristane induced arthritis QTL 40 0.0001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 20 1527959 5304575 Rat 1354642 Despr15 Despair related QTL 15 0.0027 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 20 1 24159021 Rat 4889857 Pur27 Proteinuria QTL 27 12.2 0.001 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 20 4606607 17617956 Rat 9590109 Sffal8 Serum free fatty acids level QTL 8 5.32 0.01 blood free fatty acid amount (VT:0001553) plasma free fatty acids level (CMO:0000546) 20 1 29191651 Rat 9590275 Scort15 Serum corticosterone level QTL 15 3.48 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 20 1 29191651 Rat 7175096 Tcs1 T cell selection QTL 1 T cell selection trait (VT:0004917) expression 20 4727078 5024580 Rat 6893685 Bw111 Body weight QTL 111 2.7 0.004 body mass (VT:0001259) body weight (CMO:0000012) 20 1 32578807 Rat 1641915 Colcr9 Colorectal carcinoma resistance QTL 9 2.97 0.0024 intestine integrity trait (VT:0010554) benign colorectal tumor number (CMO:0001795) 20 1530655 46530655 Rat 2317057 Aia27 Adjuvant induced arthritis QTL 27 2.83 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 20 2892597 26381954 Rat 61474 Eae1 Experimental allergic encephalomyelitis QTL 1 3 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis severity score (CMO:0001419) 20 4606607 6691706 Rat 7387283 Uae44 Urinary albumin excretion QTL 44 0.1712 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 20 1 26123605 Rat 7411668 Foco32 Food consumption QTL 32 8 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 20 1 36600972 Rat 2305926 Iddm37 Insulin dependent diabetes mellitus QTL 37 6 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 20 1527842 46527842 Rat 1600382 Edcs3 Endometrial carcinoma susceptibility QTL3 3.5 0.003 uterus morphology trait (VT:0001120) percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759) 20 1 25159026 Rat 1558640 Prcs2 Prostate cancer susceptibility QTL 2 3.3 prostate integrity trait (VT:0010571) percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943) 20 4606607 17617956 Rat 1331772 Cdexp2 CD45RC expression in CD8 T cells QTL 2 5.7 CD8-positive T cell quantity (VT:0008077) blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990) 20 3621649 10078919 Rat 8694189 Bw153 Body weight QTL 153 3.13 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 20 1 29191651 Rat 1300152 Bp195 Blood pressure QTL 195 3.46 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 20 3621649 9243559 Rat 9589155 Insul32 Insulin level QTL 32 6.38 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 20 1 29191651 Rat 7411650 Foco23 Food consumption QTL 23 20.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 20 1 29191651 Rat 2317851 Alcrsp22 Alcohol response QTL 22 3.2 0.05 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 20 1 27339237 Rat 1598816 Memor12 Memory QTL 12 2.4 exploratory behavior trait (VT:0010471) average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674) 20 2606836 47606836 Rat 61432 Cia1 Collagen induced arthritis QTL 1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 20 3621656 14101050 Rat 1641893 Alcrsp7 Alcohol response QTL 7 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 20 1 27339237 Rat 9590252 Scort12 Serum corticosterone level QTL 12 20.46 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 20 1 36600972 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000000553 ⟹ ENSRNOP00000000553
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 20 4,945,959 - 4,947,433 (+) Ensembl Rnor_6.0 Ensembl 20 5,455,974 - 5,457,444 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000092555 ⟹ ENSRNOP00000075836
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 20 5,456,235 - 5,457,444 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000092676 ⟹ ENSRNOP00000075862
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 20 5,455,974 - 5,457,444 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000092723
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source Rnor_6.0 Ensembl 20 5,456,013 - 5,456,724 (+) Ensembl
RefSeq Acc Id:
NM_001164718 ⟹ NP_001158190
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 20 4,947,844 - 4,949,318 (+) NCBI mRatBN7.2 20 4,945,959 - 4,947,433 (+) NCBI Rnor_6.0 20 5,455,974 - 5,457,448 (+) NCBI Rnor_5.0 20 7,514,586 - 7,516,060 (+) NCBI RGSC_v3.4 20 5,097,725 - 5,099,199 (+) RGD Celera 20 6,530,176 - 6,531,651 (+) RGD
Sequence:
TTGTTTATTTCCGGGTTTATGAATACAGAGGGCAGAGCGTGAAAAGGGCCAGGAAGGGGAGCTCAGGTGCTTTTCAGAGCTTGAGACCCAGCGACCCCCGCCCAGGAGGCTTTCTCCTTCACCATGGC
hide sequence
RefSeq Acc Id:
NM_212506 ⟹ NP_997671
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 20 4,947,844 - 4,949,318 (+) NCBI mRatBN7.2 20 4,945,959 - 4,947,433 (+) NCBI Rnor_6.0 20 5,455,974 - 5,457,448 (+) NCBI Rnor_5.0 20 7,514,586 - 7,516,060 (+) NCBI RGSC_v3.4 20 5,097,725 - 5,099,199 (+) RGD Celera 20 6,530,176 - 6,531,651 (+) RGD
Sequence:
TTGTTTATTTCCGGGTTTATGAATACAGAGGGCAGAGCGTGAAAAGGTTAGGGTTTGGATTTAGGGGGGTGTCTCTTCTTTTCGCTCTCTAATGCCTAGGGAGTGACTATTCTGGACGTAGAGAGTCC
hide sequence
RefSeq Acc Id:
NP_997671 ⟸ NM_212506
- UniProtKB:
Q6MGC4 (UniProtKB/TrEMBL), F7EQJ2 (UniProtKB/TrEMBL)
- Sequence:
MAELIQKKLQGEVEKYQQLQKDLSKSMSGRQKLEAQLTENNIVKEELALLDGSNVVFKLLGPVLVKQELGEARATVGKRLDYITAEIKRYESQLRDLERQSEQQRETLAQLQQEFQRAQNAKAPGKA
hide sequence
RefSeq Acc Id:
NP_001158190 ⟸ NM_001164718
- UniProtKB:
Q6MGC4 (UniProtKB/TrEMBL), F7EQJ2 (UniProtKB/TrEMBL)
- Sequence:
MAELIQKKLQGEVEKYQQLQKDLSKSMSGRQKLEAQLTENNIVKEELALLDGSNVVFKLLGPVLVKQELGEARATVGKRLDYITAEIKRYESQLRDLERQSEQQRETLAQLQQEFQRAQNAKAPGKA
hide sequence
Ensembl Acc Id:
ENSRNOP00000075862 ⟸ ENSRNOT00000092676
Ensembl Acc Id:
ENSRNOP00000075836 ⟸ ENSRNOT00000092555
Ensembl Acc Id:
ENSRNOP00000000553 ⟸ ENSRNOT00000000553
RGD ID: 13701413 Promoter ID: EPDNEW_R11936 Type: multiple initiation site Name: Pfdn6_1 Description: prefoldin subunit 6 SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 20 5,455,996 - 5,456,056 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2009-10-22
Pfdn6
prefoldin subunit 6
Pfdn6
prefoldin 6
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-03-11
Pfdn6
prefoldin 6
Pfdn6
prefoldin subunit 6
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-03-04
Pfdn6
prefoldin subunit 6
Ke2
MHC class II region expressed gene KE2
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-03-30
Ke2
MHC class II region expressed gene KE2
Symbol and Name status set to approved
1299863 APPROVED
2005-02-14
Ke2
MHC class II region expressed gene KE2
Symbol and Name status set to provisional
70820 PROVISIONAL
