Strain: SS-Nppaem4Mcwi

Symbol: SS-Nppaem4Mcwi
Strain: SS-Nppaem4
Substrain: Mcwi
Ontology ID: RS:0002436
Alleles: Nppaem4Mcwi
Also known as: SS-Nppaem4Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.05164,808,407 - 164,809,716RGD_MAPPER_PIPELINERnor6.0
Rnor_5.05168,466,309 - 168,467,618RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.45165,074,518 - 165,075,827RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains




Experimental Data Annotations
References - curated

Region


Additional Information

Nomenclature History
 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139882
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE