Itgb3 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: Itgb3

Symbol: Itgb3
Previously known as:
RGD ID: 5493866
Expected Size: 0 (bp)
Position
Human AssemblyChrPosition (strand)SourceJBrowse
GRCh371745,367,061 - 45,368,458UniSTSGRCh37
GRCh371745,367,615 - 45,368,356UniSTSGRCh37
Celera1741,817,128 - 41,818,525UniSTS
Celera1741,817,682 - 41,818,423UniSTS
HuRef1740,745,695 - 40,746,440UniSTS
HuRef1740,745,141 - 40,746,542UniSTS
Is Marker For: Genes:   ITGB3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCAGCTCATTGTTGATGCTTATGG
Reverse Primer GGTCACGCACTTCCAGCTCGACTTT
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_000212 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  NW_926883 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC068234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AK300424 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY413571 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AY826979 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC127666 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC127667 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV168221 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BV180691 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003464 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH003512 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000268 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000478 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000507 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000679 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS486074 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DS990712 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  J02703 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M20311 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M32674 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M35999 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  U95204 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 3690 UniSTS
UniSTS 143631 UniSTS