D1Got233 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Got233

Symbol: D1Got233
Previously known as: oxsts113; OT10.14; 
RGD ID: 43440
Expected Size: 231 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01154,098,589 - 154,098,780NCBIRnor5.0
RGSC_v3.41243,889,774 - 243,889,999UniSTSRGSC3.4
RGSC_v3.41244,294,363 - 244,294,596UniSTSRGSC3.4
Celera1137,151,906 - 137,152,139UniSTS
RH 3.4 Map11587.31RGD
RH 3.4 Map11587.31UniSTS
RH 2.0 Map11224.1RGD
Cytogenetic Map1q52UniSTS
Cytogenetic Map1q53UniSTS
Is Marker For: Genes:   Cyp2c6   Cyp2c6v2   Cyp2c77-ps  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CAGTCTCAAGGCAAGTGTTT
Reverse Primer GATCTACCTCTTAGTTAAGTTA
 

Region

Nucleotide Sequences
GenBank Nucleotide AU028628 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CH474137.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 29296 UniSTS
  293989 UniSTS
  686022 UniSTS
UniSTS 112143 UniSTS