Mir30d (microRNA 30d) - Rat Genome Database

Name: Mir30d
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Gene: Mir30d (microRNA 30d) Mus musculus

Analyze

Symbol:

Mir30d

Name:

microRNA 30d

RGD ID:

1607658

MGI Page

MGI

Description:

Acts upstream of or within several processes, including cellular response to lipopolysaccharide; long-term synaptic potentiation; and sensory perception of sound. Is expressed in cerebellum; liver; and telencephalon. Orthologous to human MIR30D (microRNA 30d).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

mir-30d; Mirn; Mirn30d; mmu-mir-3; mmu-mir-30d

RGD Orthologs

Alliance Orthologs

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	68,213,057 - 68,213,138 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	15	68,213,057 - 68,213,138 (-)	Ensembl		GRCm39 Ensembl
GRCm38	15	68,341,208 - 68,341,289 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	15	68,341,208 - 68,341,289 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	15	68,172,770 - 68,172,851 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	15	69,857,252 - 69,857,333 (-)	NCBI		Celera
Cytogenetic Map	15	D2	NCBI
cM Map	15	29.44	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

acute kidney failure (ISO)

Experimental Liver Neoplasms (ISO)

Fibrosis (ISO)

Hearing Loss, Noise-Induced (ISO)

kidney disease (ISO)

Neoplastic Cell Transformation (ISO)

pre-malignant neoplasm (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

(+)-schisandrin B (ISO)

1,3,5-trinitro-1,3,5-triazinane (EXP)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

aflatoxin B1 (ISO)

aluminium atom (ISO)

aluminium(0) (ISO)

Aroclor 1254 (ISO)

arsane (EXP)

arsenic atom (EXP)

arsenite(3-) (ISO)

benzo[a]pyrene (ISO)

bis(2-chloroethyl) sulfide (EXP)

bis(2-ethylhexyl) phthalate (ISO)

bleomycin A2 (ISO)

cadmium dichloride (EXP,ISO)

choline (EXP)

cisplatin (ISO)

dibutyl phthalate (ISO)

doxorubicin (ISO)

folic acid (EXP)

fulvestrant (ISO)

hydrogen peroxide (ISO)

L-methionine (EXP)

Licochalcone B (ISO)

mechlorethamine (ISO)

ozone (EXP)

paracetamol (ISO)

PhIP (ISO)

progesterone (ISO)

quartz (ISO)

resveratrol (ISO)

serpentine asbestos (ISO)

sodium arsenite (EXP,ISO)

testosterone (EXP)

tetrachloromethane (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to amino acid stimulus (IDA)

cellular response to lipopolysaccharide (IDA)

long-term synaptic potentiation (IEP)

miRNA-mediated post-transcriptional gene silencing (ISO)

regulation of membrane repolarization (ISO)

response to bacterium (IEP)

response to oxygen levels (IDA)

sensory perception of sound (IEP)

Cellular Component

extracellular exosome (ISO)

Molecular Function

mRNA 3'-UTR binding (ISO)

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:12007417	PMID:12554860	PMID:15538371	PMID:16381832	PMID:16766679	PMID:16882971	PMID:17369397	PMID:17604727	PMID:18452032	PMID:18762567	PMID:19096044	PMID:19185580
PMID:19188439	PMID:20215419	PMID:20413612	PMID:20548288	PMID:20668074	PMID:21037258	PMID:21267068	PMID:21718763	PMID:21822254	PMID:22144232	PMID:22733810	PMID:23272089
PMID:23646144	PMID:24205035	PMID:24771295	PMID:25858512	PMID:27939580	PMID:29846695	PMID:30826341	PMID:31784260	PMID:33092465	PMID:33833132	PMID:35752105	PMID:35831364

Genomics

Comparative Map Data

Mir30d
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	15	68,213,057 - 68,213,138 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	15	68,213,057 - 68,213,138 (-)	Ensembl		GRCm39 Ensembl
GRCm38	15	68,341,208 - 68,341,289 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	15	68,341,208 - 68,341,289 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	15	68,172,770 - 68,172,851 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	15	69,857,252 - 69,857,333 (-)	NCBI		Celera
Cytogenetic Map	15	D2	NCBI
cM Map	15	29.44	NCBI

MIR30D
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	8	134,804,876 - 134,804,945 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	8	134,804,876 - 134,804,945 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	8	135,817,119 - 135,817,188 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	8	135,886,300 - 135,886,369 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	8	131,989,860 - 131,989,929 (-)	NCBI		Celera
Cytogenetic Map	8	q24.22	NCBI
HuRef	8	131,132,816 - 131,132,885 (-)	NCBI		HuRef
CHM1_1	8	135,859,237 - 135,859,306 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	8	135,922,767 - 135,922,836 (-)	NCBI		T2T-CHM13v2.0

Mir30d
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	7	102,025,345 - 102,025,426 (-)	NCBI		GRCr8
mRatBN7.2	7	100,136,391 - 100,136,472 (-)	NCBI	mRatBN7.2	mRatBN7.2
mRatBN7.2 Ensembl	7	100,136,391 - 100,136,472 (-)	Ensembl		mRatBN7.2 Ensembl
UTH_Rnor_SHR_Utx	7	101,908,591 - 101,908,672 (-)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	7	104,110,268 - 104,110,349 (-)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	7	104,029,578 - 104,029,659 (-)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	7	109,286,463 - 109,286,544 (-)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	7	109,286,463 - 109,286,544 (-)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	7	109,228,641 - 109,228,722 (-)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
Celera	7	96,647,647 - 96,647,728 (-)	NCBI		Celera
Cytogenetic Map	7	q34	NCBI

MIR30D
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	13	30,910,306 - 30,910,365 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	13	30,910,306 - 30,910,365 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	13	30,885,535 - 30,885,594 (-)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	13	31,276,123 - 31,276,182 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	13	30,995,654 - 30,995,713 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	13	31,094,620 - 31,094,679 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	13	31,444,847 - 31,444,906 (-)	NCBI		UU_Cfam_GSD_1.0

MIR30D
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	4	6,948,669 - 6,948,747 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	4	6,948,669 - 6,948,747 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	4	6,713,518 - 6,713,596 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

Variants

Variants in Mir30d
4 total Variants

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	22214
Count of gene targets:	8665
Count of transcripts:	14223
Interacting mature miRNAs:	mmu-miR-30d-3p, mmu-miR-30d-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
10401902	Sicd2_m	seizure-induced cell death 2 (mouse)			Not determined		15	3474389	71197538	Mouse
4141952	W3q7_m	weight 3 weeks QTL 7 (mouse)			Not determined			3489694	78601286	Mouse
4142252	Tailaq4_m	tail length adjusted QTL 4 (mouse)			Not determined			3489694	78601286	Mouse
4142448	Tailq6_m	tail length QTL 6 (mouse)			Not determined			3489694	78601286	Mouse
1357559	Scfq2_m	subcutaneous fat pad weight QTL 2 (mouse)			Not determined		15	3489694	78601286	Mouse
1357659	Epfpq4_m	epididymal fat percentage QTL 4 (mouse)			Not determined		15	3489694	78601286	Mouse
26884387	Skwq8_m	skull length QTL 8, 10 week (mouse)					15	6129481	68271849	Mouse
26884412	Bzwq10_m	bi-zygomatic width QTL 10, 10 week (mouse)					15	6129481	71471849	Mouse
26884417	Bzwq4_m	bi-zygomatic width QTL 4, 5 week (mouse)					15	6129481	72471849	Mouse
27226786	Feml11_m	femur length 11, 5 week (mouse)					15	6129481	75871849	Mouse
27095932	Ulnl11_m	ulna length 11, 16 week (mouse)					15	6129481	76384200	Mouse
27226717	Tibw4_m	tibia width 4, proximal, 10 week (mouse)					15	6129481	78684200	Mouse
27226734	Tibmd5_m	tibia midshaft diameter 5, 10 week (mouse)					15	6129481	86684201	Mouse
26884442	Sklq6_m	skull length QTL 6, 5 week (mouse)					15	6129481	100797881	Mouse
27226721	Tibw8_m	tibia width 8, proximal, 16 week (mouse)					15	6929481	75871849	Mouse
27226773	Tibl16_m	tibia length 16, 10 week (mouse)					15	6929481	75871849	Mouse
27226777	Tibl8_m	tibia length 8, 5 week (mouse)					15	6929481	84584201	Mouse
1301433	Rapop5_m	radiation-induced apoptosis 5 (mouse)			Not determined		15	9273022	79474762	Mouse
1357526	Hyplip2_m	hyperlipidemia 2 (mouse)			Not determined		15	12402203	102896555	Mouse
26884425	Cvht2_m	cranial vault height 2, 5 week (mouse)					15	28800146	102008435	Mouse
26884392	Humsd8_m	humerus midshaft diameter 8, 16 week (mouse)					15	29300146	76084200	Mouse
1558985	Eae32_m	experimental allergic encephalomyelitis susceptibility 32 (mouse)			Not determined		15	32578416	103425899	Mouse
1301324	Cdif_m	color difference (mouse)			Not determined		15	35975906	69976019	Mouse
27226729	Tibmd2_m	tibia midshaft diameter 2, 5 week (mouse)					15	38000244	86684201	Mouse
1301580	Hrq2_m	heart rate quantitative locus 2 (mouse)			Not determined		15	39100395	73100593	Mouse
4142459	Lfnq3_m	lung function QTL 3 (mouse)			Not determined			40177022	72372580	Mouse
26884402	Cvht9_m	cranial vault height 9, 16 week (mouse)					15	42163396	95497881	Mouse
1357703	Vtbt17_m	vertebral trabecular bone trait 17 (mouse)			Not determined		15	44553313	78553437	Mouse
1301568	Tria2_m	T-cell receptor induced activation 2 (mouse)			Not determined		15	44859141	78859281	Mouse
26884420	Cvht6_m	cranial vault height 6, 10 week (mouse)					15	45563396	69171849	Mouse
1357756	Alaa4_m	alopecia areata 4 (mouse)			Not determined		15	46389646	80389845	Mouse
10755515	Amzn3_m	anatomical modifier of Zfp423 3 (mouse)					15	46389646	80389845	Mouse
1301006	Hfib1_m	hepatic fibrogenesis 1 (mouse)			Not determined		15	47306334	81306479	Mouse
1301860	Gct3_m	granulosa cell tumorigenesis 3 (mouse)			Not determined		15	47409596	81409691	Mouse
26884397	Humsd5_m	humerus midshaft diameter 5, 10 week (mouse)					15	48363396	98397881	Mouse
26884399	Humsd1_m	humerus midshaft diameter 1, 5 week (mouse)					15	48363396	101708435	Mouse
1301429	Pcir3_m	periosteal circumference 3 (mouse)			Not determined		15	48465362	82465496	Mouse
1301779	Dpml_m	dopamine loss (mouse)			Not determined		15	51004694	76794493	Mouse
4142198	Hbtq_m	habituation QTL (mouse)			Not determined		15	51160708	85160833	Mouse
10045637	Heal27_m	wound healing/regeneration 29 (mouse)			Not determined		15	51418361	85418511	Mouse
10412067	Pain2_m	pain 2 (mouse)			Not determined		15	51645339	85645626	Mouse
1302080	Szs13_m	seizure susceptibility 13 (mouse)			Not determined		15	51685832	85694449	Mouse
1301708	Cocrb14_m	cocaine related behavior 14 (mouse)			Not determined		15	51806515	85806651	Mouse
38501067	Tip3_m	tuberculosis immunophenotype 3, IFN-g level (mouse)					15	53563396	89584203	Mouse
13504731	Cath5_m	carotid atherosclerosis 5 (mouse)					15	54789129	88789129	Mouse
1302074	Bmd4_m	bone mineral density 4 (mouse)			Not determined		15	56186708	103425899	Mouse
27095936	Ulnl4_m	ulna length 4, 5 week (mouse)					15	56763396	87684201	Mouse
1300800	Ses3_m	salmonella enteritidis susceptibility 3 (mouse)			Not determined		15	57117005	91117153	Mouse
1357407	Pfat4_m	predicted fat percentage 4 (mouse)	8.6		Body fat amount	predicted fat percentage	15	57117005	91117153	Mouse
12880420	V25Dq8_m	vitamin D inactive form serum level QTL 8 (mouse)					15	61584200	95584200	Mouse
1301601	Faq9_m	fluctuating asymmetry QTL 9 (mouse)			Not determined		15	63163903	97163995	Mouse
1558786	Msq1_m	MAV-1 susceptibility QTL 1 (mouse)			Not determined		15	63389646	81086436	Mouse
1302197	Bhr2_m	bronchial hyperresponsiveness 2 (mouse)			Not determined		15	64306334	103425899	Mouse
4141135	Cia35_m	collagen induced arthritis 35 (mouse)			Not determined		15	64811826	98811946	Mouse
1301119	Drb7_m	dopamine receptor binding 7 (mouse)			Not determined		15	65336578	99341028	Mouse
1301171	Brm2_m	brachyury modifier 2 (mouse)			Not determined		15	65525376	99525499	Mouse
4141921	Pstc3_m	periosteal circumference 3 (mouse)			Not determined		15	67270698	101270847	Mouse

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029718	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC108821	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AJ459727	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608547	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSMUST00000083503

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	15	68,213,057 - 68,213,138 (-)	Ensembl
GRCm38.p6 Ensembl	15	68,341,208 - 68,341,289 (-)	Ensembl

RefSeq Acc Id:

NR_029718

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	15	68,213,057 - 68,213,138 (-)	NCBI
GRCm38	15	68,341,208 - 68,341,289 (-)	ENTREZGENE
MGSCv37	15	68,172,770 - 68,172,851 (-)	RGD
Celera	15	69,857,252 - 69,857,333 (-)	RGD
cM Map	15		ENTREZGENE

Sequence:

show sequence

AAGTCTGTGTCTGTAAACATCCCCGACTGGAAGCTGTAAGCCACAGCCAAGCTTTCAGTCAGAT
GTTTGCTGCTACTGGCTC

hide sequence

Promoters

RGD ID:

8683898

Promoter ID:

EPDNEW_M19980

Type:

single initiation site

Name:

Mir30d_1

Description:

Mus musculus microRNA 30d , microRNA.

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm38	15	68,341,214 - 68,341,274	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:2676910	AgrOrtholog
Ensembl Genes	ENSMUSG00000065437	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083503	ENTREZGENE
MGD	MGI:2676910	ENTREZGENE
miRBase	MI0000549	ENTREZGENE
NCBI Gene	387228	ENTREZGENE
PhenoGen	Mir30d	PhenoGen
RNAcentral	URS000005CF5F	RNACentral
	URS00004B2A47	RNACentral
	URS000075B035	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - CTD