Mir302a (microRNA 302a) - Rat Genome Database

Name: Mir302a
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Gene: Mir302a (microRNA 302a) Mus musculus

Analyze

Symbol:

Mir302a

Name:

microRNA 302a

RGD ID:

1607602

MGI Page

MGI

Description:

Acts upstream of or within cellular response to leukemia inhibitory factor and lung development. Is expressed in blastocyst; embryo; epiblast; future brain; and lung. Orthologous to human MIR302A (microRNA 302a).

Type:

ncrna (Ensembl: miRNA)

RefSeq Status:

PROVISIONAL

Previously known as:

mir-302a; Mirn; Mirn302; Mirn302a; mmu-mir-3; mmu-mir-302

RGD Orthologs

Human

Dog

Alliance Genes

More Info

more info ...

Latest Assembly:

GRCm39 - Mouse Genome Assembly GRCm39

Position:

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	3	127,339,145 - 127,339,213 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	3	127,339,145 - 127,339,213 (+)	Ensembl		GRCm39 Ensembl
GRCm38	3	127,545,496 - 127,545,564 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	3	127,545,496 - 127,545,564 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	3	127,248,414 - 127,248,482 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	3	134,035,048 - 134,035,116 (+)	NCBI		Celera
Cytogenetic Map	3	G2	NCBI
cM Map	3	56.54	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

aniridia (ISO)

Axenfeld-Rieger syndrome type 1 (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

17beta-estradiol (ISO)

3-\{1-[3-(dimethylamino)propyl]-1H-indol-3-yl\}-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione (ISO)

all-trans-retinoic acid (ISO)

bis(2-ethylhexyl) phthalate (EXP)

cadmium atom (EXP)

cadmium dichloride (EXP)

catechol (EXP)

chloroform (EXP)

ethanol (ISO)

paraquat (ISO)

progesterone (ISO)

silver atom (ISO)

silver(0) (ISO)

sodium arsenite (ISO)

streptozocin (EXP)

tributyl phosphate (EXP)

trichloroethene (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

cellular response to leukemia inhibitory factor (IEP)

cellular response to low-density lipoprotein particle stimulus (ISO)

cellular response to virus (ISO)

cholesterol homeostasis (ISO)

lung development (IGI)

miRNA-mediated gene silencing by mRNA destabilization (ISO)

miRNA-mediated post-transcriptional gene silencing (ISO)

negative regulation of cholesterol efflux (ISO)

negative regulation of cytokine production involved in immune response (ISO)

negative regulation of epithelial cell differentiation (ISO)

Molecular Function

mRNA base-pairing translational repressor activity (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:12919684	PMID:16381832	PMID:17369397	PMID:17604727	PMID:18452032	PMID:18710938	PMID:19363475	PMID:19559694	PMID:20215419	PMID:20413612	PMID:20439489	PMID:21037258
PMID:21267068	PMID:21350014	PMID:21454525	PMID:21490602	PMID:21770019	PMID:22384170	PMID:22735451	PMID:22828209	PMID:23821545	PMID:24040406	PMID:24578347	PMID:24630794
PMID:25109777	PMID:25147827	PMID:25184675	PMID:25215426	PMID:25501598	PMID:25524771	PMID:25787764	PMID:25922934	PMID:26107383	PMID:26212322	PMID:26441343	PMID:29141234
PMID:29174574	PMID:29556338	PMID:30971494	PMID:32694755	PMID:32866521	PMID:33066028	PMID:33117356	PMID:33663221	PMID:34409030	PMID:36724256

Genomics

Comparative Map Data

Mir302a
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	3	127,339,145 - 127,339,213 (+)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	3	127,339,145 - 127,339,213 (+)	Ensembl		GRCm39 Ensembl
GRCm38	3	127,545,496 - 127,545,564 (+)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	3	127,545,496 - 127,545,564 (+)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	3	127,248,414 - 127,248,482 (+)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
Celera	3	134,035,048 - 134,035,116 (+)	NCBI		Celera
Cytogenetic Map	3	G2	NCBI
cM Map	3	56.54	NCBI

MIR302A
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	4	112,648,183 - 112,648,251 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	4	112,648,183 - 112,648,251 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	4	113,569,339 - 113,569,407 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	4	113,788,787 - 113,788,855 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Celera	4	110,863,432 - 110,863,500 (-)	NCBI		Celera
Cytogenetic Map	4	q25	NCBI
HuRef	4	109,297,759 - 109,297,827 (-)	NCBI		HuRef
CHM1_1	4	113,545,831 - 113,545,899 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	4	115,956,523 - 115,956,591 (-)	NCBI		T2T-CHM13v2.0

MIR302A
(Canis lupus familiaris - dog)

Dog Assembly	Chr	Position (strand)	Source	Genome Browsers
Dog Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
CanFam3.1	32	32,429,209 - 32,429,277 (-)	NCBI	CanFam3.1	CanFam3.1	canFam3	CanFam3.1
CanFam3.1 Ensembl	32	32,429,209 - 32,429,277 (-)	Ensembl	CanFam3.1		canFam3	CanFam3.1
Dog10K_Boxer_Tasha	32	9,602,472 - 9,602,540 (+)	NCBI		Dog10K_Boxer_Tasha
ROS_Cfam_1.0	32	32,655,014 - 32,655,082 (-)	NCBI		ROS_Cfam_1.0
UMICH_Zoey_3.1	32	32,637,694 - 32,637,762 (-)	NCBI		UMICH_Zoey_3.1
UNSW_CanFamBas_1.0	32	32,399,626 - 32,399,694 (-)	NCBI		UNSW_CanFamBas_1.0
UU_Cfam_GSD_1.0	32	7,460,915 - 7,460,983 (+)	NCBI		UU_Cfam_GSD_1.0

Variants

Variants in Mir302a
1 total Variants

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	20561
Count of gene targets:	8337
Count of transcripts:	13499
Interacting mature miRNAs:	mmu-miR-302a-3p, mmu-miR-302a-5p
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (GRCm39)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
26884436	Zlq3_m	zygomatic length QTL 3, 10 week (mouse)					3	3265060	142405761	Mouse
13207570	Tcq12_m	total cholesterol QTL 12 (mouse)					3	16504164	130163649	Mouse
1302056	Orgwq4_m	organ weight QTL 4 (mouse)			Not determined		3	30067588	147304689	Mouse
1301705	Sles3_m	systemic lupus erythmatosus suppressor 3 (mouse)			Not determined		3	37174862	143353183	Mouse
26884382	Bzwq1_m	bi-zygomatic width QTL 1, 5 week (mouse)					3	52207421	137205761	Mouse
25314313	Syncl1_m	synaptonemal complex length 1 (mouse)					3	67907333	128393649	Mouse
4142178	Ctrq2_m	C. trachomatis resistance QTL 2 (mouse)			Not determined		3	89139967	137453008	Mouse
27226732	Tibmd3_m	tibia midshaft diameter 3, 10 week (mouse)					3	96607316	147805636	Mouse
10043955	Wt10q4_m	body weight, 10 weeks, QTL 4 (mouse)			Not determined		3	98624041	132624197	Mouse
11533920	Mvb3_m	modifier of vibrator 3 (mouse)					3	98635284	132635383	Mouse
12792984	Modn1_m	modifier of Dstn neovascularization 1 (mouse)					3	98635284	132635383	Mouse
1302114	Tbs1_m	tuberculosis severity 1 (mouse)			Not determined		3	98924105	132924250	Mouse
1300752	Ap6q_m	alcohol preference 6 QTL (mouse)			Not determined		3	100372912	147045722	Mouse
26884419	Bzwq6_m	bi-zygomatic width QTL 6, 10 week (mouse)					3	100607316	137205761	Mouse
27226733	Tibmd6_m	tibia midshaft diameter 6, 16 week (mouse)					3	101307316	149805637	Mouse
1301805	Mors2_m	modifier of obesity related sterility 2 (mouse)			Not determined		3	103482659	137482783	Mouse
1302093	Orgwq5_m	organ weight QTL 5 (mouse)			Not determined		3	107376936	147304689	Mouse
1300619	Cdcs1_m	cytokine deficiency colitis susceptibility 1 (mouse)			Not determined		3	109834882	143835005	Mouse
12910793	Pwbwq7_m	post-weaning body weight QTL 7 (mouse)					3	110084357	135715812	Mouse
12910796	Pwbwq6_m	post-weaning body weight QTL 6 (mouse)					3	110084357	135715812	Mouse
12910815	Ogrq1_m	overall growth rate QTL 1 (mouse)					3	110084357	135715812	Mouse
1301381	Bomb1_m	bone marrow pre-B 1 (mouse)			Not determined		3	111133243	145133417	Mouse
1301100	Bdt2_m	bone density traits 2 (mouse)			Not determined		3	114736617	148736784	Mouse
10043919	Afpq8_m	abdominal fat percent QTL 8 (mouse)			Not determined		3	119057332	153057456	Mouse
1558868	Ses9_m	salmonella enteritidis susceptibility 9 (mouse)			Not determined		3	119057332	153057456	Mouse
4141935	Tgq15_m	triglyceride QTL 15 (mouse)			Not determined			119318586	153318586	Mouse
4142449	Tgq14_m	triglyceride QTL 14 (mouse)			Not determined			119318586	153318586	Mouse
1302151	Lprm2_m	lymphoproliferation modifier 2 (mouse)			Not determined		3	119778857	153779044	Mouse
10412240	Alpq6_m	alcohol preference QTL 6 (mouse)			Not determined		3	120772078	154772078	Mouse
26884415	Bzwq11_m	bi-zygomatic width QTL 11, 16 week (mouse)					3	124993649	137205761	Mouse
4142245	Pstc1_m	periosteal circumference 1 (mouse)			Not determined		3	126270248	159745316	Mouse
1301218	Letohc1_m	low ethanol consumption 1 (mouse)			Not determined		3	126352986	159745316	Mouse
1301347	Fpli_m	fasting plasma insulin (mouse)			Not determined		3	126460514	159745316	Mouse

Expression

Sequence

Nucleotide Sequences


RefSeq Transcripts	NR_029653	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC113952	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	LM608444	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

RefSeq Acc Id:

ENSMUST00000083618

Type:

CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39 Ensembl	3	127,339,145 - 127,339,213 (+)	Ensembl
GRCm38.p6 Ensembl	3	127,545,496 - 127,545,564 (+)	Ensembl

RefSeq Acc Id:

NR_029653

RefSeq Status:

PROVISIONAL

Type:

NON-CODING

Position:

Mouse Assembly	Chr	Position (strand)	Source
GRCm39	3	127,339,145 - 127,339,213 (+)	NCBI
GRCm38	3	127,545,496 - 127,545,564 (+)	ENTREZGENE
MGSCv37	3	127,248,414 - 127,248,482 (+)	RGD
Celera	3	134,035,048 - 134,035,116 (+)	RGD
cM Map	3		ENTREZGENE

Sequence:

show sequence

CCACCACTTAAACGTGGTTGTACTTGCTTTAGACCTAAGAAAGTAAGTGCTTCCATGTTTTGGT
GATGG

hide sequence

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	MGI:3619325	AgrOrtholog
Ensembl Genes	ENSMUSG00000065552	Ensembl, ENTREZGENE
Ensembl Transcript	ENSMUST00000083618	ENTREZGENE
MGD	MGI:3619325	ENTREZGENE
miRBase	MI0000402	ENTREZGENE
NCBI Gene	723920	ENTREZGENE
PhenoGen	Mir302a	PhenoGen
RNAcentral	URS0000070CD2	RNACentral
	URS00002DA33E	RNACentral
	URS000069A308	RNACentral

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - ClinVar