Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Pathways

Strain: DA-Tyrem1Kyo

Symbol: DA-Tyrem1Kyo
Strain: DA-Tyrem1
Substrain: Kyo
RGD ID: 8552298
Citation ID: RRID:RGD_8552298
Ontology ID: RS:0003724
Alleles: Tyrem1Kyo;   Tyr
Variant(s): Tyrem1Kyo-var1
Also Known As: DA albino; NBRP Rat No: 0666; DA-Tyrem1Kyo; DA-Tyr^[em1Kyo]
Type: mutant
Available Source: National BioResource Project for the Rat in Japan
Origination: National BioResource Project for the Rat in Japan
Description: The strain having a Endonuclease-induced 29-bp deletion mutation in Tyr gene was established by TALENs combined with Exonuclease 1.
Coat Color: albino
Inbred Generations: F2
Last Known Status: Cryopreserved Sperm (as of 2017-03-17)
Research Usage Behavior; Dermatology
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr81150,527,687 - 150,622,857RGD_MAPPER_PIPELINE
mRatBN7.21141,201,016 - 141,201,044RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01151,097,612 - 151,097,640RGD_MAPPER_PIPELINERnor_6.0
Rnor_5.01157,322,968 - 157,416,594RGD_MAPPER_PIPELINERnor_5.0
RGSC_v3.41143,641,257 - 143,746,315RGD_MAPPER_PIPELINERGSC_v3.4





Disease Annotations     Click to see Annotation Detail View
Albinism  (IMP)

Phenotype Annotations     Click to see Annotation Detail View

Mammalian Phenotype

References

References - curated
# Reference Title Reference Citation
1. Efficient gene targeting by TAL effector nucleases coinjected with exonucleases in zygotes. Mashimo T, etal., Sci Rep. 2013;3:1253. doi: 10.1038/srep01253. Epub 2013 Feb 13.
2. Strains registered by the National Bio Resource Project for the Rat in Japan Personal Communication with NBRP
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Tyrem1Kyo-var1 chr1 141201016 141201044 AGTGGTCCCTCAGGTGTTCCATCACATAA - deletion mRatBN7.2
Tyrem1Kyo-var1 chr1 151097612 151097640 AGTGGTCCCTCAGGTGTTCCATCACATAA - deletion Rnor_6.0

Additional Information