Symbol:
Hip1r
Name:
huntingtin interacting protein 1 related
RGD ID:
621615
Description:
Predicted to enable several functions, including SH3 domain binding activity; phosphatidylinositol phosphate binding activity; and protein dimerization activity. Involved in postsynapse organization. Is active in glutamatergic synapse and postsynaptic endocytic zone. Orthologous to human HIP1R (huntingtin interacting protein 1 related); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine.
Type:
protein-coding
RefSeq Status:
VALIDATED
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 12 38,251,085 - 38,279,756 (-) NCBI GRCr8 mRatBN7.2 12 32,590,164 - 32,618,841 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 12 32,590,165 - 32,618,734 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 12 33,768,901 - 33,797,424 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 12 34,380,245 - 34,408,769 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 12 33,432,136 - 33,460,662 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 12 38,024,517 - 38,053,184 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 12 38,024,519 - 38,053,085 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 12 39,895,504 - 39,924,082 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 12 33,714,225 - 33,742,792 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 12 33,577,648 - 33,606,180 (-) NCBI Celera 12 34,277,732 - 34,306,331 (-) NCBI Celera Cytogenetic Map 12 q15 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Hip1r Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of HIP1R mRNA] CTD PMID:31150632 Hip1r Rat (1->4)-beta-D-glucan multiple interactions ISO Hip1r (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of HIP1R mRNA CTD PMID:36331819 Hip1r Rat 1,2-dimethylhydrazine increases expression ISO Hip1r (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of HIP1R mRNA CTD PMID:22206623 Hip1r Rat 17beta-estradiol decreases expression EXP 6480464 Estradiol results in decreased expression of HIP1R mRNA CTD PMID:32145629 Hip1r Rat 17beta-estradiol increases expression ISO Hip1r (Mus musculus) 6480464 Estradiol results in increased expression of HIP1R mRNA CTD PMID:39298647 Hip1r Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO HIP1R (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Hip1r Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Hip1r (Mus musculus) 6480464 [Tetrachlorodibenzodioxin binds to AHR protein] which results in decreased expression of HIP1R mRNA and [TIPARP gene mutant form results in increased susceptibility to Tetrachlorodibenzodioxin] which results in decreased expression of HIP1R mRNA CTD PMID:16214954 and PMID:25975270 Hip1r Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of HIP1R mRNA CTD PMID:33387578 Hip1r Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression EXP 6480464 Tetrachlorodibenzodioxin results in decreased expression of HIP1R mRNA CTD PMID:32109520 Hip1r Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Hip1r (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of HIP1R mRNA CTD PMID:21570461 Hip1r Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO Hip1r (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in decreased expression of HIP1R mRNA CTD PMID:19770486 Hip1r Rat 2,4,6-tribromophenol decreases expression ISO HIP1R (Homo sapiens) 6480464 2 more ... CTD PMID:31675489 Hip1r Rat 2,4-dinitrotoluene affects expression EXP 6480464 2 and 4-dinitrotoluene affects the expression of HIP1R mRNA CTD PMID:21346803 Hip1r Rat 2,6-dimethoxyphenol multiple interactions ISO HIP1R (Homo sapiens) 6480464 [Sodium Chloride co-treated with pyrogallol 1 more ... CTD PMID:38598786 Hip1r Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of HIP1R mRNA CTD PMID:21346803 Hip1r Rat 3,3',5,5'-tetrabromobisphenol A decreases expression ISO HIP1R (Homo sapiens) 6480464 tetrabromobisphenol A results in decreased expression of HIP1R protein CTD PMID:31675489 Hip1r Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO HIP1R (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of HIP1R mRNA more ... CTD PMID:28628672 Hip1r Rat 4,4'-sulfonyldiphenol multiple interactions ISO HIP1R (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol S] results in decreased expression of HIP1R mRNA CTD PMID:28628672 Hip1r Rat 4,4'-sulfonyldiphenol multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of HIP1R mRNA CTD PMID:36041667 Hip1r Rat 4,4'-sulfonyldiphenol increases expression ISO Hip1r (Mus musculus) 6480464 bisphenol S results in increased expression of HIP1R mRNA CTD PMID:39298647 Hip1r Rat 4-hydroxyphenyl retinamide increases expression ISO Hip1r (Mus musculus) 6480464 Fenretinide results in increased expression of HIP1R mRNA CTD PMID:28973697 Hip1r Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of HIP1R mRNA CTD PMID:24780913 Hip1r Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of HIP1R mRNA CTD PMID:31881176 Hip1r Rat acrolein multiple interactions ISO HIP1R (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of HIP1R mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of HIP1R mRNA CTD PMID:32699268 Hip1r Rat acrylamide increases expression EXP 6480464 Acrylamide results in increased expression of HIP1R mRNA CTD PMID:28959563 Hip1r Rat aflatoxin B1 increases expression ISO Hip1r (Mus musculus) 6480464 Aflatoxin B1 results in increased expression of HIP1R mRNA CTD PMID:19770486 Hip1r Rat aflatoxin B1 increases expression EXP 6480464 Aflatoxin B1 results in increased expression of HIP1R mRNA CTD PMID:33354967 Hip1r Rat aflatoxin B1 increases methylation ISO HIP1R (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of HIP1R polyA tail CTD PMID:30157460 Hip1r Rat all-trans-retinoic acid increases expression EXP 6480464 Tretinoin results in increased expression of HIP1R mRNA CTD PMID:20488242 Hip1r Rat alpha-pinene multiple interactions ISO HIP1R (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of HIP1R mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of HIP1R mRNA CTD PMID:32699268 Hip1r Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of HIP1R mRNA CTD PMID:16483693 Hip1r Rat arsenous acid decreases response to substance ISO HIP1R (Homo sapiens) 6480464 HIP1R protein results in decreased susceptibility to Arsenic Trioxide CTD PMID:20707922 Hip1r Rat atrazine decreases expression ISO HIP1R (Homo sapiens) 6480464 Atrazine results in decreased expression of HIP1R mRNA CTD PMID:22378314 Hip1r Rat atrazine affects methylation EXP 6480464 Atrazine affects the methylation of HIP1R gene CTD PMID:28931070 Hip1r Rat benzo[a]pyrene decreases methylation ISO Hip1r (Mus musculus) 6480464 Benzo(a)pyrene results in decreased methylation of HIP1R intron CTD PMID:27901495 Hip1r Rat bis(2-ethylhexyl) phthalate increases expression ISO Hip1r (Mus musculus) 6480464 Diethylhexyl Phthalate results in increased expression of HIP1R mRNA CTD PMID:19850644 Hip1r Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Hip1r (Mus musculus) 6480464 PPARA protein promotes the reaction [Diethylhexyl Phthalate results in increased expression of HIP1R mRNA] CTD PMID:19850644 Hip1r Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of HIP1R mRNA CTD PMID:25181051 Hip1r Rat bisphenol A multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of HIP1R mRNA CTD PMID:36041667 Hip1r Rat bisphenol A decreases expression ISO HIP1R (Homo sapiens) 6480464 bisphenol A results in decreased expression of HIP1R protein CTD PMID:31675489 Hip1r Rat bisphenol A decreases expression ISO Hip1r (Mus musculus) 6480464 bisphenol A results in decreased expression of HIP1R mRNA CTD PMID:33221593 Hip1r Rat bisphenol A increases expression ISO Hip1r (Mus musculus) 6480464 bisphenol A results in increased expression of HIP1R mRNA CTD PMID:34585602 Hip1r Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of HIP1R mRNA CTD PMID:32145629 and PMID:34947998 Hip1r Rat bisphenol A multiple interactions ISO HIP1R (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of HIP1R mRNA CTD PMID:28628672 Hip1r Rat bisphenol F multiple interactions ISO HIP1R (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in decreased expression of HIP1R mRNA CTD PMID:28628672 Hip1r Rat bisphenol F multiple interactions EXP 6480464 [bisphenol A co-treated with bisphenol F co-treated with bisphenol S] results in decreased expression of HIP1R mRNA CTD PMID:36041667 Hip1r Rat C60 fullerene increases expression EXP 6480464 fullerene C60 results in increased expression of HIP1R mRNA CTD PMID:19167457 Hip1r Rat cadmium dichloride increases expression ISO HIP1R (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of HIP1R mRNA CTD PMID:26472689 Hip1r Rat cadmium sulfate multiple interactions ISO Hip1r (Mus musculus) 6480464 cadmium sulfate affects the reaction [MTF1 affects the expression of HIP1R mRNA] CTD PMID:16221973 Hip1r Rat capsaicin decreases expression EXP 6480464 Capsaicin results in decreased expression of HIP1R mRNA CTD PMID:20349343 Hip1r Rat chlorpyrifos decreases expression ISO Hip1r (Mus musculus) 6480464 Chlorpyrifos results in decreased expression of HIP1R mRNA CTD PMID:37019170 Hip1r Rat choline multiple interactions ISO Hip1r (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of HIP1R mRNA and [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of HIP1R gene CTD PMID:20938992 Hip1r Rat cisplatin multiple interactions ISO HIP1R (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of HIP1R mRNA CTD PMID:27392435 Hip1r Rat clobetasol decreases expression ISO Hip1r (Mus musculus) 6480464 Clobetasol results in decreased expression of HIP1R mRNA CTD PMID:27462272 Hip1r Rat cobalt dichloride decreases expression ISO HIP1R (Homo sapiens) 6480464 cobaltous chloride results in decreased expression of HIP1R mRNA CTD PMID:19320972 Hip1r Rat copper(II) chloride increases expression ISO HIP1R (Homo sapiens) 6480464 cupric chloride results in increased expression of HIP1R mRNA CTD PMID:38568856 Hip1r Rat cyclosporin A decreases expression EXP 6480464 Cyclosporine results in decreased expression of HIP1R mRNA CTD PMID:21865292 Hip1r Rat decabromodiphenyl ether decreases expression ISO HIP1R (Homo sapiens) 6480464 decabromobiphenyl ether results in decreased expression of HIP1R protein CTD PMID:31675489 Hip1r Rat dexamethasone multiple interactions ISO HIP1R (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of HIP1R mRNA more ... CTD PMID:28628672 Hip1r Rat diarsenic trioxide decreases response to substance ISO HIP1R (Homo sapiens) 6480464 HIP1R protein results in decreased susceptibility to Arsenic Trioxide CTD PMID:20707922 Hip1r Rat diazinon decreases expression EXP 6480464 Diazinon results in decreased expression of HIP1R mRNA CTD PMID:21968025 Hip1r Rat doxorubicin increases expression ISO HIP1R (Homo sapiens) 6480464 Doxorubicin results in increased expression of HIP1R mRNA CTD PMID:29803840 Hip1r Rat elemental selenium increases expression ISO HIP1R (Homo sapiens) 6480464 Selenium results in increased expression of HIP1R mRNA CTD PMID:19244175 Hip1r Rat endosulfan increases expression EXP 6480464 Endosulfan results in increased expression of HIP1R mRNA CTD PMID:29391264 Hip1r Rat epoxiconazole increases expression ISO Hip1r (Mus musculus) 6480464 epoxiconazole results in increased expression of HIP1R mRNA CTD PMID:35436446 Hip1r Rat ethanol multiple interactions ISO Hip1r (Mus musculus) 6480464 Ethanol affects the expression of and affects the splicing of HIP1R mRNA CTD PMID:30319688 Hip1r Rat fipronil increases expression EXP 6480464 fipronil results in increased expression of HIP1R mRNA CTD PMID:23962444 Hip1r Rat flavonoids increases expression EXP 6480464 Flavonoids results in increased expression of HIP1R mRNA CTD PMID:18035473 Hip1r Rat folic acid multiple interactions ISO Hip1r (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of HIP1R mRNA and [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of HIP1R gene CTD PMID:20938992 Hip1r Rat folic acid decreases expression ISO Hip1r (Mus musculus) 6480464 Folic Acid results in decreased expression of HIP1R mRNA CTD PMID:25629700 Hip1r Rat furfural multiple interactions ISO HIP1R (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of HIP1R protein CTD PMID:38598786 Hip1r Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of HIP1R mRNA CTD PMID:33387578 Hip1r Rat indometacin multiple interactions ISO HIP1R (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol A] results in decreased expression of HIP1R mRNA more ... CTD PMID:28628672 Hip1r Rat ivermectin decreases expression ISO HIP1R (Homo sapiens) 6480464 Ivermectin results in decreased expression of HIP1R protein CTD PMID:32959892 Hip1r Rat L-methionine multiple interactions ISO Hip1r (Mus musculus) 6480464 [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in decreased expression of HIP1R mRNA and [Methionine deficiency co-treated with Choline deficiency co-treated with Folic Acid deficiency] results in increased methylation of HIP1R gene CTD PMID:20938992 Hip1r Rat lipopolysaccharide multiple interactions ISO HIP1R (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of HIP1R mRNA CTD PMID:35811015 Hip1r Rat ozone multiple interactions ISO HIP1R (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of HIP1R mRNA more ... CTD PMID:32699268 Hip1r Rat paracetamol affects expression ISO Hip1r (Mus musculus) 6480464 Acetaminophen affects the expression of HIP1R mRNA CTD PMID:17562736 Hip1r Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of HIP1R mRNA CTD PMID:33387578 Hip1r Rat paracetamol increases expression ISO HIP1R (Homo sapiens) 6480464 Acetaminophen results in increased expression of HIP1R mRNA CTD PMID:22230336 Hip1r Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Hip1r (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of HIP1R mRNA CTD PMID:36331819 Hip1r Rat pirinixic acid decreases expression ISO Hip1r (Mus musculus) 6480464 pirinixic acid results in decreased expression of HIP1R mRNA CTD PMID:17426115 Hip1r Rat pirinixic acid increases expression ISO Hip1r (Mus musculus) 6480464 pirinixic acid results in increased expression of HIP1R mRNA CTD PMID:18301758 and PMID:18445702 Hip1r Rat progesterone affects expression ISO Hip1r (Mus musculus) 6480464 Progesterone affects the expression of HIP1R mRNA CTD PMID:17251523 Hip1r Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO HIP1R (Homo sapiens) 6480464 [S-(1 and 2-dichlorovinyl)cysteine affects the susceptibility to Lipopolysaccharides] which results in increased expression of HIP1R mRNA CTD PMID:35811015 Hip1r Rat selenium atom increases expression ISO HIP1R (Homo sapiens) 6480464 Selenium results in increased expression of HIP1R mRNA CTD PMID:19244175 Hip1r Rat silicon dioxide increases expression ISO Hip1r (Mus musculus) 6480464 Silicon Dioxide results in increased expression of HIP1R mRNA CTD PMID:23221170 Hip1r Rat sodium arsenite increases expression ISO HIP1R (Homo sapiens) 6480464 sodium arsenite results in increased expression of HIP1R mRNA CTD PMID:38568856 Hip1r Rat sodium chloride multiple interactions ISO HIP1R (Homo sapiens) 6480464 [Sodium Chloride co-treated with Furaldehyde] results in increased expression of and affects the localization of HIP1R protein more ... CTD PMID:38598786 Hip1r Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of HIP1R mRNA] CTD PMID:31150632 Hip1r Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of HIP1R mRNA CTD PMID:31150632 Hip1r Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of HIP1R mRNA CTD PMID:34492290 Hip1r Rat thiram increases expression ISO HIP1R (Homo sapiens) 6480464 Thiram results in increased expression of HIP1R mRNA CTD PMID:38568856 Hip1r Rat titanium dioxide decreases methylation ISO Hip1r (Mus musculus) 6480464 titanium dioxide results in decreased methylation of HIP1R gene CTD PMID:35295148 Hip1r Rat trichloroethene increases expression EXP 6480464 Trichloroethylene results in increased expression of HIP1R mRNA CTD PMID:33387578 Hip1r Rat troglitazone increases expression ISO Hip1r (Mus musculus) 6480464 troglitazone results in increased expression of HIP1R mRNA CTD PMID:28973697 Hip1r Rat trovafloxacin decreases expression ISO Hip1r (Mus musculus) 6480464 trovafloxacin results in decreased expression of HIP1R mRNA CTD PMID:35537566 Hip1r Rat tungsten decreases expression ISO Hip1r (Mus musculus) 6480464 Tungsten results in decreased expression of HIP1R mRNA CTD PMID:30912803 Hip1r Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of HIP1R mRNA CTD PMID:23034163
Molecular Function
Only show annotations with direct experimental evidence (0 objects hidden)
Hip1r Rat actin binding enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat actin binding enables IEA InterPro:IPR002558 and InterPro:IPR035964 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Hip1r Rat actin binding enables IEA UniProtKB-KW:KW-0009 1600115 GO_REF:0000043 UniProt GO_REF:0000043 Hip1r Rat actin binding enables ISO Hip1r (Mus musculus) 1624291 PMID:10613908 RGD PMID:10613908 Hip1r Rat actin filament binding enables ISO HIP1R (Homo sapiens) 1624291 PMID:16415883 RGD PMID:16415883 Hip1r Rat actin filament binding enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat actin filament binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat actin filament binding enables IBA MGI:1352504 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Hip1r Rat actin filament binding enables ISO Hip1r (Mus musculus) 1624291 PMID:11564758 and PMID:18790740 RGD PMID:11564758 and PMID:18790740 Hip1r Rat clathrin adaptor activity enables ISO Hip1r (Mus musculus) 1624291 PMID:11564758 RGD PMID:11564758 Hip1r Rat clathrin adaptor activity enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat clathrin adaptor activity enables IBA MGI:1352504 and PANTHER:PTN000045135 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Hip1r Rat clathrin binding enables ISO HIP1R (Homo sapiens) 1624291 PMID:14732715 RGD PMID:14732715 Hip1r Rat clathrin binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat clathrin binding enables IEA InterPro:IPR030224 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Hip1r Rat clathrin binding enables ISO Hip1r (Mus musculus) 1624291 PMID:11564758 RGD PMID:11564758 Hip1r Rat clathrin binding enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat clathrin light chain binding enables ISO Hip1r (Mus musculus) 1624291 UniProtKB:P04973 more ... RGD PMID:15533940 and PMID:18790740 Hip1r Rat clathrin light chain binding enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat clathrin light chain binding enables IBA MGI:1352504 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Hip1r Rat identical protein binding enables ISO HIP1R (Homo sapiens) 1624291 UniProtKB:O75146 and PMID:16415883 RGD PMID:16415883 Hip1r Rat identical protein binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat phosphatidylinositol binding enables ISO HIP1R (Homo sapiens) 1624291 PMID:14732715 RGD PMID:14732715 Hip1r Rat phosphatidylinositol binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat phosphatidylinositol-3,4,5-trisphosphate binding enables ISO HIP1R (Homo sapiens) 1624291 PMID:14732715 RGD PMID:14732715 Hip1r Rat phosphatidylinositol-3,4,5-trisphosphate binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat phosphatidylinositol-3,4-bisphosphate binding enables ISO HIP1R (Homo sapiens) 1624291 PMID:14732715 RGD PMID:14732715 Hip1r Rat phosphatidylinositol-3,4-bisphosphate binding enables IBA PANTHER:PTN000045135 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Hip1r Rat phosphatidylinositol-3,4-bisphosphate binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat phosphatidylinositol-3,5-bisphosphate binding enables ISO HIP1R (Homo sapiens) 1624291 PMID:14732715 RGD PMID:14732715 Hip1r Rat phosphatidylinositol-3,5-bisphosphate binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat phosphatidylinositol-3,5-bisphosphate binding enables IBA PANTHER:PTN000045135 more ... 1600115 GO_REF:0000033 GO_Central GO_REF:0000033 Hip1r Rat phosphatidylinositol-4,5-bisphosphate binding enables ISO HIP1R (Homo sapiens) 1624291 PMID:14732715 RGD PMID:14732715 Hip1r Rat phosphatidylinositol-4,5-bisphosphate binding enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat phospholipid binding enables IEA InterPro:IPR011417 1600115 GO_REF:0000002 InterPro GO_REF:0000002 Hip1r Rat protein binding enables ISO HIP1R (Homo sapiens) 1624291 UniProtKB:O00291 more ... RGD PMID:11889126 and PMID:19255499 Hip1r Rat protein binding enables ISO Hip1r (Mus musculus) 1624291 UniProtKB:G3V6K6 more ... RGD PMID:15090612 more ... Hip1r Rat protein binding enables ISO HIP1R (Homo sapiens) and UniProtKB:O75146-2 1624291 UniProtKB:O14777 more ... RGD PMID:32296183 Hip1r Rat protein heterodimerization activity enables ISO Hip1r (Mus musculus) 1624291 UniProtKB:O00291 and PMID:15533940 RGD PMID:15533940 Hip1r Rat protein heterodimerization activity enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat protein homodimerization activity enables ISO HIP1R (Homo sapiens) 1624291 UniProtKB:O75146 and PMID:16415883 RGD PMID:16415883 Hip1r Rat protein homodimerization activity enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat protein homodimerization activity enables ISO Hip1r (Mus musculus) 1624291 UniProtKB:Q9JKY5 more ... RGD PMID:11564758 more ... Hip1r Rat protein homodimerization activity enables IEA UniProtKB:O75146 and ensembl:ENSP000002530831600115 GO_REF:0000107 Ensembl GO_REF:0000107 Hip1r Rat SH3 domain binding enables ISO Hip1r (Mus musculus) 1624291 PMID:17318189 RGD PMID:17318189 Hip1r Rat SH3 domain binding enables IEA UniProtKB:Q9JKY5 and ensembl:ENSMUSP00000000939 1600115 GO_REF:0000107 Ensembl GO_REF:0000107
(+)-schisandrin B (EXP) (1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 17beta-estradiol (EXP,ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4,6-tribromophenol (ISO) 2,4-dinitrotoluene (EXP) 2,6-dimethoxyphenol (ISO) 2,6-dinitrotoluene (EXP) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (EXP,ISO) 4-hydroxyphenyl retinamide (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) acrolein (ISO) acrylamide (EXP) aflatoxin B1 (EXP,ISO) all-trans-retinoic acid (EXP) alpha-pinene (ISO) ammonium chloride (EXP) arsenous acid (ISO) atrazine (EXP,ISO) benzo[a]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) bisphenol F (EXP,ISO) C60 fullerene (EXP) cadmium dichloride (ISO) cadmium sulfate (ISO) capsaicin (EXP) chlorpyrifos (ISO) choline (ISO) cisplatin (ISO) clobetasol (ISO) cobalt dichloride (ISO) copper(II) chloride (ISO) cyclosporin A (EXP) decabromodiphenyl ether (ISO) dexamethasone (ISO) diarsenic trioxide (ISO) diazinon (EXP) doxorubicin (ISO) elemental selenium (ISO) endosulfan (EXP) epoxiconazole (ISO) ethanol (ISO) fipronil (EXP) flavonoids (EXP) folic acid (ISO) furfural (ISO) gentamycin (EXP) indometacin (ISO) ivermectin (ISO) L-methionine (ISO) lipopolysaccharide (ISO) ozone (ISO) paracetamol (EXP,ISO) perfluorooctane-1-sulfonic acid (ISO) pirinixic acid (ISO) progesterone (ISO) S-(1,2-dichlorovinyl)-L-cysteine (ISO) selenium atom (ISO) silicon dioxide (ISO) sodium arsenite (ISO) sodium chloride (ISO) tetrachloromethane (EXP) thioacetamide (EXP) thiram (ISO) titanium dioxide (ISO) trichloroethene (EXP) troglitazone (ISO) trovafloxacin (ISO) tungsten (ISO) vinclozolin (EXP)
Biological Process
actin filament organization (IBA) clathrin coat assembly (IBA,IEA,ISO) digestive system development (IEA,ISO) endocytosis (IBA,IEA) intrinsic apoptotic signaling pathway (IEA,ISO) membrane organization (IEA,ISO) negative regulation of actin filament polymerization (IEA,ISO) negative regulation of apoptotic process (IEA,ISO) negative regulation of Arp2/3 complex-mediated actin nucleation (IEA,ISO) positive regulation of clathrin coat assembly (IEA,ISO) positive regulation of epidermal growth factor receptor signaling pathway (IBA,IEA,ISO) positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (IEA,ISO) positive regulation of platelet-derived growth factor receptor-beta signaling pathway (IBA,IEA,ISO) postsynapse organization (IDA,IMP) protein stabilization (IEA,ISO) receptor-mediated endocytosis (IEA,ISO) regulation of actin cytoskeleton organization (IEA,ISO) regulation of apoptotic process (IBA) regulation of endocytosis (IEA,ISO) regulation of gastric acid secretion (IEA,ISO)
Cellular Component
apical plasma membrane (IEA,ISO) cell cortex (IEA,ISO) clathrin-coated pit (IEA,ISO) clathrin-coated vesicle (IBA,IEA,ISO) cortical actin cytoskeleton (IBA) cytoplasm (IEA) cytoskeleton (IEA,ISO) cytosol (IEA,ISO) glutamatergic synapse (IDA,IEP,IMP) intracellular membrane-bounded organelle (IEA,ISO) mitochondrion (IEA) perinuclear region of cytoplasm (IEA,ISO) plasma membrane (IEA,ISO) postsynapse (IDA,IEP) postsynaptic endocytic zone (IDA,IMP) ruffle membrane (IEA,ISO)
Molecular Function
actin binding (IEA,ISO) actin filament binding (IBA,IEA,ISO) clathrin adaptor activity (IBA,IEA,ISO) clathrin binding (IEA,ISO) clathrin light chain binding (IBA,IEA,ISO) identical protein binding (IEA,ISO) phosphatidylinositol binding (IEA,ISO) phosphatidylinositol-3,4,5-trisphosphate binding (IEA,ISO) phosphatidylinositol-3,4-bisphosphate binding (IBA,IEA,ISO) phosphatidylinositol-3,5-bisphosphate binding (IBA,IEA,ISO) phosphatidylinositol-4,5-bisphosphate binding (IEA,ISO) phospholipid binding (IEA) protein binding (ISO) protein heterodimerization activity (IEA,ISO) protein homodimerization activity (IEA,ISO) SH3 domain binding (IEA,ISO)
1.
Dynamics and nanoscale organization of the postsynaptic endocytic zone at excitatory synapses.
Catsburg LA, etal., Elife. 2022 Jan 24;11:e74387. doi: 10.7554/eLife.74387.
2.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
3.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
4.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
5.
Huntingtin-interacting protein-1-related protein of rat (rHIP1R) is localized in the postsynaptic regions.
Okano A, etal., Brain Res 2003 Mar 28;967(1-2):210-25.
6.
Huntingtin-Interacting Protein 1-Related Protein Plays a Critical Role in Dendritic Development and Excitatory Synapse Formation in Hippocampal Neurons.
Peng L, etal., Front Mol Neurosci. 2017 Jun 15;10:186. doi: 10.3389/fnmol.2017.00186. eCollection 2017.
7.
GOA pipeline
RGD automated data pipeline
8.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
9.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
Hip1r Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 12 38,251,085 - 38,279,756 (-) NCBI GRCr8 mRatBN7.2 12 32,590,164 - 32,618,841 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 12 32,590,165 - 32,618,734 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 12 33,768,901 - 33,797,424 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 12 34,380,245 - 34,408,769 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 12 33,432,136 - 33,460,662 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 12 38,024,517 - 38,053,184 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 12 38,024,519 - 38,053,085 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 12 39,895,504 - 39,924,082 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 12 33,714,225 - 33,742,792 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 12 33,577,648 - 33,606,180 (-) NCBI Celera 12 34,277,732 - 34,306,331 (-) NCBI Celera Cytogenetic Map 12 q15 NCBI
HIP1R Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 12 122,834,748 - 122,862,961 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 12 122,834,453 - 122,862,961 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 12 123,319,295 - 123,347,508 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 12 121,885,992 - 121,913,460 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Cytogenetic Map 12 q24.31 NCBI HuRef 12 120,292,995 - 120,307,523 (+) NCBI HuRef CHM1_1 12 123,288,408 - 123,315,480 (+) NCBI CHM1_1 T2T-CHM13v2.0 12 122,830,187 - 122,858,212 (+) NCBI T2T-CHM13v2.0
Hip1r Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 5 124,111,665 - 124,141,263 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 5 124,111,691 - 124,143,621 (+) Ensembl GRCm39 Ensembl GRCm38 5 123,973,602 - 124,003,215 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 5 123,973,628 - 124,005,558 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 5 124,423,637 - 124,453,224 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 5 124,234,257 - 124,263,818 (+) NCBI MGSCv36 mm8 Celera 5 121,036,606 - 121,075,804 (+) NCBI Celera Cytogenetic Map 5 F NCBI cM Map 5 63.3 NCBI
Hip1r Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955482 5,884,839 - 5,896,389 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955482 5,885,807 - 5,896,386 (-) NCBI ChiLan1.0 ChiLan1.0
HIP1R Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 10 130,927,935 - 130,956,881 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 12 130,924,306 - 130,953,266 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 12 120,438,841 - 120,467,489 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 12 124,672,109 - 124,700,726 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 12 124,685,091 - 124,700,726 (+) Ensembl panpan1.1 panPan2
HIP1R Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 26 6,623,583 - 6,639,107 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 26 6,624,791 - 6,637,659 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 26 6,785,375 - 6,813,922 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 26 6,872,729 - 6,901,296 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 26 6,873,942 - 6,901,454 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 26 6,805,561 - 6,834,112 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 26 6,898,281 - 6,926,838 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 26 6,851,903 - 6,880,452 (-) NCBI UU_Cfam_GSD_1.0
Hip1r Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405118 157,682,803 - 157,700,559 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936558 1,778,888 - 1,791,610 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936558 1,778,862 - 1,804,071 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
HIP1R Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 14 29,993,655 - 30,024,216 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 14 29,996,388 - 30,024,343 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 14 31,685,234 - 31,713,135 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
HIP1R Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 11 118,173,302 - 118,202,840 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 11 118,173,544 - 118,202,985 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666037 127,111,575 - 127,140,009 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Hip1r
.
Predicted Target Of
Count of predictions: 175 Count of miRNA genes: 123 Interacting mature miRNAs: 144 Transcripts: ENSRNOT00000034264 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
631560 Apr1 Acute phase response QTL 1 6.1 orosomucoid 1 amount (VT:0010541) plasma orosomucoid 1 level (CMO:0001467) 12 19144362 46669029 Rat 8552964 Pigfal17 Plasma insulin-like growth factor 1 level QTL 17 3.5 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564495 46669029 Rat 8693635 Alc28 Alcohol consumption QTL 28 2.7 0.439 drinking behavior trait (VT:0001422) calculated ethanol drink intake rate (CMO:0001615) 12 23081340 44726024 Rat 61324 Eae5 Experimental allergic encephalomyelitis QTL 5 14 nervous system integrity trait (VT:0010566) percentage of study population developing relapsing-remitting experimental autoimmune encephalomyelitis during a period of time (CMO:0001402) 12 19610870 46669029 Rat 9590147 Scort7 Serum corticosterone level QTL 7 13.61 0.001 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 12 1 42110980 Rat 1549829 Scl48 Serum cholesterol level QTL 48 5 blood cholesterol amount (VT:0000180) serum total cholesterol level (CMO:0000363) 12 9603277 46669029 Rat 737822 Alc10 Alcohol consumption QTL 10 2.2 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 12 19610870 40218516 Rat 2293684 Bmd26 Bone mineral density QTL 26 4.4 0.0002 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 12 15872653 32974238 Rat 70169 Eae13 Experimental allergic encephalomyelitis QTL 13 0.032 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 12 24139202 36638073 Rat 1600386 Calcic2 Intracellular calcium level QTL 2 0.001 platelet physiology trait (VT:0005464) platelet intracellular calcium level (CMO:0000922) 12 28064433 46669029 Rat 1302792 Scl21 Serum cholesterol level QTL 21 3.8 0.0011 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 12 7196730 46669029 Rat 1556747 Calcic1 Intracellular calcium level QTL 1 3.6 platelet calcium amount (VT:0010500) platelet intracellular calcium level (CMO:0000922) 12 28064433 40130419 Rat 631829 Alc6 Alcohol consumption QTL 6 4.7 consumption behavior trait (VT:0002069) ethanol drink intake rate (CMO:0001407) 12 28607526 37691617 Rat 8693658 Alc33 Alcohol consumption QTL 33 2.1 0.68 drinking behavior trait (VT:0001422) calculated ethanol drink intake rate (CMO:0001615) 12 23081340 43551788 Rat 1598855 Bp294 Blood pressure QTL 294 3.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 1 34851688 Rat 1331761 Bp218 Blood pressure QTL 218 2.973 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 12 11073825 45055165 Rat 8694179 Bw150 Body weight QTL 150 2.9 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 12 1 42110980 Rat 7411545 Bw128 Body weight QTL 128 5.2 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 12 1 42110980 Rat 7411547 Bw129 Body weight QTL 129 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 6 5564495 46669029 Rat 737979 Pia22 Pristane induced arthritis QTL 22 53.1 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 1 44465750 Rat 1298081 Cia25 Collagen induced arthritis QTL 25 4.7 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 19610889 35682913 Rat 2300186 Bmd59 Bone mineral density QTL 59 7.1 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 12 10474137 46669029 Rat 7411660 Foco28 Food consumption QTL 28 10.9 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 70213 Niddm27 Non-insulin dependent diabetes mellitus QTL 27 3.72 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 12 19835789 38193007 Rat 7411641 Foco19 Food consumption QTL 19 27.7 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 7411643 Foco20 Food consumption QTL 20 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 20328819 46669029 Rat 5684888 Pia42 Pristane induced arthritis QTL 42 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 19610870 42828880 Rat 1549912 Bp268 Blood pressure QTL 268 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 10 13182736 46669029 Rat 2302060 Pia37 Pristane induced arthritis QTL 37 6.1 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 12 13198157 46669029 Rat 1641928 Alcrsp5 Alcohol response QTL 5 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 12 12812385 46669029 Rat 1300162 Bp188 Blood pressure QTL 188 3.19 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 32103174 45899022 Rat 8552912 Pigfal6 Plasma insulin-like growth factor 1 level QTL 6 5 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564498 46669029 Rat 10059594 Kidm46 Kidney mass QTL 46 3.79 0.025 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 12 6107579 46669029 Rat 9590086 Insglur6 Insulin/glucose ratio QTL 6 18.97 0.001 blood insulin amount (VT:0001560) calculated plasma insulin level (CMO:0002170) 12 1 42110980 Rat 8552918 Pigfal7 Plasma insulin-like growth factor 1 level QTL 7 blood insulin-like growth factor amount (VT:0010479) plasma insulin-like growth factor 1 level (CMO:0001299) 12 5564495 46669029 Rat 1549902 Bp269 Blood pressure QTL 269 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 13182736 46669029 Rat 61404 Bw120 Body weight QTL 120 5.1 body mass (VT:0001259) body mass index (BMI) (CMO:0000105) 12 12351619 46669029 Rat 1300175 Cm5 Cardiac mass QTL 5 3.78 heart mass (VT:0007028) heart left ventricle weight to body weight ratio (CMO:0000530) 12 28064433 45899022 Rat 1331787 Rf41 Renal function QTL 41 2.998 kidney blood vessel physiology trait (VT:0100012) absolute change in renal blood flow rate (CMO:0001168) 12 28064557 40218380 Rat 2293699 Bss49 Bone structure and strength QTL 49 5.61 0.0001 lumbar vertebra size trait (VT:0010518) lumbar vertebra trabecular cross-sectional area (CMO:0001692) 12 10474137 46669029 Rat 634351 Apr5 Acute phase response QTL 5 6.7 blood interleukin-6 amount (VT:0008595) plasma interleukin-6 level (CMO:0001927) 12 1 44503507 Rat 634350 Apr4 Acute phase response QTL 4 6 orosomucoid 1 amount (VT:0010541) plasma orosomucoid 1 level (CMO:0001467) 12 1172005 46172005 Rat 7387292 Kidm42 Kidney mass QTL 42 3.03 0.0004 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 12 1 36247923 Rat 61421 Cia12 Collagen induced arthritis QTL 12 4.6 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 12 13635523 35682913 Rat 2303569 Gluco44 Glucose level QTL 44 2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 12 12812385 46669029 Rat 7411586 Foco5 Food consumption QTL 5 5.4 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 2303575 Insul14 Insulin level QTL 14 4 blood insulin amount (VT:0001560) blood insulin level (CMO:0000349) 12 1 42450532 Rat 7411588 Foco6 Food consumption QTL 6 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 2302042 Pia38 Pristane induced arthritis QTL 38 3.5 0.001 blood immunoglobulin amount (VT:0002460) serum immunoglobulin G1 level (CMO:0002115) 12 1 44503507 Rat 7411595 Foco9 Food consumption QTL 9 4 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 1 42110980 Rat 7411597 Foco10 Food consumption QTL 10 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 12 5564495 46669029 Rat 631543 Bp83 Blood pressure QTL 83 5.8 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 12 15550826 38478808 Rat
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000034264 ⟹ ENSRNOP00000029635
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 12 32,590,165 - 32,618,734 (-) Ensembl Rnor_6.0 Ensembl 12 38,024,519 - 38,053,085 (-) Ensembl
RefSeq Acc Id:
NM_001134763 ⟹ NP_001128235
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,654 (-) NCBI mRatBN7.2 12 32,590,164 - 32,618,734 (-) NCBI Rnor_6.0 12 38,024,518 - 38,053,085 (-) NCBI Rnor_5.0 12 39,895,504 - 39,924,082 (-) NCBI RGSC_v3.4 12 33,714,225 - 33,742,792 (-) RGD Celera 12 34,277,732 - 34,306,331 (-) RGD
Sequence:
CGCGCGGAGCCGGGCCGGGACAGGGTCGGCGGCAGCATGAACAGCATCAAGAATGTGCCGGCGCGGGTGCTGAGCCGCAGGCCGGGCCATAGCCTAGAGGCCGAGCGCGAGCAGTTCGACAAGACGCA
hide sequence
RefSeq Acc Id:
NM_031234 ⟹ NP_112513
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,654 (-) NCBI mRatBN7.2 12 32,590,164 - 32,618,734 (-) NCBI Rnor_6.0 12 38,024,518 - 38,053,085 (-) NCBI Rnor_5.0 12 39,895,504 - 39,924,082 (-) NCBI RGSC_v3.4 12 33,714,225 - 33,742,792 (-) RGD Celera 12 34,277,732 - 34,306,331 (-) RGD
Sequence:
CGCGCGGAGCCGGGCCGGGACAGGGTCGGCGGCAGCATGAACAGCATCAAGAATGTGCCGGCGC
hide sequence
RefSeq Acc Id:
XM_008769266 ⟹ XP_008767488
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,755 (-) NCBI mRatBN7.2 12 32,590,164 - 32,618,841 (-) NCBI Rnor_6.0 12 38,024,517 - 38,053,184 (-) NCBI
Sequence:
AGCCGGAGTGACTGGCGGGAGGGGCAGCGGCTCCTCCCCGTGCGGCGCGGCGCGCGGCCTCTGGGTGCCTAGGCTCGAGCCGGTCGGTGACGCCTCATTCGCGCGGAGCCGGGCCGGGACAGGGTCGG
hide sequence
RefSeq Acc Id:
XM_008769267 ⟹ XP_008767489
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,755 (-) NCBI mRatBN7.2 12 32,590,164 - 32,618,841 (-) NCBI Rnor_6.0 12 38,024,517 - 38,053,184 (-) NCBI
Sequence:
AGCCGGAGTGACTGGCGGGAGGGGCAGCGGCTCCTCCCCGTGCGGCGCGGCGCGCGGCCTCTGGGTGCCTAGGCTCGAGCCGGTCGGTGACGCCTCATTCGCGCGGAGCCGGGCCGGGACAGGGTCGG
hide sequence
RefSeq Acc Id:
XM_063271699 ⟹ XP_063127769
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,756 (-) NCBI
RefSeq Acc Id:
XM_063271700 ⟹ XP_063127770
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,756 (-) NCBI
RefSeq Acc Id:
XM_063271701 ⟹ XP_063127771
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,755 (-) NCBI
RefSeq Acc Id:
XM_063271702 ⟹ XP_063127772
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,279,755 (-) NCBI
RefSeq Acc Id:
XM_063271703 ⟹ XP_063127773
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 12 38,251,085 - 38,269,874 (-) NCBI
RefSeq Acc Id:
NP_112513 ⟸ NM_031234
- Peptide Label:
isoform 2
- UniProtKB:
B5DFK5 (UniProtKB/TrEMBL), Q99PW9 (UniProtKB/TrEMBL)
- Sequence:
MNSIKNVPARVLSRRPGHSLEAEREQFDKTQAISISKAINSQEAPVKEKHARRIILGTHHEKGAFTFWSYAIGLPLPSSSILSWKFCHVLHKVLRDGHPNVLHDCQRYRSNIREIGDLWGHLRDQYGH
hide sequence
RefSeq Acc Id:
NP_001128235 ⟸ NM_001134763
- Peptide Label:
isoform 1
- UniProtKB:
F1LML7 (UniProtKB/TrEMBL), Q99PW9 (UniProtKB/TrEMBL)
- Sequence:
MNSIKNVPARVLSRRPGHSLEAEREQFDKTQAISISKAINSQEAPVKEKHARRIILGTHHEKGA
hide sequence
RefSeq Acc Id:
XP_008767489 ⟸ XM_008769267
- Peptide Label:
isoform X6
- UniProtKB:
Q99PW9 (UniProtKB/TrEMBL)
- Sequence:
MNSIKNVPARVLSRRPGHSLEAEREQFDKTQAISISKAINSQEAPVKEKHARRIILGTHHEKGAFTFWSYAIGLPLPSSSILSWKFCHVLHKVLRDGHPNVLHDCQRYRSNIREIGDLWGHLRDQYGH
hide sequence
RefSeq Acc Id:
XP_008767488 ⟸ XM_008769266
- Peptide Label:
isoform X5
- UniProtKB:
Q99PW9 (UniProtKB/TrEMBL)
- Sequence:
MNSIKNVPARVLSRRPGHSLEAEREQFDKTQAISISKAINSQEAPVKEKHARRIILGTHHEKGA
hide sequence
Ensembl Acc Id:
ENSRNOP00000029635 ⟸ ENSRNOT00000034264
RefSeq Acc Id:
XP_063127770 ⟸ XM_063271700
- Peptide Label:
isoform X2
- UniProtKB:
Q99PW9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127769 ⟸ XM_063271699
- Peptide Label:
isoform X1
- UniProtKB:
Q99PW9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127772 ⟸ XM_063271702
- Peptide Label:
isoform X4
- UniProtKB:
Q99PW9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127771 ⟸ XM_063271701
- Peptide Label:
isoform X3
- UniProtKB:
Q99PW9 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063127773 ⟸ XM_063271703
- Peptide Label:
isoform X7
- UniProtKB:
A6J122 (UniProtKB/TrEMBL)
RGD ID: 13698620 Promoter ID: EPDNEW_R9145 Type: initiation region Name: Hip1r_1 Description: huntingtin interacting protein 1 related SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 12 38,053,088 - 38,053,148 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2004-09-10
Hip1r
huntingtin interacting protein 1 related
Symbol and Name status set to approved
1299863 APPROVED
2002-08-07
Hip1r
huntingtin interacting protein 1 related
Symbol and Name status set to provisional
70820 PROVISIONAL
Note Type
Note
Reference
gene_cellular_localization
localized to small vesicular structures in post-synaptic spines
708599
