Symbol:
Tshb
Name:
thyroid stimulating hormone subunit beta
RGD ID:
3910
Description:
Predicted to enable hormone activity. Involved in response to calcium ion; response to estrogen; and response to vitamin A. Predicted to be active in cytoplasm and extracellular space. Human ortholog(s) of this gene implicated in congenital nongoitrous hypothyroidism 4 and hypothyroidism. Orthologous to human TSHB (thyroid stimulating hormone subunit beta); PARTICIPATES IN autoimmune thyroiditis pathway; INTERACTS WITH 17beta-estradiol; 17beta-estradiol 3-benzoate; 2,2',4,4',5,5'-hexachlorobiphenyl.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
thyroid stimulating hormone beta subunit; thyroid stimulating hormone, beta; thyroid stimulating hormone, beta subunit; thyroid-stimulating hormone subunit beta; thyrotropin beta chain; thyrotropin subunit beta; TSH-B; TSH-beta
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
TSHB (thyroid stimulating hormone subunit beta) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Tshb (thyroid stimulating hormone, beta subunit) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Tshb (thyroid stimulating hormone subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
TSHB (thyroid stimulating hormone subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
TSHB (thyroid stimulating hormone subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Tshb (thyroid stimulating hormone subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
TSHB (thyroid stimulating hormone subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
TSHB (thyroid stimulating hormone subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Tshb (thyroid stimulating hormone subunit beta) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Alliance orthologs 3
Homo sapiens (human):
TSHB (thyroid stimulating hormone subunit beta)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Tshb (thyroid stimulating hormone, beta subunit)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
tshba (thyroid stimulating hormone, beta subunit, a)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 192,913,171 - 192,918,054 (-) NCBI GRCr8 mRatBN7.2 2 190,224,676 - 190,229,559 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 190,224,676 - 190,229,559 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 197,842,312 - 197,847,195 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 195,706,354 - 195,711,234 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 190,532,005 - 190,536,888 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 205,207,799 - 205,215,199 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 205,207,799 - 205,212,681 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 224,638,392 - 224,643,274 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 197,908,308 - 197,913,186 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 197,871,064 - 197,875,940 (-) NCBI Celera 2 182,644,695 - 182,649,578 (-) NCBI Celera RH 3.4 Map 2 1301.7 RGD Cytogenetic Map 2 q34 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Tshb Rat 15-deoxy-Delta(12,14)-prostaglandin J2 multiple interactions ISO TSHB (Homo sapiens) 6480464 15-deoxy-delta(12 and 14)-prostaglandin J2 promotes the reaction [TSHB protein results in increased expression of TG protein] CTD PMID:11078701 Tshb Rat 17beta-estradiol multiple interactions EXP 6480464 [Estradiol co-treated with bisphenol A] results in increased expression of TSHB mRNA more ... CTD PMID:16570238 more ... Tshb Rat 17beta-estradiol increases secretion EXP 6480464 Estradiol results in increased secretion of TSHB protein CTD PMID:29305326 Tshb Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of TSHB protein CTD PMID:32798586 Tshb Rat 17beta-estradiol multiple interactions ISO TSHB (Homo sapiens) 6480464 Estradiol inhibits the reaction [[TSHB protein results in increased activity of TSHR protein] which results in increased abundance of Cyclic AMP] CTD PMID:19766106 Tshb Rat 17beta-estradiol 3-benzoate increases expression EXP 6480464 estradiol 3-benzoate results in increased expression of TSHB protein CTD PMID:16570238 Tshb Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions EXP 6480464 [2 more ... CTD PMID:24878560 Tshb Rat 2,2',4,4'-Tetrabromodiphenyl ether multiple interactions ISO Tshb (Mus musculus) 6480464 [Triiodothyronine co-treated with 2 more ... CTD PMID:27420076 Tshb Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO Tshb (Mus musculus) 6480464 2 more ... CTD PMID:27420076 Tshb Rat 2,2',4,4'-Tetrabromodiphenyl ether decreases expression ISO Tshb (Mus musculus) 6480464 2 more ... CTD PMID:27420076 Tshb Rat 2,2',4,5-tetrachlorobiphenyl multiple interactions ISO TSHB (Homo sapiens) 6480464 2 more ... CTD PMID:19750101 Tshb Rat 2,3',4,4',5-Pentachlorobiphenyl multiple interactions ISO TSHB (Homo sapiens) 6480464 2 more ... CTD PMID:19750101 Tshb Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression EXP 6480464 2 more ... CTD PMID:36450500 Tshb Rat 2,3,4,3',4'-Pentachlorobiphenyl multiple interactions ISO TSHB (Homo sapiens) 6480464 2 more ... CTD PMID:19750101 Tshb Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression EXP 6480464 Tetrachlorodibenzodioxin results in increased expression of TSHB protein CTD PMID:11836014 Tshb Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Tshb (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of TSHB mRNA CTD PMID:24793433 Tshb Rat 2,4-Diaminoanisole increases expression EXP 6480464 4-methoxy-3-phenylenediamine results in increased expression of TSHB protein CTD PMID:2462517 and PMID:2731155 Tshb Rat 2-(3,4-dimethoxyphenyl)-5-\{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino\}-2-(propan-2-yl)pentanenitrile multiple interactions ISO TSHB (Homo sapiens) 6480464 Verapamil inhibits the reaction [TRH protein results in increased secretion of TSHB protein] CTD PMID:7851873 Tshb Rat 2-acetamidofluorene multiple interactions ISO Tshb (Mus musculus) 6480464 TRP53 protein modified form affects the reaction [2-Acetylaminofluorene results in increased expression of TSHB mRNA] CTD PMID:17317680 Tshb Rat 3',5'-cyclic AMP increases abundance ISO TSHB (Homo sapiens) 6480464 TSHB protein results in increased abundance of Cyclic AMP CTD PMID:21072367 Tshb Rat 3',5'-cyclic AMP multiple interactions ISO TSHB (Homo sapiens) 6480464 [Cobalt binds to dipyrido(3 more ... CTD PMID:19766106 more ... Tshb Rat 3,3',4,4',5-pentachlorobiphenyl increases expression EXP 6480464 3 more ... CTD PMID:17379623 Tshb Rat 3,3',5,5'-tetrabromobisphenol A increases expression EXP 6480464 tetrabromobisphenol A results in increased expression of TSHB mRNA CTD PMID:37487893 Tshb Rat 3,3',5-triiodo-L-thyronine decreases expression ISO Tshb (Mus musculus) 6480464 Triiodothyronine results in decreased expression of TSHB mRNA CTD PMID:27420076 and PMID:9092800 Tshb Rat 3,3',5-triiodo-L-thyronine multiple interactions ISO Tshb (Mus musculus) 6480464 [Triiodothyronine co-treated with 2 more ... CTD PMID:27420076 Tshb Rat 3,3',5-triiodo-L-thyronine decreases expression EXP 6480464 Triiodothyronine results in decreased expression of TSHB mRNA CTD PMID:28167136 and PMID:7827627 Tshb Rat 3,3',5-triiodo-L-thyronine increases secretion ISO TSHB (Homo sapiens) 6480464 TSHB protein results in increased secretion of Triiodothyronine CTD PMID:11288978 Tshb Rat 3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropanecarboxylic acid multiple interactions ISO TSHB (Homo sapiens) 6480464 [Insecticides results in increased abundance of 3-(2 more ... CTD PMID:31284115 Tshb Rat 3-phenoxybenzoic acid multiple interactions ISO TSHB (Homo sapiens) 6480464 [Insecticides results in increased abundance of 3-phenoxybenzoic acid] which results in increased expression of TSHB protein CTD PMID:31284115 Tshb Rat 4'-epidoxorubicin decreases expression EXP 6480464 Epirubicin results in decreased expression of TSHB protein CTD PMID:36822302 Tshb Rat 4'-epidoxorubicin multiple interactions EXP 6480464 3-(indol-3-yl)propionic acid inhibits the reaction [Epirubicin results in decreased expression of TSHB protein] CTD PMID:36822302 Tshb Rat 4,4'-sulfonyldiphenol decreases expression EXP 6480464 bisphenol S results in decreased expression of TSHB mRNA CTD PMID:28167136 Tshb Rat 4,4'-sulfonyldiphenol increases expression EXP 6480464 bisphenol S results in increased expression of TSHB mRNA CTD PMID:37487893 Tshb Rat 4,4'-sulfonyldiphenol decreases methylation ISO TSHB (Homo sapiens) 6480464 bisphenol S results in decreased methylation of TSHB gene CTD PMID:31601247 Tshb Rat 5-fluorouracil affects expression ISO TSHB (Homo sapiens) 6480464 Fluorouracil affects the expression of TSHB protein CTD PMID:17649788 Tshb Rat 6-propyl-2-thiouracil increases expression EXP 6480464 Propylthiouracil results in increased expression of TSHB protein CTD PMID:15862623 more ... Tshb Rat 6-propyl-2-thiouracil multiple interactions EXP 6480464 haizao yuhu inhibits the reaction [Propylthiouracil results in increased expression of TSHB protein] more ... CTD PMID:30814441 more ... Tshb Rat 9-cis-retinoic acid decreases expression ISO Tshb (Mus musculus) 6480464 Alitretinoin results in decreased expression of TSHB mRNA and Alitretinoin results in decreased expression of TSHB protein CTD PMID:16306084 and PMID:9092800 Tshb Rat aflatoxin B1 increases methylation ISO TSHB (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of TSHB gene CTD PMID:27153756 Tshb Rat alachlor increases expression EXP 6480464 alachlor results in increased expression of TSHB protein CTD PMID:8812207 Tshb Rat aldehydo-D-glucose multiple interactions ISO Tshb (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in decreased expression of TSHB mRNA CTD PMID:37567420 Tshb Rat alfacalcidol multiple interactions ISO TSHB (Homo sapiens) 6480464 alfacalcidol promotes the reaction [Methimazole results in increased expression of TSHB protein] CTD PMID:9322804 Tshb Rat all-trans-retinoic acid multiple interactions ISO TSHB (Homo sapiens) 6480464 Tretinoin inhibits the reaction [TSHB protein results in increased expression of SLC5A5 protein] CTD PMID:16439463 Tshb Rat allethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of TSHB protein CTD PMID:34896426 Tshb Rat amiodarone increases expression ISO TSHB (Homo sapiens) 6480464 Amiodarone results in increased expression of TSHB protein CTD PMID:1860199 Tshb Rat amiodarone increases expression EXP 6480464 Amiodarone results in increased expression of TSHB mRNA and Amiodarone results in increased expression of TSHB protein CTD PMID:12538616 and PMID:3427795 Tshb Rat amitriptyline multiple interactions ISO TSHB (Homo sapiens) 6480464 Amitriptyline inhibits the reaction [TRH protein results in decreased expression of TSHB protein] CTD PMID:6455462 Tshb Rat amitrole increases expression EXP 6480464 Amitrole results in increased expression of TSHB protein CTD PMID:34757178 Tshb Rat ammonium chloride affects expression EXP 6480464 Ammonium Chloride affects the expression of TSHB mRNA CTD PMID:16483693 Tshb Rat Aroclor 1254 multiple interactions EXP 6480464 Ascorbic Acid inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in decreased expression of TSHB protein] more ... CTD PMID:16298753 and PMID:33592256 Tshb Rat Aroclor 1254 increases expression EXP 6480464 Chlorodiphenyl (54% Chlorine) results in increased expression of TSHB protein CTD PMID:20655938 and PMID:33592256 Tshb Rat Aroclor 1254 decreases expression EXP 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of TSHB protein CTD PMID:16298753 Tshb Rat arsenous acid increases expression EXP 6480464 Arsenic Trioxide results in increased expression of TSHB protein CTD PMID:31258454 Tshb Rat ATP multiple interactions ISO TSHB (Homo sapiens) 6480464 Adenosine Triphosphate inhibits the reaction [TSHB protein results in increased expression of SLC5A5 protein] CTD PMID:16439463 Tshb Rat atrazine multiple interactions ISO TSHB (Homo sapiens) 6480464 [Pesticides results in increased abundance of Atrazine] which results in increased secretion of TSHB protein CTD PMID:31362416 Tshb Rat atropine multiple interactions EXP 6480464 [pralidoxime co-treated with Atropine] inhibits the reaction [methamidophos results in decreased expression of TSHB protein] CTD PMID:15891268 Tshb Rat benzo[a]pyrene increases expression EXP 6480464 Benzo(a)pyrene results in increased expression of TSHB mRNA CTD PMID:21839799 Tshb Rat benzo[b]fluoranthene decreases expression ISO Tshb (Mus musculus) 6480464 benzo(b)fluoranthene results in decreased expression of TSHB mRNA CTD PMID:26377693 Tshb Rat beta-hexachlorocyclohexane multiple interactions ISO TSHB (Homo sapiens) 6480464 beta-hexachlorocyclohexane affects the expression of and affects the secretion of TSHB protein CTD PMID:19750101 Tshb Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Tshb (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate] results in decreased expression of TSHB mRNA CTD PMID:22828881 Tshb Rat bis(2-ethylhexyl) phthalate increases expression EXP 6480464 Diethylhexyl Phthalate results in increased expression of TSHB mRNA and Diethylhexyl Phthalate results in increased expression of TSHB protein CTD PMID:33649816 and PMID:36714560 Tshb Rat bis(2-ethylhexyl) phthalate affects expression EXP 6480464 Diethylhexyl Phthalate affects the expression of TSHB protein CTD PMID:38522500 Tshb Rat bis(2-ethylhexyl) phthalate multiple interactions ISO TSHB (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono(2-ethyl-5-oxohexyl)phthalate] which results in decreased secretion of TSHB protein CTD PMID:29734584 Tshb Rat bis(2-ethylhexyl) phthalate increases secretion EXP 6480464 Diethylhexyl Phthalate results in increased secretion of TSHB protein CTD PMID:36005737 Tshb Rat bis(2-ethylhexyl) phthalate decreases expression EXP 6480464 Diethylhexyl Phthalate results in decreased expression of TSHB mRNA CTD PMID:33309551 Tshb Rat bisphenol A multiple interactions ISO TSHB (Homo sapiens) 6480464 bisphenol A inhibits the reaction [[TSHB protein results in increased activity of TSHR protein] which results in increased abundance of Cyclic AMP] CTD PMID:19766106 Tshb Rat bisphenol A increases secretion EXP 6480464 bisphenol A results in increased secretion of TSHB protein CTD PMID:29305326 Tshb Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of TSHB mRNA CTD PMID:31697385 more ... Tshb Rat bisphenol A multiple interactions EXP 6480464 [Estradiol co-treated with bisphenol A] results in increased expression of TSHB mRNA and bisphenol A inhibits the reaction [TRH protein results in increased secretion of TSHB protein] CTD PMID:29305326 and PMID:30099086 Tshb Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of TSHB mRNA CTD PMID:25181051 more ... Tshb Rat bisphenol A multiple interactions ISO Tshb (Mus musculus) 6480464 [bisphenol A co-treated with Diethylhexyl Phthalate] results in decreased expression of TSHB mRNA CTD PMID:22828881 Tshb Rat bisphenol AF decreases expression EXP 6480464 bisphenol AF results in decreased expression of TSHB mRNA CTD PMID:30099086 Tshb Rat bisphenol AF multiple interactions EXP 6480464 [Estradiol co-treated with bisphenol AF] results in increased expression of TSHB mRNA CTD PMID:30099086 Tshb Rat bisphenol F decreases expression EXP 6480464 4 and 4'-bisphenol F results in decreased expression of TSHB mRNA CTD PMID:28167136 Tshb Rat Butylparaben increases expression EXP 6480464 butylparaben results in increased expression of TSHB protein CTD PMID:32798586 Tshb Rat cadmium atom decreases expression EXP 6480464 Cadmium results in decreased expression of TSHB mRNA CTD PMID:16948784 Tshb Rat cadmium atom multiple interactions EXP 6480464 Melatonin inhibits the reaction [Cadmium results in decreased expression of TSHB mRNA] CTD PMID:16948784 Tshb Rat cadmium dichloride affects expression EXP 6480464 Cadmium Chloride affects the expression of TSHB mRNA and Cadmium Chloride affects the expression of TSHB protein CTD PMID:20652474 and PMID:23085516 Tshb Rat cadmium dichloride multiple interactions EXP 6480464 [Hydrocarbons more ... CTD PMID:12011480 more ... Tshb Rat cadmium dichloride decreases expression EXP 6480464 Cadmium Chloride results in decreased expression of TSHB mRNA CTD PMID:16948784 Tshb Rat carbendazim increases expression EXP 6480464 carbendazim results in increased expression of TSHB protein CTD PMID:33965443 Tshb Rat chlorohydrocarbon multiple interactions EXP 6480464 [Hydrocarbons and Chlorinated co-treated with Cadmium Chloride co-treated with lead chloride] results in increased expression of TSHB protein CTD PMID:12011480 Tshb Rat chlorpyrifos increases expression ISO Tshb (Mus musculus) 6480464 Chlorpyrifos results in increased expression of TSHB mRNA CTD PMID:36769379 Tshb Rat cisplatin multiple interactions EXP 6480464 Resveratrol inhibits the reaction [Cisplatin results in decreased expression of TSHB protein] CTD PMID:33587916 Tshb Rat cisplatin decreases expression EXP 6480464 Cisplatin results in decreased expression of TSHB protein CTD PMID:33587916 Tshb Rat clofibrate multiple interactions EXP 6480464 Clofibrate inhibits the reaction [Thyroxine results in decreased expression of TSHB protein] CTD PMID:18219302 Tshb Rat cobalt atom multiple interactions ISO TSHB (Homo sapiens) 6480464 [Cobalt binds to dipyrido(3 more ... CTD PMID:21072367 Tshb Rat cyclohexane decreases expression EXP 6480464 Cyclohexane results in decreased expression of TSHB protein CTD PMID:37944760 Tshb Rat cyhalothrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of TSHB protein CTD PMID:34896426 Tshb Rat cypermethrin multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of TSHB protein CTD PMID:34896426 Tshb Rat D-glucose multiple interactions ISO Tshb (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in decreased expression of TSHB mRNA CTD PMID:37567420 Tshb Rat DDE multiple interactions EXP 6480464 [2 more ... CTD PMID:24878560 Tshb Rat DDE multiple interactions ISO TSHB (Homo sapiens) 6480464 Dichlorodiphenyl Dichloroethylene affects the expression of and affects the secretion of TSHB protein CTD PMID:19750101 Tshb Rat decabromodiphenyl ether increases expression EXP 6480464 decabromobiphenyl ether results in increased expression of TSHB protein CTD PMID:20686340 Tshb Rat decabromodiphenyl ether increases secretion EXP 6480464 decabromobiphenyl ether results in increased secretion of TSHB protein CTD PMID:30844666 Tshb Rat dexamethasone multiple interactions EXP 6480464 Dexamethasone promotes the reaction [Disulfiram results in decreased secretion of TSHB protein] CTD PMID:9681491 Tshb Rat dexamethasone increases secretion EXP 6480464 Dexamethasone results in increased secretion of TSHB protein CTD PMID:9681491 Tshb Rat diarsenic trioxide increases expression EXP 6480464 Arsenic Trioxide results in increased expression of TSHB protein CTD PMID:31258454 Tshb Rat diethyl hydrogen phosphate decreases expression EXP 6480464 diethyl phosphate results in decreased expression of TSHB protein CTD PMID:31835022 Tshb Rat diethylstilbestrol multiple interactions ISO TSHB (Homo sapiens) 6480464 Diethylstilbestrol inhibits the reaction [[TSHB protein results in increased activity of TSHR protein] which results in increased abundance of Cyclic AMP] CTD PMID:19766106 Tshb Rat diiodine multiple interactions ISO TSHB (Homo sapiens) 6480464 efavirenz promotes the reaction [TSHB protein affects the abundance of Iodine] more ... CTD PMID:16030158 Tshb Rat diiodine multiple interactions EXP 6480464 [Iodine deficiency co-treated with sodium perchlorate] results in increased secretion of TSHB protein CTD PMID:30090431 Tshb Rat diiodine increases secretion EXP 6480464 Iodine deficiency results in increased secretion of TSHB protein CTD PMID:20882593 Tshb Rat diiodine affects abundance ISO TSHB (Homo sapiens) 6480464 TSHB protein affects the abundance of Iodine CTD PMID:16030158 Tshb Rat diisobutyl phthalate multiple interactions ISO TSHB (Homo sapiens) 6480464 [diisobutyl phthalate results in increased abundance of mono-isobutyl phthalate] which results in decreased secretion of TSHB protein CTD PMID:29734584 Tshb Rat dioxygen multiple interactions ISO Tshb (Mus musculus) 6480464 [NFE2L2 protein affects the susceptibility to Oxygen] which affects the expression of TSHB mRNA CTD PMID:30529165 Tshb Rat disodium selenite decreases expression ISO TSHB (Homo sapiens) 6480464 Sodium Selenite results in decreased expression of TSHB mRNA CTD PMID:18175754 Tshb Rat disulfiram multiple interactions EXP 6480464 Dexamethasone promotes the reaction [Disulfiram results in decreased secretion of TSHB protein] CTD PMID:9681491 Tshb Rat disulfiram decreases secretion EXP 6480464 Disulfiram results in decreased secretion of TSHB protein CTD PMID:9681491 Tshb Rat diuron multiple interactions ISO TSHB (Homo sapiens) 6480464 [Pesticides results in increased abundance of Diuron] which results in increased secretion of TSHB protein CTD PMID:31362416 Tshb Rat efavirenz multiple interactions ISO TSHB (Homo sapiens) 6480464 [efavirenz co-treated with TSHB protein] results in increased expression of SLC5A5 mRNA more ... CTD PMID:16030158 Tshb Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of TSHB mRNA and Endosulfan results in decreased expression of TSHB protein CTD PMID:20471459 Tshb Rat erythrosin B multiple interactions EXP 6480464 Erythrosine promotes the reaction [TRH protein results in increased expression of TSHB protein] CTD PMID:2160137 Tshb Rat fenvalerate multiple interactions EXP 6480464 [cypermethrin co-treated with decamethrin co-treated with fenvalerate co-treated with cyhalothrin co-treated with Allethrins] results in increased expression of TSHB protein CTD PMID:34896426 Tshb Rat fluoxetine increases expression EXP 6480464 Fluoxetine results in increased expression of TSHB mRNA CTD PMID:17033635 Tshb Rat fructose multiple interactions ISO Tshb (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in decreased expression of TSHB mRNA CTD PMID:37567420 Tshb Rat gallic acid multiple interactions EXP 6480464 Gallic Acid inhibits the reaction [Zearalenone results in decreased expression of TSHB protein] CTD PMID:34723416 Tshb Rat glucose multiple interactions ISO Tshb (Mus musculus) 6480464 [lard co-treated with Cholesterol and Dietary co-treated with Dietary Sucrose co-treated with Fructose co-treated with Glucose co-treated with Glyphosate] results in decreased expression of TSHB mRNA CTD PMID:37567420 Tshb Rat glyphosate decreases expression ISO Tshb (Mus musculus) 6480464 Glyphosate results in decreased expression of TSHB protein CTD PMID:33159990 Tshb Rat glyphosate multiple interactions ISO Tshb (Mus musculus) 6480464 [lard co-treated with Cholesterol more ... CTD PMID:33159990 and PMID:37567420 Tshb Rat glyphosate decreases expression EXP 6480464 Glyphosate results in decreased expression of TSHB protein CTD PMID:27916585 Tshb Rat glyphosate increases secretion EXP 6480464 Glyphosate results in increased secretion of TSHB protein CTD PMID:32145347 Tshb Rat hexachlorobenzene multiple interactions ISO TSHB (Homo sapiens) 6480464 Hexachlorobenzene affects the expression of and affects the secretion of TSHB protein CTD PMID:19750101 Tshb Rat hydrogen peroxide multiple interactions ISO Tshb (Mus musculus) 6480464 Acetylcysteine inhibits the reaction [TSHB protein results in increased abundance of Hydrogen Peroxide] more ... CTD PMID:11108245 Tshb Rat imidacloprid multiple interactions ISO Tshb (Mus musculus) 6480464 [mancozeb co-treated with imidacloprid] results in increased expression of TSHB protein CTD PMID:24530807 Tshb Rat iodide salt multiple interactions ISO TSHB (Homo sapiens) 6480464 [Iodides deficiency co-treated with perchlorate] results in increased expression of TSHB protein CTD PMID:20439182 Tshb Rat iodide salt increases expression EXP 6480464 Iodides deficiency results in increased expression of TSHB protein CTD PMID:18178547 and PMID:26795019 Tshb Rat L-ascorbic acid multiple interactions EXP 6480464 Ascorbic Acid inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in decreased expression of TSHB protein] CTD PMID:16298753 Tshb Rat lead diacetate multiple interactions EXP 6480464 lead acetate promotes the reaction [Zinc Oxide results in decreased secretion of TSHB protein] more ... CTD PMID:21871911 and PMID:34553816 Tshb Rat lead diacetate decreases secretion EXP 6480464 lead acetate results in decreased secretion of TSHB protein CTD PMID:34553816 Tshb Rat lead diacetate decreases expression EXP 6480464 lead acetate results in decreased expression of TSHB protein CTD PMID:21871911 Tshb Rat lead(II) chloride multiple interactions EXP 6480464 [Hydrocarbons and Chlorinated co-treated with Cadmium Chloride co-treated with lead chloride] results in increased expression of TSHB protein CTD PMID:12011480 Tshb Rat linalool decreases expression EXP 6480464 linalool results in decreased expression of TSHB mRNA CTD PMID:20536181 Tshb Rat lycopene multiple interactions EXP 6480464 Lycopene inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in increased expression of TSHB protein] CTD PMID:33592256 Tshb Rat mancozeb multiple interactions ISO Tshb (Mus musculus) 6480464 [mancozeb co-treated with imidacloprid] results in increased expression of TSHB protein CTD PMID:24530807 Tshb Rat masoprocol multiple interactions EXP 6480464 Masoprocol inhibits the reaction [TSHB protein results in increased expression of SLC5A5 mRNA] CTD PMID:17962351 Tshb Rat melatonin multiple interactions EXP 6480464 Melatonin inhibits the reaction [Cadmium Chloride affects the expression of TSHB] more ... CTD PMID:16948784 and PMID:23085516 Tshb Rat melatonin multiple interactions ISO Tshb (Mus musculus) 6480464 Melatonin inhibits the reaction [Glyphosate results in decreased expression of TSHB protein] CTD PMID:33159990 Tshb Rat methamidophos decreases expression EXP 6480464 methamidophos results in decreased expression of TSHB protein CTD PMID:15891268 Tshb Rat methamidophos multiple interactions EXP 6480464 [pralidoxime co-treated with Atropine] inhibits the reaction [methamidophos results in decreased expression of TSHB protein] CTD PMID:15891268 Tshb Rat methimazole increases expression ISO Tshb (Mus musculus) 6480464 Methimazole results in increased expression of TSHB protein CTD PMID:17332529 Tshb Rat methimazole multiple interactions EXP 6480464 Methimazole inhibits the reaction [TSHB protein results in increased expression of IYD mRNA] CTD PMID:30814441 Tshb Rat methimazole increases expression EXP 6480464 Methimazole results in increased expression of TSHB protein CTD PMID:20036711 and PMID:34757178 Tshb Rat methimazole increases expression ISO TSHB (Homo sapiens) 6480464 Methimazole results in increased expression of TSHB protein CTD PMID:9322804 Tshb Rat methimazole multiple interactions ISO TSHB (Homo sapiens) 6480464 alfacalcidol promotes the reaction [Methimazole results in increased expression of TSHB protein] CTD PMID:9322804 Tshb Rat methoxychlor affects expression EXP 6480464 Methoxychlor affects the expression of TSHB protein CTD PMID:2925022 Tshb Rat Methylthiouracil multiple interactions ISO Tshb (Mus musculus) 6480464 Methylthiouracil inhibits the reaction [lipopolysaccharide and Escherichia coli O111 B4 results in decreased secretion of TSHB protein] CTD PMID:26298005 Tshb Rat mono(2-ethyl-5-oxohexyl) phthalate multiple interactions ISO TSHB (Homo sapiens) 6480464 [Diethylhexyl Phthalate results in increased abundance of mono(2-ethyl-5-oxohexyl)phthalate] which results in decreased secretion of TSHB protein CTD PMID:29734584 Tshb Rat N,N-bis(2-hydroxypropyl)nitrosamine multiple interactions EXP 6480464 [diisopropanolnitrosamine co-treated with Potassium Iodide] results in increased expression of TSHB protein CTD PMID:29050248 Tshb Rat N-acetyl-L-cysteine multiple interactions ISO Tshb (Mus musculus) 6480464 Acetylcysteine inhibits the reaction [TSHB protein results in increased abundance of Hydrogen Peroxide] CTD PMID:11108245 Tshb Rat N-nitrosodiethylamine increases expression EXP 6480464 Diethylnitrosamine results in increased expression of TSHB protein CTD PMID:27565560 Tshb Rat N-Vinyl-2-pyrrolidone multiple interactions EXP 6480464 [N-vinyl-2-pyrrolidinone binds to N-vinyl-2-pyrrolidinone] which results in increased expression of TSHB protein CTD PMID:22037397 Tshb Rat nevirapine multiple interactions ISO TSHB (Homo sapiens) 6480464 [Nevirapine co-treated with TSHB protein] results in increased expression of SLC5A5 mRNA more ... CTD PMID:16030158 Tshb Rat nitrates increases expression ISO TSHB (Homo sapiens) 6480464 Nitrates results in increased expression of TSHB protein CTD PMID:20439182 Tshb Rat octreotide multiple interactions ISO TSHB (Homo sapiens) 6480464 Octreotide inhibits the reaction [TRH protein affects the activity of TSHB protein] CTD PMID:1518433 Tshb Rat octreotide decreases secretion ISO TSHB (Homo sapiens) 6480464 Octreotide results in decreased secretion of TSHB protein CTD PMID:1518433 and PMID:1518435 Tshb Rat Oxyfluorfen increases secretion EXP 6480464 oxyfluorofen results in increased secretion of TSHB protein CTD PMID:39495161 Tshb Rat ozone multiple interactions ISO Tshb (Mus musculus) 6480464 [Air Pollutants results in increased abundance of Ozone] which results in increased expression of TSHB mRNA and [NOTCH3 gene mutant form affects the susceptibility to Ozone] which results in increased expression of TSHB mRNA CTD PMID:25658374 and PMID:27106289 Tshb Rat ozone decreases secretion EXP 6480464 Ozone results in decreased secretion of TSHB protein CTD PMID:31397875 Tshb Rat paraquat multiple interactions ISO TSHB (Homo sapiens) 6480464 [Pesticides results in increased abundance of Paraquat] which results in increased secretion of TSHB protein CTD PMID:31362416 Tshb Rat PCB138 multiple interactions ISO TSHB (Homo sapiens) 6480464 2 more ... CTD PMID:19750101 Tshb Rat perchlorate increases expression ISO Tshb (Mus musculus) 6480464 perchlorate results in increased expression of TSHB protein CTD PMID:17332529 Tshb Rat perchlorate multiple interactions ISO TSHB (Homo sapiens) 6480464 [Iodides deficiency co-treated with perchlorate] results in increased expression of TSHB protein CTD PMID:20439182 Tshb Rat perchlorate increases expression ISO TSHB (Homo sapiens) 6480464 perchlorate results in increased expression of TSHB protein CTD PMID:20439182 Tshb Rat perfluorononanoic acid decreases secretion ISO TSHB (Homo sapiens) 6480464 perfluoro-n-nonanoic acid results in decreased secretion of TSHB protein CTD PMID:29488882 Tshb Rat perfluorooctane-1-sulfonic acid multiple interactions ISO TSHB (Homo sapiens) 6480464 perfluorooctane sulfonic acid results in decreased expression of and results in decreased secretion of TSHB protein CTD PMID:19750101 Tshb Rat perfluorooctane-1-sulfonic acid decreases secretion ISO TSHB (Homo sapiens) 6480464 perfluorooctane sulfonic acid results in decreased secretion of TSHB protein CTD PMID:29488882 Tshb Rat perfluorooctane-1-sulfonic acid increases secretion ISO TSHB (Homo sapiens) 6480464 perfluorooctane sulfonic acid results in increased secretion of TSHB protein CTD PMID:27219111 Tshb Rat perfluorooctanoic acid decreases secretion ISO TSHB (Homo sapiens) 6480464 perfluorooctanoic acid results in decreased secretion of TSHB protein CTD PMID:29488882 Tshb Rat perfluorooctanoic acid increases secretion ISO TSHB (Homo sapiens) 6480464 perfluorooctanoic acid results in increased secretion of TSHB protein CTD PMID:36174755 Tshb Rat perfluoroundecanoic acid increases expression EXP 6480464 perfluoroundecanoic acid results in increased expression of TSHB mRNA CTD PMID:33182161 Tshb Rat Pexacerfont multiple interactions EXP 6480464 Thyroxine inhibits the reaction [pexacerfont results in increased expression of TSHB protein] CTD PMID:33340518 Tshb Rat Pexacerfont increases expression EXP 6480464 pexacerfont results in increased expression of TSHB protein CTD PMID:33340518 Tshb Rat phenobarbital increases expression EXP 6480464 Phenobarbital results in increased expression of TSHB protein CTD PMID:22037397 and PMID:31270302 Tshb Rat pirinixic acid multiple interactions ISO TSHB (Homo sapiens) 6480464 [pirinixic acid binds to and results in increased activity of PPARA protein] which results in increased expression of TSHB mRNA CTD PMID:19710929 Tshb Rat potassium iodide multiple interactions EXP 6480464 [diisopropanolnitrosamine co-treated with Potassium Iodide] results in increased expression of TSHB protein more ... CTD PMID:27568464 and PMID:29050248 Tshb Rat pralidoxime multiple interactions EXP 6480464 [pralidoxime co-treated with Atropine] inhibits the reaction [methamidophos results in decreased expression of TSHB protein] CTD PMID:15891268 Tshb Rat pregnenolone 16alpha-carbonitrile increases expression EXP 6480464 Pregnenolone Carbonitrile results in increased expression of TSHB protein CTD PMID:20421340 and PMID:20655938 Tshb Rat prochloraz decreases expression EXP 6480464 prochloraz results in decreased expression of TSHB protein CTD PMID:12377983 Tshb Rat prostaglandin D2 multiple interactions ISO TSHB (Homo sapiens) 6480464 Prostaglandin D2 promotes the reaction [TSHB protein results in increased expression of TG protein] CTD PMID:11078701 Tshb Rat prostaglandin J2 multiple interactions ISO TSHB (Homo sapiens) 6480464 9-deoxy-delta-9-prostaglandin D2 promotes the reaction [TSHB protein results in increased expression of TG protein] CTD PMID:11078701 Tshb Rat pyrethrins increases expression EXP 6480464 Pyrethrins results in increased expression of TSHB protein CTD PMID:34896426 Tshb Rat pyrrolidine dithiocarbamate multiple interactions ISO Tshb (Mus musculus) 6480464 pyrrolidine dithiocarbamic acid inhibits the reaction [TSHB protein results in increased abundance of Hydrogen Peroxide] CTD PMID:11108245 Tshb Rat quercetin multiple interactions EXP 6480464 Quercetin inhibits the reaction [TSHB protein results in increased expression of SLC5A5 mRNA] CTD PMID:17962351 Tshb Rat resveratrol multiple interactions ISO TSHB (Homo sapiens) 6480464 resveratrol inhibits the reaction [[TSHB protein results in increased activity of TSHR protein] which results in increased abundance of Cyclic AMP] CTD PMID:19766106 Tshb Rat resveratrol increases expression EXP 6480464 resveratrol results in increased expression of TSHB protein CTD PMID:28668442 Tshb Rat resveratrol multiple interactions EXP 6480464 Resveratrol inhibits the reaction [Cisplatin results in decreased expression of TSHB protein] CTD PMID:33587916 Tshb Rat sodium arsenate affects expression ISO Tshb (Mus musculus) 6480464 sodium arsenate affects the expression of TSHB mRNA CTD PMID:28813693 Tshb Rat sodium arsenite affects expression ISO Tshb (Mus musculus) 6480464 sodium arsenite affects the expression of TSHB mRNA CTD PMID:28813693 Tshb Rat sodium perchlorate multiple interactions EXP 6480464 [Iodine deficiency co-treated with sodium perchlorate] results in increased secretion of TSHB protein CTD PMID:30090431 Tshb Rat sodium perchlorate increases expression EXP 6480464 sodium perchlorate results in increased expression of TSHB mRNA and sodium perchlorate results in increased expression of TSHB protein CTD PMID:29139221 Tshb Rat sodium perchlorate multiple interactions ISO TSHB (Homo sapiens) 6480464 sodium perchlorate inhibits the reaction [efavirenz promotes the reaction [TSHB protein affects the abundance of Iodine]] and sodium perchlorate inhibits the reaction [Nevirapine promotes the reaction [TSHB protein affects the abundance of Iodine]] CTD PMID:16030158 Tshb Rat sulfasalazine increases secretion ISO Tshb (Mus musculus) 6480464 Sulfasalazine results in increased secretion of TSHB protein CTD PMID:12587019 Tshb Rat syringic acid decreases expression EXP 6480464 syringic acid results in decreased expression of TSHB protein CTD PMID:34047416 Tshb Rat syringic acid multiple interactions EXP 6480464 syringic acid inhibits the reaction [Propylthiouracil results in increased expression of TSHB protein] CTD PMID:34047416 Tshb Rat tert-butyl hydroperoxide decreases activity ISO TSHB (Homo sapiens) 6480464 tert-Butylhydroperoxide results in decreased activity of TSHB protein CTD PMID:14751029 Tshb Rat tert-butyl hydroperoxide increases oxidation ISO TSHB (Homo sapiens) 6480464 tert-Butylhydroperoxide results in increased oxidation of TSHB protein CTD PMID:14751029 Tshb Rat thimerosal increases expression ISO Tshb (Mus musculus) 6480464 Thimerosal results in increased expression of TSHB mRNA and Thimerosal results in increased expression of TSHB protein CTD PMID:24675092 Tshb Rat thiocyanate increases expression ISO TSHB (Homo sapiens) 6480464 thiocyanate results in increased expression of TSHB protein CTD PMID:20439182 Tshb Rat thyroxine multiple interactions EXP 6480464 Clofibrate inhibits the reaction [Thyroxine results in decreased expression of TSHB protein] more ... CTD PMID:18219302 more ... Tshb Rat thyroxine decreases expression ISO Tshb (Mus musculus) 6480464 Thyroxine results in decreased expression of TSHB mRNA CTD PMID:27420076 Tshb Rat thyroxine decreases expression EXP 6480464 Thyroxine results in decreased expression of TSHB protein CTD PMID:18219302 Tshb Rat toxaphene increases expression EXP 6480464 Toxaphene results in increased expression of TSHB protein CTD PMID:8933632 Tshb Rat trifluralin multiple interactions EXP 6480464 Trifluralin results in increased expression of and results in increased secretion of TSHB protein CTD PMID:18582544 Tshb Rat triphenyl phosphate increases expression EXP 6480464 triphenyl phosphate results in increased expression of TSHB mRNA CTD PMID:25646720 Tshb Rat tropan-3alpha-yl 3-hydroxy-2-phenylpropanoate multiple interactions EXP 6480464 [pralidoxime co-treated with Atropine] inhibits the reaction [methamidophos results in decreased expression of TSHB protein] CTD PMID:15891268 Tshb Rat valproic acid decreases methylation ISO TSHB (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of TSHB gene CTD PMID:29154799 Tshb Rat vemurafenib multiple interactions ISO TSHB (Homo sapiens) 6480464 [TSHB protein co-treated with Vemurafenib] affects the expression of SLC5A5 mRNA more ... CTD PMID:26751190 Tshb Rat verapamil multiple interactions ISO TSHB (Homo sapiens) 6480464 Verapamil inhibits the reaction [TRH protein results in increased secretion of TSHB protein] CTD PMID:7851873 Tshb Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of TSHB protein CTD PMID:17980475 Tshb Rat vitamin E multiple interactions EXP 6480464 Vitamin E inhibits the reaction [Chlorodiphenyl (54% Chlorine) results in decreased expression of TSHB protein] CTD PMID:16298753 Tshb Rat vorinostat multiple interactions ISO TSHB (Homo sapiens) 6480464 BRAF protein mutant form affects the reaction [vorinostat affects the reaction [[TSHB protein co-treated with vemurafenib] affects the expression of SLC5A5 mRNA]] more ... CTD PMID:26751190 Tshb Rat zearalenone multiple interactions EXP 6480464 Gallic Acid inhibits the reaction [Zearalenone results in decreased expression of TSHB protein] CTD PMID:34723416 Tshb Rat zearalenone decreases expression EXP 6480464 Zearalenone results in decreased expression of TSHB protein CTD PMID:34723416 Tshb Rat zinc oxide decreases secretion EXP 6480464 Zinc Oxide results in decreased secretion of TSHB protein CTD PMID:34553816 Tshb Rat zinc oxide multiple interactions EXP 6480464 lead acetate promotes the reaction [Zinc Oxide results in decreased secretion of TSHB protein] and Zinc Oxide promotes the reaction [lead acetate results in decreased secretion of TSHB protein] CTD PMID:34553816
Imported Annotations - KEGG (archival)
15-deoxy-Delta(12,14)-prostaglandin J2 (ISO) 17beta-estradiol (EXP,ISO) 17beta-estradiol 3-benzoate (EXP) 2,2',4,4',5,5'-hexachlorobiphenyl (EXP) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,2',4,5-tetrachlorobiphenyl (ISO) 2,3',4,4',5-Pentachlorobiphenyl (EXP,ISO) 2,3,4,3',4'-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (EXP,ISO) 2,4-Diaminoanisole (EXP) 2-(3,4-dimethoxyphenyl)-5-\{[2-(3,4-dimethoxyphenyl)ethyl](methyl)amino\}-2-(propan-2-yl)pentanenitrile (ISO) 2-acetamidofluorene (ISO) 3',5'-cyclic AMP (ISO) 3,3',4,4',5-pentachlorobiphenyl (EXP) 3,3',5,5'-tetrabromobisphenol A (EXP) 3,3',5-triiodo-L-thyronine (EXP,ISO) 3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropanecarboxylic acid (ISO) 3-phenoxybenzoic acid (ISO) 4'-epidoxorubicin (EXP) 4,4'-sulfonyldiphenol (EXP,ISO) 5-fluorouracil (ISO) 6-propyl-2-thiouracil (EXP) 9-cis-retinoic acid (ISO) aflatoxin B1 (ISO) alachlor (EXP) aldehydo-D-glucose (ISO) alfacalcidol (ISO) all-trans-retinoic acid (ISO) allethrin (EXP) amiodarone (EXP,ISO) amitriptyline (ISO) amitrole (EXP) ammonium chloride (EXP) Aroclor 1254 (EXP) arsenous acid (EXP) ATP (ISO) atrazine (ISO) atropine (EXP) benzo[a]pyrene (EXP) benzo[b]fluoranthene (ISO) beta-hexachlorocyclohexane (ISO) bis(2-ethylhexyl) phthalate (EXP,ISO) bisphenol A (EXP,ISO) bisphenol AF (EXP) bisphenol F (EXP) Butylparaben (EXP) cadmium atom (EXP) cadmium dichloride (EXP) carbendazim (EXP) chlorohydrocarbon (EXP) chlorpyrifos (ISO) cisplatin (EXP) clofibrate (EXP) cobalt atom (ISO) cyclohexane (EXP) cyhalothrin (EXP) cypermethrin (EXP) D-glucose (ISO) DDE (EXP,ISO) decabromodiphenyl ether (EXP) dexamethasone (EXP) diarsenic trioxide (EXP) diethyl hydrogen phosphate (EXP) diethylstilbestrol (ISO) diiodine (EXP,ISO) diisobutyl phthalate (ISO) dioxygen (ISO) disodium selenite (ISO) disulfiram (EXP) diuron (ISO) efavirenz (ISO) endosulfan (EXP) erythrosin B (EXP) fenvalerate (EXP) fluoxetine (EXP) fructose (ISO) gallic acid (EXP) glucose (ISO) glyphosate (EXP,ISO) hexachlorobenzene (ISO) hydrogen peroxide (ISO) imidacloprid (ISO) iodide salt (EXP,ISO) L-ascorbic acid (EXP) lead diacetate (EXP) lead(II) chloride (EXP) linalool (EXP) lycopene (EXP) mancozeb (ISO) masoprocol (EXP) melatonin (EXP,ISO) methamidophos (EXP) methimazole (EXP,ISO) methoxychlor (EXP) Methylthiouracil (ISO) mono(2-ethyl-5-oxohexyl) phthalate (ISO) N,N-bis(2-hydroxypropyl)nitrosamine (EXP) N-acetyl-L-cysteine (ISO) N-nitrosodiethylamine (EXP) N-Vinyl-2-pyrrolidone (EXP) nevirapine (ISO) nitrates (ISO) octreotide (ISO) Oxyfluorfen (EXP) ozone (EXP,ISO) paraquat (ISO) PCB138 (ISO) perchlorate (ISO) perfluorononanoic acid (ISO) perfluorooctane-1-sulfonic acid (ISO) perfluorooctanoic acid (ISO) perfluoroundecanoic acid (EXP) Pexacerfont (EXP) phenobarbital (EXP) pirinixic acid (ISO) potassium iodide (EXP) pralidoxime (EXP) pregnenolone 16alpha-carbonitrile (EXP) prochloraz (EXP) prostaglandin D2 (ISO) prostaglandin J2 (ISO) pyrethrins (EXP) pyrrolidine dithiocarbamate (ISO) quercetin (EXP) resveratrol (EXP,ISO) sodium arsenate (ISO) sodium arsenite (ISO) sodium perchlorate (EXP,ISO) sulfasalazine (ISO) syringic acid (EXP) tert-butyl hydroperoxide (ISO) thimerosal (ISO) thiocyanate (ISO) thyroxine (EXP,ISO) toxaphene (EXP) trifluralin (EXP) triphenyl phosphate (EXP) tropan-3alpha-yl 3-hydroxy-2-phenylpropanoate (EXP) valproic acid (ISO) vemurafenib (ISO) verapamil (ISO) vinclozolin (EXP) vitamin E (EXP) vorinostat (ISO) zearalenone (EXP) zinc oxide (EXP)
1.
Vitamin A repletion in rats with concurrent vitamin A and iodine deficiency affects pituitary TSHbeta gene expression and reduces thyroid hyperstimulation and thyroid size.
Biebinger R, etal., J Nutr. 2007 Mar;137(3):573-7.
2.
Chronic treatment with low doses of estradiol affects pituitary and thyroid function in young and middle-aged ovariectomized rats.
Bottner M and Wuttke W, Biogerontology. 2005;6(4):261-9.
3.
Isolation and characterization of the rat thyrotropin beta-subunit gene. Differential regulation of two transcriptional start sites by thyroid hormone.
Carr FE, etal., J Biol Chem 1987 Jan 25;262(3):981-7.
4.
Evidence for a single rat thyrotropin-beta-subunit gene: thyroidectomy increases its mRNA.
Chin WW, etal., Biochem Biophys Res Commun 1985 May 16;128(3):1152-8.
5.
Thyroid hormone decreases thyrotropin subunit mRNA levels in rat anterior pituitary.
Croyle ML and Maurer RA, DNA 1984 Jun;3(3):231-6.
6.
Analysis of the organization and nucleotide sequence of the chromosomal gene for the beta-subunit of rat thyrotropin.
Croyle ML, etal., DNA 1986 Aug;5(4):299-304.
7.
Familial hypothyroidism caused by a nonsense mutation in the thyroid-stimulating hormone beta-subunit gene.
Dacou-Voutetakis C, etal., Am J Hum Genet 1990 May;46(5):988-93.
8.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
9.
Rat ISS GO annotations from GOA human gene data--August 2006
GOA data from the GO Consortium
10.
beta-Endorphin and some hormonal levels in children with acute stress hyperglycaemia.
Gunoz H, etal., Diabetes Res Clin Pract. 1994 Jun;24(2):97-101.
11.
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
12.
Rat ISS GO annotations from MGI mouse gene data--August 2006
MGD data from the GO Consortium
13.
Electronic Transfer of LocusLink and RefSeq Data
NCBI rat LocusLink and RefSeq merged data July 26, 2002
14.
OMIM Disease Annotation Pipeline
OMIM Disease Annotation Pipeline
15.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
16.
GOA pipeline
RGD automated data pipeline
17.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
18.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
19.
Comprehensive gene review and curation
RGD comprehensive gene curation
20.
Immunoreactive TSH cells in the pituitary of female middle-aged rats after treatment with estradiol or calcium.
Sekulic M, etal., Acta Histochem. 1998 Apr;100(2):185-91.
21.
Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.
Strausberg RL, etal., Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16899-903. Epub 2002 Dec 11.
22.
Endocrine cells of the adenohypophysis in severe acute respiratory syndrome (SARS).
Wei L, etal., Biochem Cell Biol. 2010 Aug;88(4):723-30. doi: 10.1139/O10-022.
Tshb Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 192,913,171 - 192,918,054 (-) NCBI GRCr8 mRatBN7.2 2 190,224,676 - 190,229,559 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 190,224,676 - 190,229,559 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 197,842,312 - 197,847,195 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 195,706,354 - 195,711,234 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 190,532,005 - 190,536,888 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 205,207,799 - 205,215,199 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 205,207,799 - 205,212,681 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 224,638,392 - 224,643,274 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 197,908,308 - 197,913,186 (-) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 197,871,064 - 197,875,940 (-) NCBI Celera 2 182,644,695 - 182,649,578 (-) NCBI Celera RH 3.4 Map 2 1301.7 RGD Cytogenetic Map 2 q34 NCBI
TSHB Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 1 115,029,826 - 115,034,309 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 1 115,029,826 - 115,034,302 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 1 115,572,447 - 115,576,930 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 1 115,373,938 - 115,378,464 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 1 115,284,456 - 115,288,983 NCBI Celera 1 113,801,633 - 113,806,160 (+) NCBI Celera Cytogenetic Map 1 p13.2 NCBI HuRef 1 113,430,739 - 113,435,225 (+) NCBI HuRef CHM1_1 1 115,687,686 - 115,692,176 (+) NCBI CHM1_1 T2T-CHM13v2.0 1 115,041,260 - 115,045,748 (+) NCBI T2T-CHM13v2.0
Tshb Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 3 102,684,621 - 102,718,175 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 3 102,682,781 - 102,690,034 (-) Ensembl GRCm39 Ensembl GRCm38 3 102,777,398 - 102,789,082 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 3 102,775,465 - 102,782,718 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 3 102,581,321 - 102,586,637 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 3 102,906,459 - 102,911,775 (-) NCBI MGSCv36 mm8 Celera 3 104,982,812 - 104,987,788 (-) NCBI Celera Cytogenetic Map 3 F2.2 NCBI cM Map 3 45.25 NCBI
Tshb Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955435 18,316,585 - 18,339,935 (+) Ensembl ChiLan1.0 ChiLan1.0 NW_004955435 18,316,585 - 18,339,935 (+) NCBI ChiLan1.0 ChiLan1.0
TSHB Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 1 107,685,126 - 107,689,672 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 1 107,284,277 - 107,288,822 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 1 87,527,267 - 87,531,813 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 1 122,575,546 - 122,580,028 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 1 122,575,546 - 122,580,028 (-) Ensembl panpan1.1 panPan2
TSHB Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 17 52,659,137 - 52,685,388 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 17 52,681,357 - 52,685,390 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 17 52,306,371 - 52,332,583 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 17 53,525,777 - 53,563,370 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 17 53,559,339 - 53,563,372 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 17 52,571,137 - 52,597,347 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 17 52,616,291 - 52,641,625 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 17 53,186,781 - 53,212,984 (+) NCBI UU_Cfam_GSD_1.0
Tshb
TSHB Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 4 105,553,076 - 105,554,015 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 4 105,553,070 - 105,558,769 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 4 115,691,689 - 115,697,380 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
TSHB Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 20 18,660,683 - 18,665,226 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 20 18,657,535 - 18,665,185 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666038 21,406,905 - 21,411,461 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Tshb
.
Predicted Target Of
Count of predictions: 10 Count of miRNA genes: 9 Interacting mature miRNAs: 10 Transcripts: ENSRNOT00000022575 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1578648 Bss11 Bone structure and strength QTL 11 4.7 femur morphology trait (VT:0000559) femoral neck cortical cross-sectional area (CMO:0001702) 2 114837527 211674221 Rat 1358356 Srcrt1 Stress Responsive Cort QTL1 3.66 blood corticosterone amount (VT:0005345) plasma corticosterone level (CMO:0001173) 2 161699179 222436696 Rat 1331734 Bp204 Blood pressure QTL 204 3.61192 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 168358098 223265385 Rat 1298074 Bp164 Blood pressure QTL 164 0.003 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 42804607 202447032 Rat 1354648 Bp239 Blood pressure QTL 239 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 66118463 226797303 Rat 1354649 Kidm17 Kidney mass QTL 17 2.9 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 2 81754530 227146641 Rat 10755499 Bp389 Blood pressure QTL 389 2.61 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 2 18960362 228801039 Rat 1298076 Bp166 Blood pressure QTL 166 0.0009 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 136445150 202447032 Rat 152025245 Scl81 Serum cholesterol level QTL 81 3.49 blood cholesterol amount (VT:0000180) 2 122609194 206936711 Rat 61458 Bp10 Blood pressure QTL 10 3.42 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 189020722 215287351 Rat 70162 Bp63 Blood pressure QTL 63 5.64 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 2 169745596 214745596 Rat 1554319 Bmd2 Bone mineral density QTL 2 13.4 0.0001 lumbar vertebra area (VT:0010570) lumbar vertebra cross-sectional area (CMO:0001689) 2 114837675 212549332 Rat 1581569 Uae32 Urinary albumin excretion QTL 32 0.0001 urine protein amount (VT:0005160) urine albumin excretion rate (CMO:0000757) 2 78665619 219826953 Rat 10043136 Iddm54 Insulin dependent diabetes mellitus QTL 54 3.4 0.0001 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 2 143657411 190602963 Rat 1302793 Bw16 Body weight QTL 16 5 0.0001 body mass (VT:0001259) body weight (CMO:0000012) 2 157142209 202446871 Rat 61467 Bp14 Blood pressure QTL 14 2.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 43154682 202446871 Rat 61469 Bp16 Blood pressure QTL 16 5.64 arterial blood pressure trait (VT:2000000) blood pressure measurement (CMO:0000003) 2 169745596 214745596 Rat 70175 BpQTLCluster3 Blood pressure QTL cluster 3 4.128 arterial blood pressure trait (VT:2000000) absolute change in systolic blood pressure (CMO:0000607) 2 135552573 202446871 Rat 1358900 Bw48 Body weight QTL 48 4.88 body mass (VT:0001259) body weight (CMO:0000012) 2 157142078 211086598 Rat 4889834 Pur24 Proteinuria QTL 24 5.8 0.014 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 2 184114274 202447032 Rat 1359031 Bp275 Blood pressure QTL 275 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 2 185876309 219753474 Rat 1581499 Esta2 Estrogen-induced thymic atrophy QTL 2 thymus mass (VT:0004954) thymus wet weight (CMO:0000855) 2 189599258 226936289 Rat 1331760 Bp206 Blood pressure QTL 206 3.62454 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 56043031 202447032 Rat 9589044 Scfw1 Subcutaneous fat weight QTL 1 5.8 0.001 subcutaneous adipose mass (VT:1000472) abdominal subcutaneous fat pad weight (CMO:0002069) 2 182171407 227171407 Rat 8694435 Bw166 Body weight QTL 166 14.08 0.001 retroperitoneal fat pad mass (VT:0010430) retroperitoneal fat pad weight to body weight ratio (CMO:0000635) 2 182171407 227171407 Rat 1359032 Hrtrt18 Heart rate QTL 18 heart pumping trait (VT:2000009) heart rate (CMO:0000002) 2 157142078 192625452 Rat 2301966 Bp322 Blood pressure QTL 322 3.58 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 150540301 202447032 Rat 1298083 Bp158 Blood pressure QTL 158 2.62 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 189020722 215287351 Rat 1298080 Bp163 Blood pressure QTL 163 0.02 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 66118275 202447032 Rat 8662832 Vetf7 Vascular elastic tissue fragility QTL 7 3.5 aorta elastin amount (VT:0003905) aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002) 2 81689826 221035911 Rat 1331745 Bp203 Blood pressure QTL 203 4.377 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 189599258 218414891 Rat 1298085 Bp165 Blood pressure QTL 165 0.0006 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 42804607 202447032 Rat 8694194 Abfw1 Abdominal fat weight QTL 1 11.7 0.001 visceral adipose mass (VT:0010063) abdominal fat pad weight to body weight ratio (CMO:0000095) 2 182171407 227171407 Rat 61366 Iddm3 Insulin dependent diabetes mellitus QTL 3 4.7 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 2 189599258 234599258 Rat 1359022 Ppulsi1 Prepulse inhibition QTL 1 3.63 prepulse inhibition trait (VT:0003088) acoustic startle response measurement (CMO:0001519) 2 136916935 213594495 Rat 1641891 Alcrsp17 Alcohol response QTL 17 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 2 149559561 249053267 Rat 724534 Uae6 Urinary albumin excretion QTL 6 10 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 2 78665619 249053267 Rat 61374 Edpm2 Estrogen-dependent pituitary mass QTL 2 4.42 0.86 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 2 76539322 202447032 Rat 2300189 Bmd48 Bone mineral density QTL 48 5.8 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 2 179335906 224335906 Rat 8662843 Vetf9 Vascular elastic tissue fragility QTL 9 2.05 thoracic aorta molecular composition trait (VT:0010568) aorta wall extracellular elastin dry weight to aorta wall extracellular collagen weight ratio (CMO:0002003) 2 157142078 226277316 Rat 631501 Bp101 Blood pressure QTL 101 2.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 150341684 202446871 Rat 2307174 Activ3 Activity QTL 3 4.83 0.000058 locomotor behavior trait (VT:0001392) number of entries into a discrete space in an experimental apparatus (CMO:0000960) 2 168594495 213594495 Rat 1331794 Bp202 Blood pressure QTL 202 3.66819 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 141194931 223265385 Rat 71113 Cari2 Carrageenan-induced inflammation QTL 2 2.7 0.009 hypodermis integrity trait (VT:0010550) inflammatory exudate volume (CMO:0001429) 2 141596551 202447032 Rat 1331805 Cm29 Cardiac mass QTL 29 3.50746 heart mass (VT:0007028) heart wet weight (CMO:0000069) 2 141194931 223265385 Rat 634308 Sach6 Saccharin preference QTL 6 4.9 taste sensitivity trait (VT:0001986) saccharin intake volume to total fluid intake volume ratio (CMO:0001601) 2 112456140 212696837 Rat 1358917 Cm42 Cardiac mass QTL 42 2.82 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 203928301 Rat 724568 Uae13 Urinary albumin excretion QTL 13 4.4 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 2 143157029 210020885 Rat 7488929 Bp366 Blood pressure QTL 366 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 184974550 193094998 Rat 1358913 Cm41 Cardiac mass QTL 41 2.73 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 203928301 Rat 1300165 Rf9 Renal function QTL 9 3.28 kidney glomerulus integrity trait (VT:0010546) index of glomerular damage (CMO:0001135) 2 133914684 202447032 Rat 738013 Alc15 Alcohol consumption QTL 15 4.1 0.00022 consumption behavior trait (VT:0002069) ethanol drink intake rate to body weight ratio (CMO:0001616) 2 184165752 229165752 Rat 61398 Bp50 Blood pressure QTL 50 4.4 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 189599258 234599258 Rat 631507 Bp105 Blood pressure QTL 105 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 112456140 212696837 Rat 1641925 Alcrsp2 Alcohol response QTL 2 response to alcohol trait (VT:0010489) duration of loss of righting reflex (CMO:0002289) 2 149559561 221167075 Rat 1354609 Niddm62 Non-insulin dependent diabetes mellitus QTL 62 4.72 0.000006 insulin secretion trait (VT:0003564) plasma insulin level (CMO:0000342) 2 150540301 202447032 Rat 1598833 Bp295 Blood pressure QTL 295 3.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 147798556 192798556 Rat 61417 Cia10 Collagen induced arthritis QTL 10 3.4 joint integrity trait (VT:0010548) experimental arthritis severity measurement (CMO:0001459) 2 179946951 224946951 Rat 1354622 Kidm16 Kidney mass QTL 16 3 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 2 81754530 222436696 Rat 631266 Bp132 Blood pressure QTL 132 0.0005 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 46123260 202447032 Rat 8694383 Bw158 Body weight QTL 158 7.69 0.001 body lean mass (VT:0010483) lean tissue morphological measurement (CMO:0002184) 2 182171407 227171407 Rat 7488927 Bp365 Blood pressure QTL 365 0.008 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 162765032 207765032 Rat 1598838 Bp290 Blood pressure QTL 290 1.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 166539266 211539266 Rat 7488925 Bp364 Blood pressure QTL 364 0.001 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 160564068 205564068 Rat 2306901 Bp337 Blood pressure QTL 337 0.01 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 164073756 227146641 Rat 1354605 Rf48 Renal function QTL 48 2.9 blood creatinine amount (VT:0005328) plasma creatinine level (CMO:0000537) 2 74786664 206665859 Rat 2293084 Iddm26 Insulin dependent diabetes mellitus QTL 26 2.9 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 2 174930955 213594495 Rat
Tshb
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 2 190,227,786 - 190,228,048 (+) MAPPER mRatBN7.2 Rnor_6.0 2 205,210,909 - 205,211,170 NCBI Rnor6.0 Rnor_5.0 2 224,641,502 - 224,641,763 UniSTS Rnor5.0 RGSC_v3.4 2 197,911,414 - 197,911,675 UniSTS RGSC3.4 Celera 2 182,647,806 - 182,648,067 UniSTS Cytogenetic Map 2 q34 UniSTS
RH94521
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 2 190,224,625 - 190,224,783 (+) MAPPER mRatBN7.2 Rnor_6.0 2 205,207,749 - 205,207,906 NCBI Rnor6.0 Rnor_5.0 2 224,638,342 - 224,638,499 UniSTS Rnor5.0 RGSC_v3.4 2 197,908,253 - 197,908,410 UniSTS RGSC3.4 Celera 2 182,644,645 - 182,644,802 UniSTS RH 3.4 Map 2 1301.7 UniSTS Cytogenetic Map 2 q34 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
9
16
43
38
38
8
25
8
6
95
61
24
9
35
30
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000022575 ⟹ ENSRNOP00000022575
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 2 190,224,676 - 190,229,559 (-) Ensembl Rnor_6.0 Ensembl 2 205,207,799 - 205,212,681 (-) Ensembl
RefSeq Acc Id:
NM_013116 ⟹ NP_037248
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 192,913,171 - 192,918,054 (-) NCBI mRatBN7.2 2 190,224,676 - 190,229,559 (-) NCBI Rnor_6.0 2 205,207,799 - 205,212,681 (-) NCBI Rnor_5.0 2 224,638,392 - 224,643,274 (-) NCBI RGSC_v3.4 2 197,908,308 - 197,913,186 (-) RGD Celera 2 182,644,695 - 182,649,578 (-) NCBI
Sequence:
AATTATCCCGAAGGGTATAAAATGAACAGAGTCTGGGTCATCACAGCATTAACTCGCCAGTGCAAAGTAAGCATGAATGCTGTCGTTCTCTTTTCCGTGCTTTTCGCTCTTGCTTGTGGGCAAGTGTC
hide sequence
RefSeq Acc Id:
NP_037248 ⟸ NM_013116
- Peptide Label:
precursor
- UniProtKB:
Q6GTA8 (UniProtKB/Swiss-Prot), P04652 (UniProtKB/Swiss-Prot), A0A0F7RQR3 (UniProtKB/TrEMBL), A6K3J3 (UniProtKB/TrEMBL)
- Sequence:
MNAVVLFSVLFALACGQVSSFCIPTEYMMYVDRRECAYCLTINTTICAGYCMTRDINGKLFLPKYALSQDVCTYRDFTYRTVEIPGCPHHVAPYFSYPVALSCKCGKCNTDYSDCTHEAVKTNYCTKP
hide sequence
Ensembl Acc Id:
ENSRNOP00000022575 ⟸ ENSRNOT00000022575
RGD ID: 6850012 Promoter ID: EP30070 Type: single initiation site Name: RN_TSHB_2 Description: Thyroid stimulating hormone-beta, TSHB gene. SO ACC ID: SO:0000170 Source: EPD (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Notes: homology_group=Homology group 179; Mammalian thyrotropin beta chain, promoter 2 Alternative Promoters: alternative promoter #2 of 2; 5' exon 1; site 2; major promoter.; see alsoEP30069 Experiment Methods: Nuclease protection; Primer extension Regulation: pituitary; (repressed by or weakly expressed in) thyroxine, (induced by or strongly expressed in) TRH Position: Rat Assembly Chr Position (strand) Source RGSC_v3.4 2 197,913,142 - 197,913,202 EPD
RGD ID: 6850016 Promoter ID: EP30069 Type: single initiation site Name: RN_TSHB_1 Description: Thyroid stimulating hormone-beta, TSHB gene. SO ACC ID: SO:0000170 Source: EPD (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Notes: homology_group=Homology group 178; Mammalian thyrotropin beta chain, promoter 1 Alternative Promoters: alternative promoter #1 of 2; 5' exon 1; site 1.; see alsoEP30070 Tissues & Cell Lines: pituitary, constitutive Experiment Methods: Nuclease protection; Sequencing of a full-length cDNA; Primer extension Position: Rat Assembly Chr Position (strand) Source RGSC_v3.4 2 197,913,186 - 197,913,246 EPD
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2019-08-05
Tshb
thyroid stimulating hormone subunit beta
Tshb
thyroid stimulating hormone, beta
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2008-09-09
Tshb
thyroid stimulating hormone, beta
Tshb
thyroid stimulating hormone, beta subunit
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2002-06-10
Tshb
Thyroid stimulating hormone, beta subunit
Symbol and Name status set to approved
70586 APPROVED
