Symbol:
Marco
Name:
macrophage receptor with collagenous structure
RGD ID:
1589662
Description:
Enables G protein-coupled receptor binding activity; amyloid-beta binding activity; and cargo receptor activity. Involved in several processes, including adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway; endocytosis; and positive regulation of ERK1 and ERK2 cascade. Located in cytoplasm and plasma membrane. Used to study silicosis. Biomarker of meningococcal meningitis. Human ortholog(s) of this gene implicated in pulmonary tuberculosis. Orthologous to human MARCO (macrophage receptor with collagenous structure); PARTICIPATES IN phagocytosis pathway; INTERACTS WITH 17beta-estradiol; acetamide; aflatoxin B1.
Type:
protein-coding
RefSeq Status:
PROVISIONAL
Previously known as:
LOC367391; macrophage receptor MARCO; similar to Macrophage receptor MARCO (Macrophage receptor with collagenous structure)
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 34,169,011 - 34,210,340 (-) NCBI GRCr8 mRatBN7.2 13 31,616,278 - 31,648,521 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 31,616,278 - 31,648,521 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 34,183,224 - 34,215,428 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 35,471,075 - 35,503,279 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 32,745,488 - 32,777,692 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 85,115,199 - 85,147,683 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 85,115,201 - 85,135,859 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 84,555,641 - 84,587,281 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 13 31,497,203 - 31,529,354 (-) NCBI Celera Cytogenetic Map 13 q11 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Marco Rat 1,2-dichloroethane increases expression ISO Marco (Mus musculus) 6480464 ethylene dichloride results in increased expression of MARCO mRNA CTD PMID:28960355 Marco Rat 17alpha-ethynylestradiol increases expression ISO Marco (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of MARCO mRNA CTD PMID:17942748 Marco Rat 17alpha-ethynylestradiol multiple interactions ISO Marco (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MARCO mRNA CTD PMID:17942748 Marco Rat 17beta-estradiol increases expression EXP 6480464 Estradiol results in increased expression of MARCO mRNA CTD PMID:32145629 Marco Rat 17beta-estradiol decreases expression ISO Marco (Mus musculus) 6480464 Estradiol results in decreased expression of MARCO mRNA CTD PMID:39298647 Marco Rat 2,2',4,4',5,5'-hexachlorobiphenyl multiple interactions ISO Marco (Mus musculus) 6480464 2 more ... CTD PMID:32352317 Marco Rat 2,2',4,4'-Tetrabromodiphenyl ether increases expression ISO MARCO (Homo sapiens) 6480464 2 more ... CTD PMID:23146750 Marco Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Marco (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Marco Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Marco (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of MARCO mRNA and [TIPARP gene mutant form results in increased susceptibility to Tetrachlorodibenzodioxin] which results in decreased expression of MARCO mRNA CTD PMID:17942748 and PMID:25975270 Marco Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Marco (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of MARCO mRNA CTD PMID:28922406 Marco Rat 2,4-dibromophenyl 2,4,5-tribromophenyl ether affects expression ISO Marco (Mus musculus) 6480464 2 more ... CTD PMID:38648751 Marco Rat 3,3',4,4',5-pentachlorobiphenyl decreases expression ISO MARCO (Homo sapiens) 6480464 3 more ... CTD PMID:23146750 Marco Rat 4,4'-sulfonyldiphenol decreases expression ISO Marco (Mus musculus) 6480464 bisphenol S results in decreased expression of MARCO mRNA CTD PMID:39298647 Marco Rat 5-aza-2'-deoxycytidine multiple interactions ISO Marco (Mus musculus) 6480464 Decitabine inhibits the reaction [[bisphenol A affects the susceptibility to [Lipopolysaccharides co-treated with IFNG protein]] which results in decreased expression of MARCO mRNA] CTD PMID:29718165 Marco Rat acetamide increases expression EXP 6480464 acetamide results in increased expression of MARCO mRNA CTD PMID:31881176 Marco Rat aflatoxin B1 decreases expression EXP 6480464 Aflatoxin B1 results in decreased expression of MARCO mRNA CTD PMID:25378103 and PMID:33354967 Marco Rat aflatoxin B1 decreases methylation ISO MARCO (Homo sapiens) 6480464 Aflatoxin B1 results in decreased methylation of MARCO exon CTD PMID:30157460 Marco Rat alpha-Zearalanol increases expression EXP 6480464 Zeranol results in increased expression of MARCO mRNA CTD PMID:35163327 Marco Rat antirheumatic drug decreases expression ISO MARCO (Homo sapiens) 6480464 Antirheumatic Agents results in decreased expression of MARCO mRNA CTD PMID:24449571 Marco Rat benzo[a]pyrene increases expression ISO Marco (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of MARCO mRNA CTD PMID:21964900 and PMID:22610609 Marco Rat benzo[a]pyrene increases expression ISO MARCO (Homo sapiens) 6480464 Benzo(a)pyrene results in increased expression of MARCO mRNA CTD PMID:32234424 Marco Rat benzo[a]pyrene increases methylation ISO MARCO (Homo sapiens) 6480464 Benzo(a)pyrene results in increased methylation of MARCO exon CTD PMID:27901495 Marco Rat benzo[a]pyrene affects methylation ISO MARCO (Homo sapiens) 6480464 Benzo(a)pyrene affects the methylation of MARCO promoter CTD PMID:27901495 Marco Rat benzo[a]pyrene multiple interactions ISO Marco (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MARCO mRNA CTD PMID:27858113 Marco Rat benzo[b]fluoranthene increases expression ISO Marco (Mus musculus) 6480464 benzo(b)fluoranthene results in increased expression of MARCO mRNA CTD PMID:26377693 Marco Rat benzo[b]fluoranthene multiple interactions ISO Marco (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MARCO mRNA CTD PMID:27858113 Marco Rat benzo[e]pyrene increases methylation ISO MARCO (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of MARCO exon CTD PMID:30157460 Marco Rat bis(2-ethylhexyl) phthalate multiple interactions ISO Marco (Mus musculus) 6480464 Diethylhexyl Phthalate inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased expression of MARCO mRNA] CTD PMID:29718165 Marco Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MARCO mRNA CTD PMID:25181051 Marco Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of MARCO mRNA CTD PMID:30903817 and PMID:32145629 Marco Rat bisphenol A multiple interactions ISO Marco (Mus musculus) 6480464 [bisphenol A affects the susceptibility to [Lipopolysaccharides co-treated with IFNG protein]] which results in decreased expression of MARCO mRNA more ... CTD PMID:29718165 Marco Rat buta-1,3-diene increases expression ISO Marco (Mus musculus) 6480464 1 and 3-butadiene results in increased expression of MARCO mRNA CTD PMID:29038090 Marco Rat butanal increases expression ISO MARCO (Homo sapiens) 6480464 butyraldehyde results in increased expression of MARCO mRNA CTD PMID:26079696 Marco Rat cadmium dichloride increases methylation EXP 6480464 Cadmium Chloride results in increased methylation of MARCO promoter CTD PMID:22457795 Marco Rat calcium atom multiple interactions ISO MARCO (Homo sapiens) 6480464 Calcium promotes the reaction [titanium dioxide binds to MARCO protein] CTD PMID:18836211 Marco Rat calcium(0) multiple interactions ISO MARCO (Homo sapiens) 6480464 Calcium promotes the reaction [titanium dioxide binds to MARCO protein] CTD PMID:18836211 Marco Rat carbon nanotube increases uptake ISO Marco (Mus musculus) 6480464 MARCO protein results in increased uptake of Nanotubes and Carbon CTD PMID:22209804 Marco Rat carbon nanotube increases expression ISO MARCO (Homo sapiens) 6480464 Nanotubes and Carbon results in increased expression of MARCO mRNA CTD PMID:29348435 Marco Rat carbon nanotube increases expression EXP 6480464 Nanotubes and Carbon results in increased expression of MARCO mRNA CTD PMID:24911292 Marco Rat carbon nanotube increases expression ISO Marco (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:25620056 Marco Rat carbon nanotube decreases expression ISO Marco (Mus musculus) 6480464 Nanotubes and Carbon analog results in decreased expression of MARCO mRNA CTD PMID:25554681 Marco Rat CGP 52608 multiple interactions ISO MARCO (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to MARCO gene] CTD PMID:28238834 Marco Rat cholesterol multiple interactions ISO Marco (Mus musculus) 6480464 [Cholesterol co-treated with 1 and 2-dioleoyloxy-3-(trimethylammonium)propane] results in increased expression of MARCO mRNA CTD PMID:22129739 Marco Rat chrysene multiple interactions ISO Marco (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MARCO mRNA CTD PMID:27858113 Marco Rat ciguatoxin CTX1B affects expression ISO Marco (Mus musculus) 6480464 Ciguatoxins affects the expression of MARCO mRNA CTD PMID:18353800 Marco Rat cisplatin multiple interactions ISO MARCO (Homo sapiens) 6480464 [Cisplatin co-treated with jinfukang] results in increased expression of MARCO mRNA CTD PMID:27392435 Marco Rat cisplatin increases expression ISO MARCO (Homo sapiens) 6480464 Cisplatin results in increased expression of MARCO mRNA CTD PMID:27392435 Marco Rat diclofenac increases expression ISO Marco (Mus musculus) 6480464 Diclofenac results in increased expression of MARCO mRNA CTD PMID:26934552 Marco Rat diclofenac decreases expression ISO Marco (Mus musculus) 6480464 Diclofenac results in decreased expression of MARCO mRNA CTD PMID:26934552 Marco Rat doxorubicin increases expression ISO Marco (Mus musculus) 6480464 Doxorubicin results in increased expression of MARCO mRNA CTD PMID:36227756 Marco Rat fumonisin B1 increases expression ISO Marco (Mus musculus) 6480464 fumonisin B1 results in increased expression of MARCO mRNA CTD PMID:16221962 Marco Rat lipopolysaccharide increases expression ISO Marco (Mus musculus) 6480464 Lipopolysaccharides results in increased expression of MARCO mRNA and Lipopolysaccharides results in increased expression of MARCO protein CTD PMID:10223745 more ... Marco Rat lipopolysaccharide multiple interactions ISO MARCO (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of MARCO mRNA] CTD PMID:35811015 Marco Rat lipopolysaccharide increases expression ISO MARCO (Homo sapiens) 6480464 Lipopolysaccharides results in increased expression of MARCO mRNA CTD PMID:35811015 Marco Rat lipopolysaccharide multiple interactions ISO Marco (Mus musculus) 6480464 [bisphenol A affects the susceptibility to [Lipopolysaccharides co-treated with IFNG protein]] which results in decreased expression of MARCO mRNA more ... CTD PMID:29718165 Marco Rat LLY-507 multiple interactions ISO Marco (Mus musculus) 6480464 [LLY-507 affects the susceptibility to [Lipopolysaccharides co-treated with IFNG protein]] which results in decreased expression of MARCO mRNA CTD PMID:29718165 Marco Rat magnesium atom multiple interactions ISO MARCO (Homo sapiens) 6480464 Magnesium promotes the reaction [titanium dioxide binds to MARCO protein] CTD PMID:18836211 Marco Rat medroxyprogesterone acetate increases expression ISO MARCO (Homo sapiens) 6480464 Medroxyprogesterone Acetate results in increased expression of MARCO mRNA CTD PMID:20843944 Marco Rat methapyrilene increases methylation ISO MARCO (Homo sapiens) 6480464 Methapyrilene results in increased methylation of MARCO exon CTD PMID:30157460 Marco Rat mono(2-ethylhexyl) phthalate multiple interactions ISO Marco (Mus musculus) 6480464 mono-(2-ethylhexyl)phthalate inhibits the reaction [[Lipopolysaccharides co-treated with IFNG protein] results in increased expression of MARCO mRNA] CTD PMID:29718165 Marco Rat ozone multiple interactions ISO Marco (Mus musculus) 6480464 [Air Pollutants results in increased abundance of [Ozone co-treated with Soot]] which results in increased expression of MARCO mRNA more ... CTD PMID:19555225 more ... Marco Rat ozone increases expression ISO Marco (Mus musculus) 6480464 Ozone results in increased expression of MARCO mRNA CTD PMID:21543283 and PMID:25658374 Marco Rat paracetamol increases expression ISO Marco (Mus musculus) 6480464 Acetaminophen results in increased expression of MARCO mRNA CTD PMID:17585979 Marco Rat paracetamol affects expression ISO Marco (Mus musculus) 6480464 Acetaminophen affects the expression of MARCO mRNA CTD PMID:17562736 Marco Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Marco (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Pectins] results in decreased expression of MARCO mRNA CTD PMID:36331819 Marco Rat pirinixic acid increases expression ISO Marco (Mus musculus) 6480464 pirinixic acid results in increased expression of MARCO mRNA CTD PMID:23811191 Marco Rat poly(guanylic acid) multiple interactions ISO Marco (Mus musculus) 6480464 Poly G inhibits the reaction [MARCO protein binds to and results in increased uptake of Polystyrenes] CTD PMID:17361018 Marco Rat poly(guanylic acid) multiple interactions EXP 6480464 Poly G inhibits the reaction [Particulate Matter results in increased expression of MARCO protein] and Poly G inhibits the reaction [Silicon Dioxide results in increased expression of MARCO protein] CTD PMID:30391304 more ... Marco Rat protein kinase inhibitor multiple interactions ISO MARCO (Homo sapiens) 6480464 Protein Kinase Inhibitors inhibits the reaction [gardiquimod results in increased expression of MARCO mRNA] CTD PMID:28003376 Marco Rat rotenone affects expression EXP 6480464 Rotenone affects the expression of MARCO mRNA CTD PMID:28374803 Marco Rat S-(1,2-dichlorovinyl)-L-cysteine multiple interactions ISO MARCO (Homo sapiens) 6480464 S-(1 and 2-dichlorovinyl)cysteine inhibits the reaction [Lipopolysaccharides results in increased expression of MARCO mRNA] CTD PMID:35811015 Marco Rat silicon dioxide increases expression ISO MARCO (Homo sapiens) 6480464 Silicon Dioxide analog results in increased expression of MARCO mRNA CTD PMID:25895662 Marco Rat silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of MARCO protein CTD PMID:30391304 more ... Marco Rat silicon dioxide multiple interactions EXP 6480464 Poly G inhibits the reaction [Silicon Dioxide results in increased expression of MARCO protein] CTD PMID:30391304 more ... Marco Rat silicon dioxide increases expression ISO Marco (Mus musculus) 6480464 Silicon Dioxide results in increased expression of MARCO mRNA and Silicon Dioxide results in increased expression of MARCO protein CTD PMID:19151164 and PMID:29341224 Marco Rat silicon dioxide affects binding ISO MARCO (Homo sapiens) 6480464 Silicon Dioxide binds to MARCO protein CTD PMID:18836211 Marco Rat silicon dioxide multiple interactions ISO Marco (Mus musculus) 6480464 MARCO affects the reaction [Silicon Dioxide results in increased expression of IL6 protein] and MARCO protein results in increased uptake of and results in decreased susceptibility to Silicon Dioxide CTD PMID:19151164 Marco Rat sodium arsenite increases expression ISO MARCO (Homo sapiens) 6480464 sodium arsenite results in increased expression of MARCO mRNA CTD PMID:38568856 Marco Rat sodium arsenite affects expression ISO Marco (Mus musculus) 6480464 sodium arsenite affects the expression of MARCO mRNA CTD PMID:26674514 Marco Rat sodium arsenite decreases expression ISO MARCO (Homo sapiens) 6480464 sodium arsenite results in decreased expression of MARCO mRNA CTD PMID:34032870 Marco Rat tamoxifen increases expression ISO Marco (Mus musculus) 6480464 Tamoxifen results in increased expression of MARCO mRNA CTD PMID:25123088 Marco Rat tetrachloromethane multiple interactions ISO Marco (Mus musculus) 6480464 PLG gene mutant form promotes the reaction [Carbon Tetrachloride results in increased expression of MARCO mRNA] CTD PMID:16006527 Marco Rat tetrachloromethane increases expression ISO Marco (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of MARCO mRNA CTD PMID:27339419 and PMID:31919559 Marco Rat tetraphene multiple interactions ISO Marco (Mus musculus) 6480464 [Benzo(a)pyrene co-treated with benz(a)anthracene co-treated with benzo(b)fluoranthene co-treated with chrysene] results in increased expression of MARCO mRNA CTD PMID:27858113 Marco Rat thioacetamide decreases expression EXP 6480464 Thioacetamide results in decreased expression of MARCO mRNA CTD PMID:23411599 Marco Rat thioacetamide increases expression EXP 6480464 Thioacetamide results in increased expression of MARCO mRNA CTD PMID:34492290 Marco Rat titanium dioxide multiple interactions ISO MARCO (Homo sapiens) 6480464 Calcium promotes the reaction [titanium dioxide binds to MARCO protein] and Magnesium promotes the reaction [titanium dioxide binds to MARCO protein] CTD PMID:18836211 Marco Rat titanium dioxide increases expression ISO Marco (Mus musculus) 6480464 titanium dioxide results in increased expression of MARCO mRNA CTD PMID:23557971 and PMID:27760801 Marco Rat titanium dioxide affects binding ISO MARCO (Homo sapiens) 6480464 titanium dioxide binds to MARCO protein CTD PMID:18836211 Marco Rat trichostatin A multiple interactions ISO Marco (Mus musculus) 6480464 trichostatin A inhibits the reaction [[bisphenol A affects the susceptibility to [Lipopolysaccharides co-treated with IFNG protein]] which results in decreased expression of MARCO mRNA] CTD PMID:29718165 Marco Rat trimellitic anhydride decreases expression ISO Marco (Mus musculus) 6480464 trimellitic anhydride results in decreased expression of MARCO mRNA CTD PMID:19042947 Marco Rat valproic acid affects expression ISO Marco (Mus musculus) 6480464 Valproic Acid affects the expression of MARCO mRNA CTD PMID:17292431 Marco Rat valproic acid decreases methylation ISO MARCO (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of MARCO gene CTD PMID:29154799
Imported Annotations - KEGG (archival)
1,2-dichloroethane (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (EXP,ISO) 2,2',4,4',5,5'-hexachlorobiphenyl (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,4-dibromophenyl 2,4,5-tribromophenyl ether (ISO) 3,3',4,4',5-pentachlorobiphenyl (ISO) 4,4'-sulfonyldiphenol (ISO) 5-aza-2'-deoxycytidine (ISO) acetamide (EXP) aflatoxin B1 (EXP,ISO) alpha-Zearalanol (EXP) antirheumatic drug (ISO) benzo[a]pyrene (ISO) benzo[b]fluoranthene (ISO) benzo[e]pyrene (ISO) bis(2-ethylhexyl) phthalate (ISO) bisphenol A (EXP,ISO) buta-1,3-diene (ISO) butanal (ISO) cadmium dichloride (EXP) calcium atom (ISO) calcium(0) (ISO) carbon nanotube (EXP,ISO) CGP 52608 (ISO) cholesterol (ISO) chrysene (ISO) ciguatoxin CTX1B (ISO) cisplatin (ISO) diclofenac (ISO) doxorubicin (ISO) fumonisin B1 (ISO) lipopolysaccharide (ISO) LLY-507 (ISO) magnesium atom (ISO) medroxyprogesterone acetate (ISO) methapyrilene (ISO) mono(2-ethylhexyl) phthalate (ISO) ozone (ISO) paracetamol (ISO) perfluorooctane-1-sulfonic acid (ISO) pirinixic acid (ISO) poly(guanylic acid) (EXP,ISO) protein kinase inhibitor (ISO) rotenone (EXP) S-(1,2-dichlorovinyl)-L-cysteine (ISO) silicon dioxide (EXP,ISO) sodium arsenite (ISO) tamoxifen (ISO) tetrachloromethane (ISO) tetraphene (ISO) thioacetamide (EXP) titanium dioxide (ISO) trichostatin A (ISO) trimellitic anhydride (ISO) valproic acid (ISO)
1.
Expression of scavenger receptors in glial cells. Comparing the adhesion of astrocytes and microglia from neonatal rats to surface-bound beta-amyloid.
Alarcón R, etal., J Biol Chem. 2005 Aug 26;280(34):30406-15. Epub 2005 Jun 29.
2.
The scavenger receptor MARCO is required for lung defense against pneumococcal pneumonia and inhaled particles.
Arredouani M, etal., J Exp Med. 2004 Jul 19;200(2):267-72. doi: 10.1084/jem.20040731.
3.
Genetic variants of MARCO are associated with susceptibility to pulmonary tuberculosis in a Gambian population.
Bowdish DM, etal., BMC Med Genet. 2013 Apr 23;14:47. doi: 10.1186/1471-2350-14-47.
4.
Functional and physical interactions between formyl-peptide-receptors and scavenger receptor MARCO and their involvement in amyloid beta 1-42-induced signal transduction in glial cells.
Brandenburg LO, etal., J Neurochem. 2010 May;113(3):749-60. doi: 10.1111/j.1471-4159.2010.06637.x. Epub 2010 Feb 5.
5.
The formyl peptide receptor like-1 and scavenger receptor MARCO are involved in glial cell activation in bacterial meningitis.
Braun BJ, etal., J Neuroinflammation. 2011 Feb 7;8(1):11. doi: 10.1186/1742-2094-8-11.
6.
Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.
Gaudet P, etal., Brief Bioinform. 2011 Sep;12(5):449-62. doi: 10.1093/bib/bbr042. Epub 2011 Aug 27.
7.
MARCO regulates early inflammatory responses against influenza: a useful macrophage function with adverse outcome.
Ghosh S, etal., Am J Respir Cell Mol Biol. 2011 Nov;45(5):1036-44. doi: 10.1165/rcmb.2010-0349OC. Epub 2011 May 11.
8.
Evaluation of the relationship between MARCO and CD36 single-nucleotide polymorphisms and susceptibility to pulmonary tuberculosis in a Chinese Han population.
Lao W, etal., BMC Infect Dis. 2017 Jul 11;17(1):488. doi: 10.1186/s12879-017-2595-2.
9.
Impaired Recognition of Mycobacterium tuberculosis by Alveolar Macrophages From Diabetic Mice.
Martinez N, etal., J Infect Dis. 2016 Dec 1;214(11):1629-1637. doi: 10.1093/infdis/jiw436. Epub 2016 Sep 13.
10.
KEGG Annotation Import Pipeline
Pipeline to import KEGG annotations from KEGG into RGD
11.
GOA pipeline
RGD automated data pipeline
12.
ClinVar Automated Import and Annotation Pipeline
RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations
13.
Data Import for Chemical-Gene Interactions
RGD automated import pipeline for gene-chemical interactions
14.
The class A scavenger receptor, macrophage receptor with collagenous structure, is the major phagocytic receptor for Clostridium sordellii expressed by human decidual macrophages.
Thelen T, etal., J Immunol. 2010 Oct 1;185(7):4328-35. doi: 10.4049/jimmunol.1000989. Epub 2010 Sep 1.
15.
MARCO variants are associated with phagocytosis, pulmonary tuberculosis susceptibility and Beijing lineage.
Thuong NT, etal., Genes Immun. 2016 Dec;17(7):419-425. doi: 10.1038/gene.2016.43. Epub 2016 Nov 17.
16.
Scavenger Receptor MARCO Orchestrates Early Defenses and Contributes to Fungal Containment during Cryptococcal Infection.
Xu J, etal., J Immunol. 2017 May 1;198(9):3548-3557. doi: 10.4049/jimmunol.1700057. Epub 2017 Mar 15.
17.
Inhibition of MARCO ameliorates silica-induced pulmonary fibrosis by regulating epithelial-mesenchymal transition.
Yang M, etal., Toxicol Lett. 2019 Feb;301:64-72. doi: 10.1016/j.toxlet.2018.10.031. Epub 2018 Nov 2.
Marco Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 13 34,169,011 - 34,210,340 (-) NCBI GRCr8 mRatBN7.2 13 31,616,278 - 31,648,521 (-) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 13 31,616,278 - 31,648,521 (-) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 13 34,183,224 - 34,215,428 (-) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 13 35,471,075 - 35,503,279 (-) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 13 32,745,488 - 32,777,692 (-) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 16 85,115,199 - 85,147,683 (-) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 16 85,115,201 - 85,135,859 (-) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 16 84,555,641 - 84,587,281 (-) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 Celera 13 31,497,203 - 31,529,354 (-) NCBI Celera Cytogenetic Map 13 q11 NCBI
MARCO Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 2 118,942,194 - 118,994,660 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 2 118,942,194 - 118,994,660 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 2 119,699,770 - 119,752,236 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 2 119,416,215 - 119,468,706 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 2 119,415,974 - 119,468,467 NCBI Celera 2 113,024,535 - 113,078,253 (+) NCBI Celera Cytogenetic Map 2 q14.2 NCBI HuRef 2 112,024,650 - 112,076,879 (+) NCBI HuRef CHM1_1 2 119,703,356 - 119,755,847 (+) NCBI CHM1_1 T2T-CHM13v2.0 2 119,375,479 - 119,427,929 (+) NCBI T2T-CHM13v2.0
Marco Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 1 120,402,267 - 120,432,753 (-) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 1 120,402,267 - 120,432,753 (-) Ensembl GRCm39 Ensembl GRCm38 1 120,474,538 - 120,505,024 (-) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 1 120,474,538 - 120,505,024 (-) Ensembl GRCm38 mm10 GRCm38 MGSCv37 1 122,371,115 - 122,401,661 (-) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 1 122,302,084 - 122,332,630 (-) NCBI MGSCv36 mm8 Celera 1 123,137,568 - 123,168,212 (-) NCBI Celera Cytogenetic Map 1 E2.3 NCBI cM Map 1 52.71 NCBI
Marco Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955459 10,698,294 - 10,739,131 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955459 10,700,645 - 10,739,222 (-) NCBI ChiLan1.0 ChiLan1.0
MARCO Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 13 20,962,321 - 21,006,160 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 2B 20,977,294 - 21,021,133 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 2B 5,896,433 - 5,940,284 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 2B 119,475,704 - 119,519,918 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 2B 119,475,677 - 119,520,385 (+) Ensembl panpan1.1 panPan2
MARCO Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 19 30,996,209 - 31,034,520 (-) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 19 30,996,347 - 31,034,487 (-) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 19 31,260,569 - 31,305,455 (-) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 19 32,381,105 - 32,426,221 (-) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 19 32,381,113 - 32,419,679 (-) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 19 31,067,312 - 31,112,187 (-) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 19 31,233,786 - 31,278,688 (-) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 19 32,420,649 - 32,465,527 (-) NCBI UU_Cfam_GSD_1.0
Marco
MARCO Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 15 24,503,108 - 24,541,283 (+) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 15 24,502,935 - 24,541,286 (+) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 15 28,139,421 - 28,177,787 (+) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
MARCO Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 10 11,329,036 - 11,389,428 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 10 11,329,026 - 11,388,999 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666061 11,291,422 - 11,352,136 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Marco
.
Predicted Target Of
Count of predictions: 48 Count of miRNA genes: 39 Interacting mature miRNAs: 47 Transcripts: ENSRNOT00000075773 Prediction methods: Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
2317027 Aia22 Adjuvant induced arthritis QTL 22 2.29 joint integrity trait (VT:0010548) right rear ankle joint diameter (CMO:0002150) 13 1 34266636 Rat 9589141 Insul28 Insulin level QTL 28 10.82 0.001 blood insulin amount (VT:0001560) plasma insulin level (CMO:0000342) 13 9313465 54313465 Rat 2317034 Aia9 Adjuvant induced arthritis QTL 9 4.62 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 13 11766535 32331607 Rat 61391 Bp5 Blood pressure QTL 5 5.6 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 13 22301875 67301875 Rat 1300163 Cardf1 Cardiac cell morphology QTL 1 4.18 aorta morphology trait (VT:0000272) artery lesion measurement (CMO:0000975) 13 11929449 45417941 Rat 2317040 Aia21 Adjuvant induced arthritis QTL 21 2.75 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 13 9831541 54831541 Rat 631645 Bp121 Blood pressure QTL 121 3.3 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 14915655 59915655 Rat 2317046 Aia8 Adjuvant induced arthritis QTL 8 3.9700000286102295 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 13 9831541 54831541 Rat 2303030 Bp327 Blood pressure QTL 327 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 30395351 41184251 Rat 2317044 Aia23 Adjuvant induced arthritis QTL 23 2.3 joint integrity trait (VT:0010548) ankle joint diameter (CMO:0002148) 13 11766535 32331607 Rat 1581570 Eae17 Experimental allergic encephalomyelitis QTL 17 4.1 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 13 8897350 101631289 Rat 61339 Bp24 Blood pressure QTL 24 0.05 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 5994668 44807491 Rat 70170 Eae14 Experimental allergic encephalomyelitis QTL 14 0.0024 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 13 23203448 68203448 Rat 1331784 Bp222 Blood pressure QTL 222 2.944 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 13 17694436 53050594 Rat 1581573 Uae36 Urinary albumin excretion QTL 36 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 2302275 Gluco37 Glucose level QTL 37 3.8 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 13 11929449 46193066 Rat 7207885 Glom27 Glomerulus QTL 27 3.9 kidney glomerulus integrity trait (VT:0010546) kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139) 13 20605871 101339738 Rat 1558644 Cm45 Cardiac mass QTL 45 3.6 0.002 heart mass (VT:0007028) heart wet weight (CMO:0000069) 13 23692969 68692969 Rat 70181 BpQTLcluster11 Blood pressure QTL cluster 11 6.922 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 13 31241331 93395974 Rat 1354621 Rf47 Renal function QTL 47 3.7 kidney renin amount (VT:0010559) kidney renin level (CMO:0002166) 13 30395351 101056920 Rat 2301962 Cm72 Cardiac mass QTL 72 4.12 heart left ventricle mass (VT:0007031) heart left ventricle weight (CMO:0000776) 13 31241331 58363171 Rat 1581554 Pur11 Proteinuria QTL 11 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 13 5994833 77046787 Rat 631672 Iddm12 Insulin dependent diabetes mellitus QTL 12 2.2 0.0032 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 13 5994668 34535351 Rat 6893338 Cm76 Cardiac mass QTL 76 0 0.99 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 13 23692969 68692969 Rat 1354666 Bp244 Blood pressure QTL 244 4.9 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 13 1 101056920 Rat 9589164 Gluco66 Glucose level QTL 66 6.67 0.001 blood glucose amount (VT:0000188) plasma glucose level (CMO:0000042) 13 15158722 60158722 Rat 738036 Lnnr4 Liver neoplastic nodule remodeling QTL 4 3.64 liver integrity trait (VT:0010547) liver remodeling tumorous lesion number (CMO:0001461) 13 1 42356786 Rat 7411662 Foco29 Food consumption QTL 29 20.8 0.001 eating behavior trait (VT:0001431) feed conversion ratio (CMO:0001312) 13 9313465 54313465 Rat
D13Rat15
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 13 31,623,770 - 31,623,898 (+) MAPPER mRatBN7.2 Rnor_6.0 16 85,122,693 - 85,122,820 NCBI Rnor6.0 Rnor_5.0 16 84,563,135 - 84,563,262 UniSTS Rnor5.0 Celera 13 31,504,697 - 31,504,824 UniSTS RH 2.0 Map 13 60.2 RGD SHRSP x BN Map 13 3.4599 RGD
D13Got222
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 13 31,636,565 - 31,636,701 (+) MAPPER mRatBN7.2 Rnor_6.0 16 85,135,488 - 85,135,624 NCBI Rnor6.0 Rnor_5.0 16 84,575,930 - 84,576,066 UniSTS Rnor5.0 Celera 13 31,517,492 - 31,517,623 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
2
4
9
33
75
80
55
20
55
4
112
37
21
14
43
25
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000075773 ⟹ ENSRNOP00000066125
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 31,616,278 - 31,648,521 (-) Ensembl Rnor_6.0 Ensembl 16 85,115,201 - 85,135,859 (-) Ensembl
Ensembl Acc Id:
ENSRNOT00000106911 ⟹ ENSRNOP00000077144
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 13 31,616,278 - 31,648,521 (-) Ensembl
RefSeq Acc Id:
NM_001109011 ⟹ NP_001102481
RefSeq Status:
PROVISIONAL
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 34,169,011 - 34,201,255 (-) NCBI mRatBN7.2 13 31,616,278 - 31,648,521 (-) NCBI Rnor_6.0 16 85,115,199 - 85,147,683 (-) NCBI Rnor_5.0 16 84,555,641 - 84,587,281 (-) NCBI Celera 13 31,497,203 - 31,529,354 (-) NCBI
Sequence:
GAGTGTCACCGAGGGGCTTGGGGACATGGAGGGTCTTTTCCAAACTTCTTCAATTATCCTTAACAGGCAGCTTCCCCACACAACAGCTCCACTGTGAACAGCCTGATTTTTAGCAAACTCTACATTAA
hide sequence
RefSeq Acc Id:
XM_063272524 ⟹ XP_063128594
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 13 34,169,014 - 34,210,340 (-) NCBI
RefSeq Acc Id:
NP_001102481 ⟸ NM_001109011
- UniProtKB:
M0R9F7 (UniProtKB/TrEMBL), A6K7Z9 (UniProtKB/TrEMBL), A0A8I5Y779 (UniProtKB/TrEMBL)
- Sequence:
MGSKETLKEEAFLGSTEDGADFDQDMLPVMETFEINDPVPKKRNGRTLCMAVMAIHLILLTAGTALLLIQVLNLQEQFQSLEMCCDNGTLAAEDKPFFSLQWARPKTHIVSGAQGLQALQAQLSWVHT
hide sequence
Ensembl Acc Id:
ENSRNOP00000066125 ⟸ ENSRNOT00000075773
Ensembl Acc Id:
ENSRNOP00000077144 ⟸ ENSRNOT00000106911
RefSeq Acc Id:
XP_063128594 ⟸ XM_063272524
- Peptide Label:
isoform X1
- UniProtKB:
A0A8I5Y779 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-03-05
Marco
macrophage receptor with collagenous structure
LOC367391
similar to Macrophage receptor MARCO (Macrophage receptor with collagenous structure)
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2006-11-19
LOC367391
similar to Macrophage receptor MARCO (Macrophage receptor with collagenous structure)
Symbol and Name status set to provisional
70820 PROVISIONAL
