Prm1 (protamine 1) - Rat Genome Database

Name: Prm1
Creator: Rat Genome Database
License: Creative Commons CC BY 4.0
Keywords: Rat Gene RGD Genome

Advanced Search (OLGA)

Gene: Prm1 (protamine 1) Rattus norvegicus

Analyze

Symbol:

Prm1

Name:

protamine 1

RGD ID:

1583873

Description:

Predicted to enable DNA binding activity. Predicted to be involved in chromosome condensation and sperm DNA condensation. Predicted to act upstream of or within nucleus organization and spermatid development. Predicted to be located in cytosol; male germ cell nucleus; and nucleoplasm. Predicted to be part of nucleosome. Orthologous to human PRM1 (protamine 1); INTERACTS WITH 2,2',4,4'-Tetrabromodiphenyl ether; 2,2',5,5'-tetrachlorobiphenyl; 6-propyl-2-thiouracil.

Type:

protein-coding

RefSeq Status:

VALIDATED

Previously known as:

cysteine-rich protamine; Prm1_mapped; protamine 1 (mapped); protamine P1; sperm protamine P1; sperm protamine-P1

RGD Orthologs

Alliance Orthologs

More Info

more info ...

More Info

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Homo sapiens (human):	PRM1 (protamine 1)	HGNC	NCBI, OMA, Panther
Mus musculus (house mouse):	Prm1 (protamine 1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):	PRM1 (protamine 1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Sus scrofa (pig):	PRM1 (protamine 1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):	PRM1 (protamine 1)	Transitive Ortholog Pipeline	Transitive Ortholog Pipeline
Alliance orthologs ³
Mus musculus (house mouse):	Prm1 (protamine 1)	Alliance	DIOPT (Ensembl Compara\|OMA\|OrthoFinder\|OrthoInspector\|SonicParanoid)
Homo sapiens (human):	PRM1 (protamine 1)	Alliance	DIOPT (HGNC\|OMA)

Latest Assembly:

mRatBN7.2 - mRatBN7.2 Assembly

Position:

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	10	5,378,740 - 5,379,235 (+)	NCBI		GRCr8
mRatBN7.2	10	4,871,817 - 4,872,312 (+)	NCBI	mRatBN7.2	mRatBN7.2
UTH_Rnor_SHR_Utx	10	9,568,484 - 9,568,730 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	10	9,089,600 - 9,089,846 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	10	4,727,881 - 4,728,127 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	10	4,945,995 - 4,946,241 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	4,945,911 - 4,946,397 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	3,772,481 - 3,772,727 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	10	4,808,354 - 4,808,600 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	10	3,893,505 - 3,893,751 (+)	NCBI		Celera
Cytogenetic Map	10	q11	NCBI

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation Click to see Annotation Detail View

Disease Annotations Click to see Annotation Detail View

Charcot-Marie-Tooth disease type 1C (ISO)

Landau-Kleffner syndrome (ISO)

MHC class II deficiency (ISO)

Gene-Chemical Interaction Annotations Click to see Annotation Detail View

17alpha-ethynylestradiol (ISO)

2,2',4,4',5,5'-hexachlorobiphenyl (ISO)

2,2',4,4'-Tetrabromodiphenyl ether (EXP)

2,2',5,5'-tetrachlorobiphenyl (EXP,ISO)

2,3,7,8-tetrachlorodibenzodioxine (ISO)

4-hydroxyphenyl retinamide (ISO)

6-propyl-2-thiouracil (EXP)

all-trans-retinoic acid (ISO)

all-trans-retinol (ISO)

allethrin (EXP)

amitrole (EXP)

ammonium chloride (EXP)

Aroclor 1254 (ISO)

bis(2-ethylhexyl) phthalate (ISO)

bisphenol A (EXP,ISO)

cadmium dichloride (EXP)

carbon nanotube (ISO)

cocaine (ISO)

cyhalothrin (EXP)

cypermethrin (EXP)

diclofenac (ISO)

fenvalerate (EXP)

folic acid (ISO)

glyphosate (EXP)

herbicide (EXP)

ibuprofen (ISO)

lead nitrate (EXP)

methimazole (EXP)

PCB138 (EXP,ISO)

pirinixic acid (ISO)

procarbazine (EXP)

propiconazole (EXP)

pyrethrins (EXP)

sodium arsenite (ISO)

sodium fluoride (ISO)

sulfadimethoxine (EXP)

valproic acid (ISO)

vinclozolin (EXP)

Gene Ontology Annotations Click to see Annotation Detail View

Biological Process

chromosome condensation (IEA)

nucleus organization (ISO)

sperm DNA condensation (IEA)

spermatid development (ISO)

Cellular Component

cytoplasm (ISO)

cytosol (ISO)

male germ cell nucleus (ISO)

nucleoplasm (ISO)

nucleosome (IEA)

nucleus (ISO)

Molecular Function

DNA binding (IEA)

protein binding (ISO)

References

References - curated

#	Reference Title	Reference Citation
1.	GOA pipeline	RGD automated data pipeline
2.	Data Import for Chemical-Gene Interactions	RGD automated import pipeline for gene-chemical interactions

Additional References at PubMed

PMID:1268226	PMID:1627265	PMID:2757789	PMID:3072011	PMID:8185929	PMID:8618919	PMID:8720108	PMID:10369260	PMID:11326282	PMID:12477932	PMID:14680821

Genomics

Comparative Map Data

Prm1
(Rattus norvegicus - Norway rat)

Rat Assembly	Chr	Position (strand)	Source	Genome Browsers
Rat Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCr8	10	5,378,740 - 5,379,235 (+)	NCBI		GRCr8
mRatBN7.2	10	4,871,817 - 4,872,312 (+)	NCBI	mRatBN7.2	mRatBN7.2
UTH_Rnor_SHR_Utx	10	9,568,484 - 9,568,730 (+)	NCBI	Rnor_SHR	UTH_Rnor_SHR_Utx
UTH_Rnor_SHRSP_BbbUtx_1.0	10	9,089,600 - 9,089,846 (+)	NCBI	Rnor_SHRSP	UTH_Rnor_SHRSP_BbbUtx_1.0
UTH_Rnor_WKY_Bbb_1.0	10	4,727,881 - 4,728,127 (+)	NCBI	Rnor_WKY	UTH_Rnor_WKY_Bbb_1.0
Rnor_6.0	10	4,945,995 - 4,946,241 (+)	NCBI	Rnor6.0	Rnor_6.0	rn6	Rnor6.0
Rnor_6.0 Ensembl	10	4,945,911 - 4,946,397 (+)	Ensembl	Rnor6.0		rn6	Rnor6.0
Rnor_5.0	10	3,772,481 - 3,772,727 (+)	NCBI	Rnor5.0	Rnor_5.0	rn5	Rnor5.0
RGSC_v3.4	10	4,808,354 - 4,808,600 (+)	NCBI	RGSC3.4	RGSC_v3.4	rn4	RGSC3.4
Celera	10	3,893,505 - 3,893,751 (+)	NCBI		Celera
Cytogenetic Map	10	q11	NCBI

PRM1
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	16	11,280,841 - 11,281,330 (-)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh38.p14 Ensembl	16	11,280,841 - 11,281,330 (-)	Ensembl	GRCh38		hg38	GRCh38
GRCh37	16	11,374,698 - 11,375,187 (-)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Build 36	16	11,282,194 - 11,282,693 (-)	NCBI	NCBI36	Build 36	hg18	NCBI36
Build 34	16	11,282,199 - 11,282,685	NCBI
Celera	16	11,544,077 - 11,544,576 (-)	NCBI		Celera
Cytogenetic Map	16	p13.13	NCBI
HuRef	16	11,292,416 - 11,292,915 (-)	NCBI		HuRef
CHM1_1	16	11,374,599 - 11,375,098 (-)	NCBI		CHM1_1
T2T-CHM13v2.0	16	11,317,056 - 11,317,545 (-)	NCBI		T2T-CHM13v2.0

Prm1
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm39	16	10,614,196 - 10,614,687 (-)	NCBI	GRCm39	GRCm39	mm39
GRCm39 Ensembl	16	10,614,190 - 10,623,703 (-)	Ensembl		GRCm39 Ensembl
GRCm38	16	10,796,332 - 10,796,823 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
GRCm38.p6 Ensembl	16	10,796,326 - 10,805,839 (-)	Ensembl	GRCm38		mm10	GRCm38
MGSCv37	16	10,796,425 - 10,796,916 (-)	NCBI	GRCm37	MGSCv37	mm9	NCBIm37
MGSCv36	16	10,709,910 - 10,710,401 (-)	NCBI		MGSCv36	mm8
Celera	16	11,423,762 - 11,424,253 (-)	NCBI		Celera
Cytogenetic Map	16	A1	NCBI
cM Map	16	5.87	NCBI

PRM1
(Pan paniscus - bonobo/pygmy chimpanzee)

Bonobo Assembly	Chr	Position (strand)	Source	Genome Browsers
Bonobo Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
NHGRI_mPanPan1-v2	18	11,829,110 - 11,831,298 (-)	NCBI		NHGRI_mPanPan1-v2
NHGRI_mPanPan1	16	15,599,576 - 15,601,748 (-)	NCBI		NHGRI_mPanPan1
Mhudiblu_PPA_v0	16	10,222,779 - 10,223,289 (-)	NCBI	Mhudiblu_PPA_v0	Mhudiblu_PPA_v0	panPan3
PanPan1.1	16	11,444,606 - 11,445,114 (-)	NCBI	panpan1.1	PanPan1.1	panPan2

PRM1
(Sus scrofa - pig)

Pig Assembly	Chr	Position (strand)	Source	Genome Browsers
Pig Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
Sscrofa11.1 Ensembl	3	31,861,087 - 31,861,510 (+)	Ensembl	Sscrofa11.1		susScr11	Sscrofa11.1
Sscrofa11.1	3	31,861,087 - 31,861,529 (+)	NCBI	Sscrofa11.1	Sscrofa11.1	susScr11	Sscrofa11.1
Sscrofa10.2	3	32,650,583 - 32,651,026 (+)	NCBI	Sscrofa10.2	Sscrofa10.2	susScr3

PRM1
(Chlorocebus sabaeus - green monkey)

Green Monkey Assembly	Chr	Position (strand)	Source	Genome Browsers
Green Monkey Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
ChlSab1.1	5	10,758,057 - 10,758,574 (-)	NCBI	ChlSab1.1	ChlSab1.1	chlSab2
Vero_WHO_p1.0	NW_023666068	19,405,264 - 19,405,904 (+)	NCBI	Vero_WHO_p1.0	Vero_WHO_p1.0

Variants

Variants in Prm1
1 total Variants

miRNA Target Status

Predicted Target Of

	Summary Value
Count of predictions:	31
Count of miRNA genes:	29
Interacting mature miRNAs:	31
Transcripts:	ENSRNOT00000003420
Prediction methods:	Miranda, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
634329	Pia15	Pristane induced arthritis QTL 15	3.1		joint integrity trait (VT:0010548)	joint inflammation composite score (CMO:0000919)	10	1	24158324	Rat
2293680	Bss40	Bone structure and strength QTL 40	5.66	0.0001	femur strength trait (VT:0010010)	femur total energy absorbed before break (CMO:0001677)	10	1	35225947	Rat
7387235	Uae41	Urinary albumin excretion QTL 41	5.26	0.1874	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	10	1	29497586	Rat
10401803	Kidm50	Kidney mass QTL 50			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	10	418344	45418344	Rat
1576304	Schws7	Schwannoma susceptibility QTL 7		0.0115	nervous system integrity trait (VT:0010566)	percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)	10	4765527	19816042	Rat
7411611	Foco17	Food consumption QTL 17	18.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	10	1	42315980	Rat
631554	Bp133	Blood pressure QTL 133		0.005	arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	743364	63851208	Rat
1549898	Neuinf3	Neuroinflammation QTL 3	26.4		nervous system integrity trait (VT:0010566)	MHC Class II RT1A-positive spinal cord ventral horn area to total spinal cord ventral horn area ratio (CMO:0001980)	10	3406320	5387112	Rat
634327	Hc4	Hypercalciuria QTL 4	2.4		urine calcium amount (VT:0002985)	urine calcium excretion rate (CMO:0000763)	10	1	38328221	Rat
70223	Bp57	Blood pressure QTL 57	5		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	10	1	80676123	Rat

Expression

RNA-SEQ Expression

Click on a value in the shaded box below the category label to view a detailed expression data table for that system.

Download All Expressed Objects for this Gene

alimentary part of gastrointestinal system	appendage	circulatory system	ectoderm	endocrine system	endoderm	exocrine system	hemolymphoid system	hepatobiliary system	integumental system	mesenchyme	mesoderm	nervous system	renal system	reproductive system	respiratory system
3	7	8	27	34	28	16	13	16	2	65	33	17	9	31	12

Sequence

Nucleotide Sequences


RefSeq Transcripts	NM_001002850	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	BC126070	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CH474017	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	JAXUCZ010000010	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	M83729	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	Z12148	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	Z46939	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Ensembl Acc Id:

ENSRNOT00000003420 ⟹ ENSRNOP00000003420

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0 Ensembl	10	4,945,911 - 4,946,397 (+)	Ensembl

RefSeq Acc Id:

NM_001002850 ⟹ NP_001002850

RefSeq Status:

VALIDATED

Type:

CODING

Position:

Rat Assembly	Chr	Position (strand)	Source
GRCr8	10	5,378,740 - 5,379,235 (+)	NCBI
mRatBN7.2	10	4,871,817 - 4,872,312 (+)	NCBI
Rnor_6.0	10	4,945,995 - 4,946,241 (+)	NCBI
Rnor_5.0	10	3,772,481 - 3,772,727 (+)	NCBI
RGSC_v3.4	10	4,808,354 - 4,808,600 (+)	RGD
Celera	10	3,893,505 - 3,893,751 (+)	RGD

Sequence:

show sequence

ATGGCCAGATACCGATGCTGCCGCAGCAAAAGCAGGAGCAGATGCCGCCGCCGCAGGCGAAGAT
GTCGCAGACGGAGGAGGCGGTGCTGCAGGCGGAGGCGGCGAAGGTGCTGCCGCCGCCGCCGCTC
ATACACCTTTAGGTGTAAAAGATACTAG

hide sequence

Protein Sequences


Protein RefSeqs	NP_001002850	(Get FASTA)	NCBI Sequence Viewer
GenBank Protein	AAI26071	(Get FASTA)	NCBI Sequence Viewer
	CAA78132	(Get FASTA)	NCBI Sequence Viewer
	CAA87061	(Get FASTA)	NCBI Sequence Viewer
	EDL96207	(Get FASTA)	NCBI Sequence Viewer
Ensembl Protein	ENSRNOP00055025957
	ENSRNOP00060017262
	ENSRNOP00065002732
GenBank Protein	P10118	(Get FASTA)	NCBI Sequence Viewer

RefSeq Acc Id:	NP_001002850 ⟸ NM_001002850
- UniProtKB:	A0JN03 (UniProtKB/Swiss-Prot), P10118 (UniProtKB/Swiss-Prot), A6K4I5 (UniProtKB/TrEMBL)
- Sequence:	show sequence MARYRCCRSKSRSRCRRRRRRCRRRRRRCCRRRRRRCCRRRRSYTFRCKRY hide sequence

Ensembl Acc Id:

ENSRNOP00000003420 ⟸ ENSRNOT00000003420

Protein Structures

Name	Modeler	Protein Id	AA Range	Protein Structure
AF-P10118-F1-model_v2	AlphaFold	P10118	1-51	view protein structure

Transcriptome

eQTL		View at Phenogen
WGCNA		View at Phenogen
Tissue/Strain Expression		View at Phenogen

Promoters

RGD ID:

13696939

Promoter ID:

EPDNEW_R7464

Type:

single initiation site

Name:

Prm1_1

Description:

protamine 1

SO ACC ID:

SO:0000170

Source:

EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/)

Experiment Methods:

Single-end sequencing.

Position:

Rat Assembly	Chr	Position (strand)	Source
Rnor_6.0	10	4,945,903 - 4,945,963	EPDNEW

Additional Information

External Database Links

Database	Acc Id	Source(s)
AGR Gene	RGD:1583873	AgrOrtholog
BioCyc Gene	G2FUF-26146	BioCyc
Ensembl Genes	ENSRNOG00000002532	Ensembl
	ENSRNOG00055018842	UniProtKB/Swiss-Prot
	ENSRNOG00060012834	UniProtKB/Swiss-Prot
	ENSRNOG00065002819	UniProtKB/Swiss-Prot
Ensembl Transcript	ENSRNOT00055032099	UniProtKB/Swiss-Prot
	ENSRNOT00060021816	UniProtKB/Swiss-Prot
	ENSRNOT00065003874	UniProtKB/Swiss-Prot
IMAGE_CLONE	IMAGE:7134211	IMAGE-MGC_LOAD
InterPro	Protamine_P1	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
KEGG Report	rno:24685	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
MGC_CLONE	MGC:156539	IMAGE-MGC_LOAD
NCBI Gene	24685	ENTREZGENE
Pfam	Protamine_P1	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
PhenoGen	Prm1	PhenoGen
PROSITE	PROTAMINE_P1	UniProtKB/Swiss-Prot, UniProtKB/TrEMBL
RatGTEx	ENSRNOG00000002532	RatGTEx
	ENSRNOG00055018842	RatGTEx
	ENSRNOG00060012834	RatGTEx
	ENSRNOG00065002819	RatGTEx
UniProt	A0JN03	ENTREZGENE
	A6K4I5	ENTREZGENE, UniProtKB/TrEMBL
	HSP1_RAT	UniProtKB/Swiss-Prot, ENTREZGENE
UniProt Secondary	A0JN03	UniProtKB/Swiss-Prot

Nomenclature History

Date	Current Symbol	Current Name	Previous Symbol	Previous Name	Description	Reference	Status
2007-04-13		protamine 1	Prm1	protamine 1 (mapped)	Name updated	737654	APPROVED
2007-04-12	Prm1	protamine 1 (mapped)	Prm1_mapped	protamine 1 (mapped)	Data merged from RGD:3408	737654	APPROVED
2006-11-19	Prm1	protamine 1 (mapped)			Symbol and Name status set to provisional	70820	PROVISIONAL
2005-11-17	Prm1_mapped	protamine 1 (mapped)	Prm1	protamine 1	Symbol and Name updated	1556543	APPROVED
2002-06-10	Prm1	Protamine 1			Symbol and Name status set to approved	70586	APPROVED

RGD Curation Notes

Note Type	Note	Reference
gene_expression	expressed in the central layers of the testis tubuli seminiferi in sexually mature rats	1334512

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message

Imported Disease Annotations - ClinVar