Symbol:
Srpra
Name:
SRP receptor subunit alpha
RGD ID:
1311504
Description:
Predicted to enable GTPase activity and signal recognition particle binding activity. Predicted to be involved in protein targeting to ER. Predicted to be located in membrane. Predicted to be part of signal recognition particle receptor complex. Predicted to be active in endoplasmic reticulum membrane. Orthologous to human SRPRA (SRP receptor subunit alpha); INTERACTS WITH (+)-schisandrin B; 2,6-dinitrotoluene; bisphenol A.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC315548; MGC124867; signal recognition particle receptor; signal recognition particle receptor ('docking protein'); signal recognition particle receptor subunit alpha; SRP receptor alpha subunit; Srpr
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Species
Gene symbol and name
Data Source
Assertion derived from
less info ...
Orthologs 1
Homo sapiens (human):
SRPRA (SRP receptor subunit alpha) HGNC
EggNOG, Ensembl, HomoloGene, Inparanoid, NCBI, OMA, OrthoDB, OrthoMCL, Panther, PhylomeDB, Treefam
Mus musculus (house mouse):
Srpra (signal recognition particle receptor alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chinchilla lanigera (long-tailed chinchilla):
Srpra (SRP receptor subunit alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Pan paniscus (bonobo/pygmy chimpanzee):
SRPRA (SRP receptor subunit alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Canis lupus familiaris (dog):
SRPRA (SRP receptor subunit alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Ictidomys tridecemlineatus (thirteen-lined ground squirrel):
Srpra (SRP receptor subunit alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Sus scrofa (pig):
SRPRA (SRP receptor subunit alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Chlorocebus sabaeus (green monkey):
SRPRA (SRP receptor subunit alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Heterocephalus glaber (naked mole-rat):
Srpra (SRP receptor subunit alpha) Transitive Ortholog Pipeline
Transitive Ortholog Pipeline
Other homologs 2
Homo sapiens (human):
KCNK7 (potassium two pore domain channel subfamily K member 7) HGNC
OMA
Alliance orthologs 3
Homo sapiens (human):
SRPRA (SRP receptor subunit alpha)
Alliance
DIOPT (Ensembl Compara|HGNC|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Mus musculus (house mouse):
Srpra (signal recognition particle receptor alpha)
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Caenorhabditis elegans (roundworm):
F38A1.8
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Drosophila melanogaster (fruit fly):
Gtp-bp
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Saccharomyces cerevisiae (baker's yeast):
SRP101
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Danio rerio (zebrafish):
srpra
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Xenopus tropicalis (tropical clawed frog):
srpra
Alliance
DIOPT (Ensembl Compara|Hieranoid|InParanoid|OMA|OrthoFinder|OrthoInspector|PANTHER|PhylomeDB|SonicParanoid)
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 41,818,199 - 41,824,292 (+) NCBI GRCr8 mRatBN7.2 8 33,560,365 - 33,566,458 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 33,560,348 - 33,566,470 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 37,630,487 - 37,636,631 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 35,913,527 - 35,919,671 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 33,776,372 - 33,782,516 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 36,410,683 - 36,416,766 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 36,410,683 - 36,416,296 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 36,428,866 - 36,434,949 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 34,992,187 - 34,998,270 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 35,000,954 - 35,007,031 (+) NCBI Celera 8 34,979,915 - 34,986,044 (+) NCBI Celera Cytogenetic Map 8 q21 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Srpra Rat (+)-schisandrin B multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of SRPRA mRNA] CTD PMID:31150632 Srpra Rat (1->4)-beta-D-glucan multiple interactions ISO Srpra (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of SRPRA mRNA CTD PMID:36331819 Srpra Rat 1,2-dimethylhydrazine increases expression ISO Srpra (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in increased expression of SRPRA mRNA CTD PMID:22206623 Srpra Rat 17alpha-ethynylestradiol affects expression ISO Srpra (Mus musculus) 6480464 Ethinyl Estradiol affects the expression of SRPRA mRNA CTD PMID:17555576 Srpra Rat 17alpha-ethynylestradiol multiple interactions ISO Srpra (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of SRPRA mRNA CTD PMID:17942748 Srpra Rat 17alpha-ethynylestradiol increases expression ISO Srpra (Mus musculus) 6480464 Ethinyl Estradiol results in increased expression of SRPRA mRNA CTD PMID:17942748 Srpra Rat 17beta-estradiol increases expression ISO SRPRA (Homo sapiens) 6480464 Estradiol results in increased expression of SRPRA mRNA CTD PMID:19167446 Srpra Rat 17beta-estradiol increases expression ISO Srpra (Mus musculus) 6480464 Estradiol results in increased expression of SRPRA mRNA CTD PMID:39298647 Srpra Rat 17beta-hydroxy-5alpha-androstan-3-one increases expression ISO SRPRA (Homo sapiens) 6480464 Dihydrotestosterone results in increased expression of SRPRA mRNA CTD PMID:29581250 Srpra Rat 2,2',4,4'-Tetrabromodiphenyl ether affects expression ISO Srpra (Mus musculus) 6480464 2 more ... CTD PMID:30294300 Srpra Rat 2,3,7,8-tetrachlorodibenzodioxine multiple interactions ISO Srpra (Mus musculus) 6480464 [Tetrachlorodibenzodioxin co-treated with Ethinyl Estradiol] results in increased expression of SRPRA mRNA CTD PMID:17942748 Srpra Rat 2,3,7,8-tetrachlorodibenzodioxine increases expression ISO Srpra (Mus musculus) 6480464 Tetrachlorodibenzodioxin results in increased expression of SRPRA mRNA CTD PMID:23994337 Srpra Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Srpra (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of SRPRA mRNA CTD PMID:21570461 Srpra Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of SRPRA mRNA CTD PMID:21346803 Srpra Rat 3,3',4,4',5-pentachlorobiphenyl increases expression ISO Srpra (Mus musculus) 6480464 3 more ... CTD PMID:23994337 Srpra Rat 3,3',5,5'-tetrabromobisphenol A increases expression ISO SRPRA (Homo sapiens) 6480464 tetrabromobisphenol A results in increased expression of SRPRA protein CTD PMID:31675489 Srpra Rat 3-isobutyl-1-methyl-7H-xanthine multiple interactions ISO SRPRA (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of SRPRA mRNA CTD PMID:28628672 Srpra Rat 4,4'-sulfonyldiphenol increases expression ISO Srpra (Mus musculus) 6480464 bisphenol S results in increased expression of SRPRA mRNA CTD PMID:39298647 Srpra Rat acrolein multiple interactions ISO SRPRA (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with Ozone] results in increased expression of SRPRA mRNA CTD PMID:32845096 Srpra Rat aflatoxin B1 increases methylation ISO SRPRA (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of SRPRA gene CTD PMID:27153756 Srpra Rat aristolochic acid A decreases expression ISO SRPRA (Homo sapiens) 6480464 aristolochic acid I results in decreased expression of SRPRA mRNA CTD PMID:33212167 Srpra Rat bathocuproine disulfonic acid multiple interactions ISO SRPRA (Homo sapiens) 6480464 [bathocuproine sulfonate co-treated with pyrrolidine dithiocarbamic acid] inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of SRPRA mRNA] CTD PMID:15477007 Srpra Rat beta-naphthoflavone increases expression ISO Srpra (Mus musculus) 6480464 beta-Naphthoflavone results in increased expression of SRPRA mRNA CTD PMID:23994337 Srpra Rat bisphenol A affects expression EXP 6480464 bisphenol A affects the expression of SRPRA mRNA CTD PMID:25181051 Srpra Rat bisphenol A decreases expression ISO Srpra (Mus musculus) 6480464 bisphenol A results in decreased expression of SRPRA mRNA CTD PMID:33221593 Srpra Rat bisphenol A affects expression ISO SRPRA (Homo sapiens) 6480464 bisphenol A affects the expression of SRPRA mRNA CTD PMID:30903817 Srpra Rat bisphenol A decreases expression ISO SRPRA (Homo sapiens) 6480464 bisphenol A results in decreased expression of SRPRA protein CTD PMID:31675489 Srpra Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of SRPRA mRNA CTD PMID:30816183 more ... Srpra Rat Bisphenol B increases expression ISO SRPRA (Homo sapiens) 6480464 bisphenol B results in increased expression of SRPRA protein CTD PMID:34186270 Srpra Rat bisphenol F increases expression ISO Srpra (Mus musculus) 6480464 bisphenol F results in increased expression of SRPRA mRNA CTD PMID:38685157 Srpra Rat bisphenol F multiple interactions ISO SRPRA (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of SRPRA mRNA CTD PMID:28628672 Srpra Rat bisphenol F increases expression ISO SRPRA (Homo sapiens) 6480464 bisphenol F results in increased expression of SRPRA protein CTD PMID:34186270 Srpra Rat buspirone decreases expression EXP 6480464 Buspirone results in decreased expression of SRPRA mRNA CTD PMID:24136188 Srpra Rat cadmium dichloride increases expression EXP 6480464 Cadmium Chloride results in increased expression of SRPRA mRNA CTD PMID:21297351 Srpra Rat cadmium dichloride increases expression ISO SRPRA (Homo sapiens) 6480464 Cadmium Chloride results in increased expression of SRPRA mRNA CTD PMID:26472689 Srpra Rat carbon nanotube increases expression ISO Srpra (Mus musculus) 6480464 Nanotubes more ... CTD PMID:25554681 and PMID:25620056 Srpra Rat cefaloridine decreases expression EXP 6480464 Cephaloridine results in decreased expression of SRPRA mRNA CTD PMID:18500788 Srpra Rat CGP 52608 multiple interactions ISO SRPRA (Homo sapiens) 6480464 CGP 52608 promotes the reaction [RORA protein binds to SRPRA gene] CTD PMID:28238834 Srpra Rat clobetasol increases expression ISO Srpra (Mus musculus) 6480464 Clobetasol results in increased expression of SRPRA mRNA CTD PMID:27462272 Srpra Rat clofibrate decreases expression ISO Srpra (Mus musculus) 6480464 Clofibrate results in decreased expression of SRPRA mRNA CTD PMID:17585979 Srpra Rat cyclosporin A increases expression ISO SRPRA (Homo sapiens) 6480464 Cyclosporine results in increased expression of SRPRA mRNA CTD PMID:20106945 more ... Srpra Rat cyproconazole increases expression ISO Srpra (Mus musculus) 6480464 cyproconazole results in increased expression of SRPRA mRNA CTD PMID:22334560 Srpra Rat decabromodiphenyl ether increases expression ISO SRPRA (Homo sapiens) 6480464 decabromobiphenyl ether results in increased expression of SRPRA protein CTD PMID:31675489 Srpra Rat dexamethasone multiple interactions ISO SRPRA (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of SRPRA mRNA CTD PMID:28628672 Srpra Rat Dibutyl phosphate affects expression ISO SRPRA (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of SRPRA mRNA CTD PMID:37042841 Srpra Rat dibutyl phthalate increases expression ISO Srpra (Mus musculus) 6480464 Dibutyl Phthalate results in increased expression of SRPRA mRNA CTD PMID:21266533 Srpra Rat dicrotophos increases expression ISO SRPRA (Homo sapiens) 6480464 dicrotophos results in increased expression of SRPRA mRNA CTD PMID:28302478 Srpra Rat disodium selenite increases expression ISO SRPRA (Homo sapiens) 6480464 Sodium Selenite results in increased expression of SRPRA mRNA CTD PMID:18175754 Srpra Rat endosulfan decreases expression EXP 6480464 Endosulfan results in decreased expression of SRPRA mRNA CTD PMID:29391264 Srpra Rat enzyme inhibitor multiple interactions ISO SRPRA (Homo sapiens) 6480464 [Enzyme Inhibitors results in decreased activity of OGA protein] which results in increased O-linked glycosylation of SRPRA protein CTD PMID:23301498 Srpra Rat epoxiconazole increases expression ISO Srpra (Mus musculus) 6480464 epoxiconazole results in increased expression of SRPRA mRNA CTD PMID:22334560 Srpra Rat ethanol affects splicing ISO Srpra (Mus musculus) 6480464 Ethanol affects the splicing of SRPRA mRNA CTD PMID:30319688 Srpra Rat flutamide increases expression EXP 6480464 Flutamide results in increased expression of SRPRA mRNA CTD PMID:24136188 Srpra Rat folic acid decreases expression ISO Srpra (Mus musculus) 6480464 Folic Acid results in decreased expression of SRPRA mRNA CTD PMID:25629700 Srpra Rat FR900359 increases phosphorylation ISO SRPRA (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of SRPRA protein CTD PMID:37730182 Srpra Rat furan increases methylation EXP 6480464 furan results in increased methylation of SRPRA gene CTD PMID:22079235 Srpra Rat geldanamycin increases expression ISO SRPRA (Homo sapiens) 6480464 geldanamycin results in increased expression of SRPRA mRNA CTD PMID:26705709 Srpra Rat genistein multiple interactions ISO SRPRA (Homo sapiens) 6480464 ESR2 promotes the reaction [Genistein results in decreased expression of SRPRA protein] CTD PMID:20884965 Srpra Rat genistein decreases expression ISO SRPRA (Homo sapiens) 6480464 Genistein results in decreased expression of SRPRA protein CTD PMID:20884965 Srpra Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of SRPRA mRNA CTD PMID:22061828 Srpra Rat glafenine increases expression EXP 6480464 Glafenine results in increased expression of SRPRA mRNA CTD PMID:24136188 Srpra Rat haloperidol decreases expression ISO SRPRA (Homo sapiens) 6480464 Haloperidol results in decreased expression of SRPRA protein CTD PMID:34122009 Srpra Rat indometacin multiple interactions ISO SRPRA (Homo sapiens) 6480464 [INS protein co-treated with Dexamethasone co-treated with 1-Methyl-3-isobutylxanthine co-treated with Indomethacin co-treated with bisphenol F] results in increased expression of SRPRA mRNA CTD PMID:28628672 Srpra Rat ionomycin multiple interactions ISO SRPRA (Homo sapiens) 6480464 [bathocuproine sulfonate co-treated with pyrrolidine dithiocarbamic acid] inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of SRPRA mRNA] and [Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of SRPRA mRNA CTD PMID:15477007 Srpra Rat ivermectin decreases expression ISO SRPRA (Homo sapiens) 6480464 Ivermectin results in decreased expression of SRPRA protein CTD PMID:32959892 Srpra Rat methapyrilene decreases expression EXP 6480464 Methapyrilene results in decreased expression of SRPRA mRNA CTD PMID:30467583 Srpra Rat methidathion increases expression ISO Srpra (Mus musculus) 6480464 methidathion results in increased expression of SRPRA mRNA CTD PMID:34813904 Srpra Rat methotrexate decreases expression ISO SRPRA (Homo sapiens) 6480464 Methotrexate results in decreased expression of SRPRA mRNA CTD PMID:24449571 Srpra Rat methylparaben increases expression ISO SRPRA (Homo sapiens) 6480464 methylparaben results in increased expression of SRPRA mRNA CTD PMID:31745603 Srpra Rat nitrates multiple interactions ISO Srpra (Mus musculus) 6480464 [Particulate Matter results in increased abundance of Nitrates] which results in increased expression of SRPRA mRNA CTD PMID:35964746 Srpra Rat ochratoxin A decreases expression ISO SRPRA (Homo sapiens) 6480464 ochratoxin A results in decreased expression of SRPRA mRNA CTD PMID:30559759 Srpra Rat ozone multiple interactions ISO SRPRA (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with Ozone] results in increased expression of SRPRA mRNA CTD PMID:32845096 Srpra Rat paclitaxel affects response to substance ISO SRPRA (Homo sapiens) 6480464 SRPRA protein affects the susceptibility to Paclitaxel CTD PMID:16217747 Srpra Rat perfluorooctane-1-sulfonic acid multiple interactions ISO Srpra (Mus musculus) 6480464 [perfluorooctane sulfonic acid co-treated with Cellulose] results in decreased expression of SRPRA mRNA CTD PMID:36331819 Srpra Rat phorbol 13-acetate 12-myristate multiple interactions ISO SRPRA (Homo sapiens) 6480464 [bathocuproine sulfonate co-treated with pyrrolidine dithiocarbamic acid] inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of SRPRA mRNA] and [Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of SRPRA mRNA CTD PMID:15477007 Srpra Rat propiconazole increases expression ISO Srpra (Mus musculus) 6480464 propiconazole results in increased expression of SRPRA mRNA CTD PMID:21278054 and PMID:22334560 Srpra Rat pyrrolidine dithiocarbamate multiple interactions ISO SRPRA (Homo sapiens) 6480464 [bathocuproine sulfonate co-treated with pyrrolidine dithiocarbamic acid] inhibits the reaction [[Tetradecanoylphorbol Acetate co-treated with Ionomycin] results in increased expression of SRPRA mRNA] CTD PMID:15477007 Srpra Rat resveratrol multiple interactions ISO SRPRA (Homo sapiens) 6480464 [Plant Extracts co-treated with Resveratrol] results in increased expression of SRPRA mRNA CTD PMID:23557933 Srpra Rat silicon dioxide increases expression EXP 6480464 Silicon Dioxide results in increased expression of SRPRA mRNA CTD PMID:18685790 Srpra Rat sodium arsenite increases expression ISO SRPRA (Homo sapiens) 6480464 sodium arsenite results in increased expression of SRPRA mRNA CTD PMID:38568856 Srpra Rat tamoxifen affects expression ISO Srpra (Mus musculus) 6480464 Tamoxifen affects the expression of SRPRA mRNA CTD PMID:17555576 Srpra Rat temozolomide increases expression ISO SRPRA (Homo sapiens) 6480464 Temozolomide results in increased expression of SRPRA mRNA CTD PMID:31758290 Srpra Rat tert-butyl hydroperoxide decreases expression ISO SRPRA (Homo sapiens) 6480464 tert-Butylhydroperoxide results in decreased expression of SRPRA mRNA CTD PMID:15336504 Srpra Rat testosterone decreases expression ISO Srpra (Mus musculus) 6480464 Testosterone deficiency results in decreased expression of SRPRA mRNA CTD PMID:33848595 Srpra Rat tetrachloromethane increases expression EXP 6480464 Carbon Tetrachloride results in increased expression of SRPRA mRNA CTD PMID:31150632 Srpra Rat tetrachloromethane increases expression ISO Srpra (Mus musculus) 6480464 Carbon Tetrachloride results in increased expression of SRPRA mRNA CTD PMID:27339419 and PMID:31919559 Srpra Rat tetrachloromethane multiple interactions EXP 6480464 schizandrin B inhibits the reaction [Carbon Tetrachloride results in increased expression of SRPRA mRNA] CTD PMID:31150632 Srpra Rat tetrahydropalmatine decreases expression ISO SRPRA (Homo sapiens) 6480464 tetrahydropalmatine results in decreased expression of SRPRA protein CTD PMID:20109541 Srpra Rat thapsigargin increases expression ISO SRPRA (Homo sapiens) 6480464 Thapsigargin results in increased expression of SRPRA mRNA CTD PMID:22378314 Srpra Rat thimerosal decreases expression ISO SRPRA (Homo sapiens) 6480464 Thimerosal results in decreased expression of SRPRA mRNA CTD PMID:27188386 Srpra Rat thiram increases expression ISO SRPRA (Homo sapiens) 6480464 Thiram results in increased expression of SRPRA mRNA CTD PMID:38568856 Srpra Rat titanium dioxide decreases methylation ISO Srpra (Mus musculus) 6480464 titanium dioxide results in decreased methylation of SRPRA gene CTD PMID:35295148 Srpra Rat trichostatin A decreases expression ISO SRPRA (Homo sapiens) 6480464 trichostatin A results in decreased expression of SRPRA mRNA CTD PMID:24935251 Srpra Rat triphenyl phosphate affects expression ISO SRPRA (Homo sapiens) 6480464 triphenyl phosphate affects the expression of SRPRA mRNA CTD PMID:37042841 Srpra Rat tunicamycin increases expression ISO SRPRA (Homo sapiens) 6480464 Tunicamycin results in increased expression of SRPRA mRNA CTD PMID:22378314 Srpra Rat valproic acid affects expression ISO Srpra (Mus musculus) 6480464 Valproic Acid affects the expression of SRPRA mRNA CTD PMID:17963808 Srpra Rat valproic acid decreases methylation ISO SRPRA (Homo sapiens) 6480464 Valproic Acid results in decreased methylation of SRPRA gene CTD PMID:29154799 Srpra Rat valproic acid affects expression ISO SRPRA (Homo sapiens) 6480464 Valproic Acid affects the expression of SRPRA mRNA CTD PMID:25979313 Srpra Rat vinclozolin decreases expression EXP 6480464 vinclozolin results in decreased expression of SRPRA mRNA CTD PMID:23034163 Srpra Rat zinc atom increases expression ISO SRPRA (Homo sapiens) 6480464 Zinc deficiency results in increased expression of SRPRA mRNA CTD PMID:22171008 Srpra Rat zinc(0) increases expression ISO SRPRA (Homo sapiens) 6480464 Zinc deficiency results in increased expression of SRPRA mRNA CTD PMID:22171008
(+)-schisandrin B (EXP) (1->4)-beta-D-glucan (ISO) 1,2-dimethylhydrazine (ISO) 17alpha-ethynylestradiol (ISO) 17beta-estradiol (ISO) 17beta-hydroxy-5alpha-androstan-3-one (ISO) 2,2',4,4'-Tetrabromodiphenyl ether (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,6-dinitrotoluene (EXP) 3,3',4,4',5-pentachlorobiphenyl (ISO) 3,3',5,5'-tetrabromobisphenol A (ISO) 3-isobutyl-1-methyl-7H-xanthine (ISO) 4,4'-sulfonyldiphenol (ISO) acrolein (ISO) aflatoxin B1 (ISO) aristolochic acid A (ISO) bathocuproine disulfonic acid (ISO) beta-naphthoflavone (ISO) bisphenol A (EXP,ISO) Bisphenol B (ISO) bisphenol F (ISO) buspirone (EXP) cadmium dichloride (EXP,ISO) carbon nanotube (ISO) cefaloridine (EXP) CGP 52608 (ISO) clobetasol (ISO) clofibrate (ISO) cyclosporin A (ISO) cyproconazole (ISO) decabromodiphenyl ether (ISO) dexamethasone (ISO) Dibutyl phosphate (ISO) dibutyl phthalate (ISO) dicrotophos (ISO) disodium selenite (ISO) endosulfan (EXP) enzyme inhibitor (ISO) epoxiconazole (ISO) ethanol (ISO) flutamide (EXP) folic acid (ISO) FR900359 (ISO) furan (EXP) geldanamycin (ISO) genistein (ISO) gentamycin (EXP) glafenine (EXP) haloperidol (ISO) indometacin (ISO) ionomycin (ISO) ivermectin (ISO) methapyrilene (EXP) methidathion (ISO) methotrexate (ISO) methylparaben (ISO) nitrates (ISO) ochratoxin A (ISO) ozone (ISO) paclitaxel (ISO) perfluorooctane-1-sulfonic acid (ISO) phorbol 13-acetate 12-myristate (ISO) propiconazole (ISO) pyrrolidine dithiocarbamate (ISO) resveratrol (ISO) silicon dioxide (EXP) sodium arsenite (ISO) tamoxifen (ISO) temozolomide (ISO) tert-butyl hydroperoxide (ISO) testosterone (ISO) tetrachloromethane (EXP,ISO) tetrahydropalmatine (ISO) thapsigargin (ISO) thimerosal (ISO) thiram (ISO) titanium dioxide (ISO) trichostatin A (ISO) triphenyl phosphate (ISO) tunicamycin (ISO) valproic acid (ISO) vinclozolin (EXP) zinc atom (ISO) zinc(0) (ISO)
Srpra Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 8 41,818,199 - 41,824,292 (+) NCBI GRCr8 mRatBN7.2 8 33,560,365 - 33,566,458 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 8 33,560,348 - 33,566,470 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 8 37,630,487 - 37,636,631 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 8 35,913,527 - 35,919,671 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 8 33,776,372 - 33,782,516 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 8 36,410,683 - 36,416,766 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 8 36,410,683 - 36,416,296 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 8 36,428,866 - 36,434,949 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 8 34,992,187 - 34,998,270 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 8 35,000,954 - 35,007,031 (+) NCBI Celera 8 34,979,915 - 34,986,044 (+) NCBI Celera Cytogenetic Map 8 q21 NCBI
SRPRA Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 11 126,235,930 - 126,268,895 (-) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 11 126,262,938 - 126,269,144 (-) Ensembl GRCh38 hg38 GRCh38 GRCh37 11 126,132,833 - 126,138,790 (-) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 11 125,638,043 - 125,643,960 (-) NCBI NCBI36 Build 36 hg18 NCBI36 Build 34 11 125,638,042 - 125,643,960 NCBI Celera 11 123,297,838 - 123,303,901 (-) NCBI Celera Cytogenetic Map 11 q24.2 NCBI HuRef 11 122,075,206 - 122,081,269 (-) NCBI HuRef CHM1_1 11 126,019,105 - 126,025,168 (-) NCBI CHM1_1 T2T-CHM13v2.0 11 126,265,417 - 126,298,379 (-) NCBI T2T-CHM13v2.0
Srpra Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 9 35,122,499 - 35,128,299 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 9 35,111,471 - 35,159,269 (+) Ensembl GRCm39 Ensembl GRCm38 9 35,211,203 - 35,217,003 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 9 35,200,175 - 35,247,973 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 9 35,018,788 - 35,024,588 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 9 34,960,874 - 34,966,674 (+) NCBI MGSCv36 mm8 Celera 9 32,447,922 - 32,453,726 (+) NCBI Celera Cytogenetic Map 9 A4 NCBI cM Map 9 20.06 NCBI
Srpra Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 Ensembl NW_004955412 27,287,368 - 27,293,362 (-) Ensembl ChiLan1.0 ChiLan1.0 NW_004955412 27,287,359 - 27,293,362 (-) NCBI ChiLan1.0 ChiLan1.0
SRPRA Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 9 126,938,808 - 126,952,604 (-) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 11 128,048,049 - 128,060,239 (-) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 11 121,071,054 - 121,083,106 (-) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 11 124,987,307 - 124,993,347 (-) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 11 124,987,307 - 124,993,347 (-) Ensembl panpan1.1 panPan2
SRPRA Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 5 8,247,608 - 8,253,411 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 5 8,224,416 - 8,254,792 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 5 8,308,830 - 8,314,605 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 5 8,203,219 - 8,208,993 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 5 8,203,231 - 8,208,989 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 5 8,272,836 - 8,278,587 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 5 8,246,523 - 8,252,291 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 5 8,280,726 - 8,286,491 (+) NCBI UU_Cfam_GSD_1.0
Srpra Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024404947 108,493,753 - 108,499,710 (-) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936572 5,950,530 - 5,958,025 (+) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936572 5,950,608 - 5,956,620 (+) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
SRPRA Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 9 53,358,534 - 53,365,653 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 9 53,358,522 - 53,365,085 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 9 58,968,922 - 58,974,223 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
SRPRA Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 1 117,388,341 - 117,394,358 (-) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 1 117,387,044 - 117,394,415 (-) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666043 8,677,830 - 8,683,823 (+) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Srpra
.
Predicted Target Of
Count of predictions: 44 Count of miRNA genes: 44 Interacting mature miRNAs: 44 Transcripts: ENSRNOT00000015177 Prediction methods: Miranda, Rnahybrid Result types: miRGate_prediction
1298065 Scl16 Serum cholesterol level QTL 16 3.8 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 8 30856404 75856404 Rat 1578769 Uae31 Urinary albumin excretion QTL 31 3.3 0.001 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 30848154 101699754 Rat 11556286 Cm81 Cardiac mass QTL 81 0.01 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 8 30848154 61290444 Rat 1578765 Klgr1 Kidney lesion grade QTL 1 3.3 0.0001 kidney morphology trait (VT:0002135) organ lesion measurement (CMO:0000677) 8 30848154 101699754 Rat 1582222 Epfw2 Epididymal fat weight QTL 2 3.2 0.0005 epididymal fat pad mass (VT:0010421) epididymal fat pad weight to body weight ratio (CMO:0000658) 8 31737729 76737729 Rat 1354627 Despr14 Despair related QTL 14 0.0056 locomotor behavior trait (VT:0001392) amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958) 8 7688955 52688955 Rat 61337 Bp22 Blood pressure QTL 22 5.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 30848154 42692818 Rat 1578755 Pur5 Proteinuria QTL 5 3.3 0.0001 urine total protein amount (VT:0000032) urine total protein excretion rate (CMO:0000756) 8 30848154 101699754 Rat 1300146 Rf17 Renal function QTL 17 2.9 renal blood flow trait (VT:2000006) absolute change in renal blood flow rate (CMO:0001168) 8 28242912 73242912 Rat 8662823 Vetf5 Vascular elastic tissue fragility QTL 5 1.9 artery integrity trait (VT:0010639) patent ductus arteriosus score (CMO:0002566) 8 28242912 99525068 Rat 2313088 Bss75 Bone structure and strength QTL 75 3.1 0.0001 body length (VT:0001256) body length, nose to rump (CMO:0000079) 8 30848154 82460899 Rat 1358896 Bp262 Blood pressure QTL 262 2.89 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 27205715 99103503 Rat 731182 Uae24 Urinary albumin excretion QTL 24 6.4 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 19331152 93965294 Rat 724514 Uae15 Urinary albumin excretion QTL 15 2.9 urine albumin amount (VT:0002871) urine albumin excretion rate (CMO:0000757) 8 29502665 70386295 Rat 61353 Bp35 Blood pressure QTL 35 0.001 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 8 30848154 61290444 Rat 631842 Inf1 Infertility severity QTL 1 4.1 0.001 seminal gland mass (VT:0010524) seminal vesicle wet weight (CMO:0001603) 8 22662330 67662330 Rat 1359033 Bp273 Blood pressure QTL 273 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 30848154 61290444 Rat 1358907 Cm40 Cardiac mass QTL 40 1.89 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 8 27205715 99103503 Rat 1331744 Bp217 Blood pressure QTL 217 3.398 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 8 30848154 58482492 Rat 2316950 Scl66 Serum cholesterol level QTL 66 4.1 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 8 30848259 105647037 Rat 1358892 Kidm26 Kidney mass QTL 26 3.69 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 8 27205715 99103503 Rat 1359021 Bp271 Blood pressure QTL 271 1.8 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 26644912 46711092 Rat 2302367 Slep5 Serum leptin concentration QTL 5 3.43 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 8 9712463 41866876 Rat 61373 Mcs4 Mammary carcinoma susceptibility QTL 4 1.1 mammary gland integrity trait (VT:0010552) mammary tumor number (CMO:0000343) 8 16290444 61290444 Rat 70206 Alc20 Alcohol consumption QTL 20 2 drinking behavior trait (VT:0001422) ethanol intake volume to total fluid intake volume ratio (CMO:0001591) 8 30848154 40713225 Rat 1357398 Slep3 Serum leptin concentration QTL 3 3.43 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 8 9712463 41866876 Rat 2313057 Bss76 Bone structure and strength QTL 76 3 0.0001 tibia size trait (VT:0100001) tibia midshaft cross-sectional area (CMO:0001717) 8 30848154 82460899 Rat 1549908 Neudeg1 Neurodegradation QTL 1 5.5 0 nervous system integrity trait (VT:0010566) logarithm of the ratio of the lesioned side motor neuron count to contralateral side motor neuron count (CMO:0001986) 8 30188867 94457446 Rat 2317030 Wbc5 White blood cell count QTL 5 3.21 0.005 leukocyte quantity (VT:0000217) white blood cell count (CMO:0000027) 8 8736635 53736635 Rat 1331804 Cm30 Cardiac mass QTL 30 3.77443 heart mass (VT:0007028) heart wet weight (CMO:0000069) 8 28242912 53961020 Rat 2313067 Bss77 Bone structure and strength QTL 77 3.1 0.0001 tibia size trait (VT:0100001) tibia midshaft endosteal cross-sectional area (CMO:0001716) 8 30848154 82460899 Rat 2317032 Ginf2 Gastrointestinal inflammation QTL 2 3.21 0.005 liver integrity trait (VT:0010547) liver granuloma severity score (CMO:0002157) 8 4705810 49705810 Rat 2301416 Bp315 Blood pressure QTL 315 0.008 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 8 7670578 52670578 Rat 2317036 Livw3 Liver weight QTL 3 2.43 0.01 liver mass (VT:0003402) liver weight to body weight ratio (CMO:0000633) 8 4705810 49705810 Rat 12880023 Bw184 Body weight QTL 184 0.001 body mass (VT:0001259) body weight (CMO:0000012) 8 2097640 47097640 Rat 12880028 Cm103 Cardiac mass QTL 103 0.02 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 8 2097640 47097640 Rat 2317051 Aia18 Adjuvant induced arthritis QTL 18 2.42 joint integrity trait (VT:0010548) left rear ankle joint diameter (CMO:0002149) 8 8736635 53736635 Rat 2317048 Ginf1 Gastrointestinal inflammation QTL 1 3.52 0.005 cecum mucosa thickness (VT:0010234) enterocolitis severity score (CMO:0002138) 8 4705810 49705810 Rat 12880025 Cm102 Cardiac mass QTL 102 0.044 heart mass (VT:0007028) heart wet weight to body weight ratio (CMO:0002408) 8 2097640 47097640 Rat 1558646 Swd5 Spike wave discharge measurement QTL 5 3.45 0.00036 brain electrophysiology trait (VT:0010557) brain spike-and-wave discharge frequency (CMO:0001742) 8 14906751 59906751 Rat 2302278 Gluco36 Glucose level QTL 36 4.2 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 8 29502665 50095447 Rat 12880044 Am9 Aortic mass QTL 9 0.007 aorta mass (VT:0002845) aorta weight to aorta length to body weight ratio (CMO:0002722) 8 2097640 47097640 Rat 631648 Stl5 Serum triglyceride level QTL 5 4 0.0003 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 8 27205715 54998217 Rat 631650 Stl6 Serum triglyceride level QTL 6 4 0.0019 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 8 10378157 112202585 Rat 1581557 Eae16 Experimental allergic encephalomyelitis QTL 16 3.8 nervous system integrity trait (VT:0010566) experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046) 8 8462195 110921472 Rat 631271 Lecl1 Lens clarity QTL 1 0.001 lens clarity trait (VT:0001304) age of onset/diagnosis of cataract (CMO:0001584) 8 18984168 84531599 Rat 2303564 Gluco43 Glucose level QTL 43 3 blood glucose amount (VT:0000188) blood glucose level (CMO:0000046) 8 26130187 71130187 Rat 1598824 Memor4 Memory QTL 4 2.5 exploratory behavior trait (VT:0010471) total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) 8 9712220 53356647 Rat 2313046 Bss78 Bone structure and strength QTL 78 3.5 0.0001 tibia strength trait (VT:1000284) tibia total energy absorbed before break (CMO:0001736) 8 30848154 82460899 Rat 1354595 Despr4 Despair related QTL 4 2.16 0.0036 locomotor behavior trait (VT:0001392) amount of time spent in voluntary immobility (CMO:0001043) 8 7688955 52688955 Rat 2303572 Insul13 Insulin level QTL 13 2 blood insulin amount (VT:0001560) blood insulin level (CMO:0000349) 8 26130187 71130187 Rat
RH131034
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 33,564,003 - 33,564,190 (+) MAPPER mRatBN7.2 Rnor_6.0 8 36,414,312 - 36,414,498 NCBI Rnor6.0 Rnor_5.0 8 36,432,495 - 36,432,681 UniSTS Rnor5.0 RGSC_v3.4 8 34,995,816 - 34,996,002 UniSTS RGSC3.4 Celera 8 34,983,544 - 34,983,730 UniSTS RH 3.4 Map 8 289.1 UniSTS Cytogenetic Map 8 q21 UniSTS
UniSTS:236630
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 8 33,560,453 - 33,561,647 (+) MAPPER mRatBN7.2 Rnor_6.0 8 36,410,762 - 36,411,955 NCBI Rnor6.0 Rnor_5.0 8 36,428,945 - 36,430,138 UniSTS Rnor5.0 RGSC_v3.4 8 34,992,266 - 34,993,459 UniSTS RGSC3.4 Celera 8 34,979,994 - 34,981,187 UniSTS Cytogenetic Map 8 q21 UniSTS
GDB:197863
Rat Assembly Chr Position (strand) Source JBrowse GRCr8 8 41,821,221 - 41,821,508 (+) Marker Load Pipeline mRatBN7.2 8 33,563,387 - 33,563,674 (+) MAPPER mRatBN7.2 Rnor_6.0 8 36,413,696 - 36,413,982 NCBI Rnor6.0 Rnor_5.0 8 36,431,879 - 36,432,165 UniSTS Rnor5.0 RGSC_v3.4 8 34,995,200 - 34,995,486 UniSTS RGSC3.4 Celera 8 34,982,928 - 34,983,214 UniSTS Cytogenetic Map 8 q21 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000015177 ⟹ ENSRNOP00000015177
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 33,560,348 - 33,566,470 (+) Ensembl Rnor_6.0 Ensembl 8 36,410,683 - 36,416,296 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000113037 ⟹ ENSRNOP00000087621
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 8 33,560,395 - 33,566,450 (+) Ensembl
RefSeq Acc Id:
NM_001034150 ⟹ NP_001029322
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 8 41,818,199 - 41,824,292 (+) NCBI mRatBN7.2 8 33,560,365 - 33,566,458 (+) NCBI Rnor_6.0 8 36,410,683 - 36,416,766 (+) NCBI Rnor_5.0 8 36,428,866 - 36,434,949 (+) NCBI RGSC_v3.4 8 34,992,187 - 34,998,270 (+) RGD Celera 8 34,979,915 - 34,986,044 (+) RGD
Sequence:
GGGGGCTGCTGGTGTGACGTGTCCCGCGCTTGGCGCAGCAGGAAGCGGCGGCGGACGCGGCCCGAGTTCCCGGCGCCGGTCTCGGCCCCAAGTCTTCTCCCGCTTCCATCATGCTTGACTTCTTCACC
hide sequence
RefSeq Acc Id:
NP_001029322 ⟸ NM_001034150
- UniProtKB:
Q3KRC3 (UniProtKB/TrEMBL), A6JYJ9 (UniProtKB/TrEMBL)
- Sequence:
MLDFFTIFSKGGLVLWCFQGVSDSCTGPVNALIRSVLLQERGGNNSFTHEALTLKYKLDNQFELVFVVGFQKILTLTYVDKLIDDVHRLFRDKYRTEIQQQSALSLLNGTFDFQNDFLRLLREAEESS
hide sequence
Ensembl Acc Id:
ENSRNOP00000015177 ⟸ ENSRNOT00000015177
Ensembl Acc Id:
ENSRNOP00000087621 ⟸ ENSRNOT00000113037
RGD ID: 13695836 Promoter ID: EPDNEW_R6361 Type: initiation region Name: Srpra_1 Description: SRP receptor alpha subunit SO ACC ID: SO:0000170 Source: EPDNEW (Eukaryotic Promoter Database, http://epd.vital-it.ch/ ) Experiment Methods: Single-end sequencing. Position: Rat Assembly Chr Position (strand) Source Rnor_6.0 8 36,410,708 - 36,410,768 EPDNEW
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2018-05-04
Srpra
SRP receptor subunit alpha
Srpra
SRP receptor alpha subunit
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2015-11-25
Srpra
SRP receptor alpha subunit
Srpr
signal recognition particle receptor ('docking protein')
Nomenclature updated to reflect human and mouse nomenclature
1299863 APPROVED
2005-12-06
Srpr
signal recognition particle receptor ('docking protein')
Srpr_predicted
signal recognition particle receptor ('docking protein') (predicted)
Symbol and Name updated
1559027 APPROVED
2005-01-12
Srpr_predicted
signal recognition particle receptor ('docking protein') (predicted)
Symbol and Name status set to approved
70820 APPROVED
