Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)
Genes search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

15 records found for search term Il2rg
Refine Term:
Assembly:
    Chr  
Sort By:
           Export CSV TAB Print GViewer Analysis Tools

RGD IDSymbolNameDescriptionChrStartStopSpeciesAnnotationsMatchType
621466Il2rginterleukin 2 receptor subunit gammaENCODES a protein that exhibits coreceptor activity (ortholog); interleukin-15 receptor activity (ortholog); interleukin-2 binding (ortholog); INVOLVED IN cell surface receptor signaling pathway via JAK-STAT (ortholog); cellular homeostasis (ortholog); interleukin-15-mediated signaling pathway (orthX7043534070439052Rat156symbol , PhenoGengene, protein-coding, PROVISIONAL [RefSeq]
13628731Il2rgem1Anginterleukin 2 receptor subunit gamma;TALEN induced mutant1, AngASSOCIATED WITH decreased bone marrow cell number; decreased CD4-positive, alpha-beta T cell number; decreased CD8-positive, alpha-beta T cell number; ASSOCIATED WITH Immune Deficiency DiseaseRat10symbol , descriptiongene, allele
12798560Il2rgem1Kyointerleukin 2 receptor subunit gamma; ZFN induced mutant 1, KyoASSOCIATED WITH combined T cell and B cell immunodeficiency; X-linked severe combined immunodeficiencyRat2symbol , description , old_gene_symbolgene, allele
12798561Il2rgem2Kyointerleukin 2 receptor subunit gamma; ZFN induced mutant 2, KyoASSOCIATED WITH combined T cell and B cell immunodeficiency; X-linked severe combined immunodeficiencyRat2symbol , description , old_gene_symbolgene, allele
13464340Il2rgem3Kyointerleukin 2 receptor subunit gamma; ZFN induced mutant 3, KyoThis mutant allele was generated by a zinc finger nuclease induced 332-bp deletion in Il2rg gene of F344/TM embryo.Ratsymbol , description , old_gene_symbolgene, allele
13464339Il2rgem4Kyointerleukin 2 receptor subunit gamma; ZFN induced mutant 4, KyoThe mutant allele has a zinc finger nuclease-induced 162-bp deletion mutation in the Il2rg gene of the the TM/Kyo embryo.Ratsymbol , description , old_gene_symbolgene, allele
12910099Il2rgem5Kyointerleukin 2 receptor subunit gamma; ZFN induced mutant 5, KyoThis ZFN induced mutant allele contains a 653-bp deletion in the Il2rg gene.Ratsymbol , description , old_gene_symbolgene, allele
12910097Il2rgem6Kyointerleukin 2 receptor subunit gamma; ZFN induced mutant 6, KyoThese ZFN mutant rats were produced by injecting zinc finger nuclease targeting rat Il2rg into F344/Stm. A 332-bp deletion mutation was created.Ratsymbol , description , old_gene_symbolgene, allele
13628732Il2rgem7Kyointerleukin 2 receptor subunit gamma; TALEN induced mutant 7, KyoThis mutant allele has a 7 bp deletion in the 2nd exon of the rat Il2rg gene created by TALEN.Ratsymbol , descriptiongene, allele
12798562Il2rgem1Hinainterleukin 2 receptor subunit gamma; endonuclease-induced mutant 1, HinaThis mutation was generated by electroporation method: introduction of Il2rg gene-targeting vector (PKG promoter-HSV TK, loxp Tk2 promoter-Neor loxp) into ES cells of Wistar rat（Crlj:Wistar).Ratsymbol , description , old_gene_symbolgene, allele
12790633Il2rgem1Mcwiinterleukin 2 receptor, gamma; TALEN induced mutant 1, Medical College of WisconsinThis allele was made by TALEN mutagensis. The resulting mutation is a 19-bp deletion in exon 2.Ratsymbol , old_gene_symbolgene, allele
10002792Il2rgem2Mcwiinterleukin 2 receptor, gamma; TALEN induced mutant 2, Medical College of WisconsinThis allele was made by TALEN mutagensis. The resulting mutation is a 1-bp frameshift deletion in exon 2 causing a predicted non-functional protein.Ratsymbol , old_gene_symbolgene, allele
12790660Il2rgem3Mcwiinterleukin 2 receptor, gamma; TALEN induced mutant 3, Medical College of WisconsinThis allele was made by TALEN mutagensis. The resulting mutation is a 2-bp deletion in exon 2.Ratsymbol , old_gene_symbolgene, allele
13464264Il2rgem1Iexasinterleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, IexasThis mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used fRatsymbol , description , old_gene_symbolgene, allele
629096379Rag1em6Mcwirecombination activating 1; CRISPR/Cas9 induced mutant 1, McwiThe allele was produced by injection of CRISPR/Cas9 targeting the genomic sequence GGTGAGATCCTTTGAAAAGG in Rag1 into double homozygous embryos with knockout of Fah and Il2rg produced following multiple generations of intercrossing strains SD-Il2rgRatdescriptiongene, allele