| 69192 | Cyp27b1 | cytochrome P450, family 27, subfamily b, polypeptide 1 | ENCODES a protein that exhibits calcidiol 1-monooxygenase activity; secalciferol 1-monooxygenase activity (ortholog); INVOLVED IN lactation; negative regulation of bone trabecula formation; negative regulation of ossification; PARTICIPATES IN steroid biosynthetic pathway; tuberculosis pathway; ASSOC IATED WITH abnormal cartilage morphology; abnormal femur morphology; abnormal survival; ASSOCIATED WITH Acidoses; acute kidney failure; Experimental Diabetes Mellitus; FOUND IN cytoplasm (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3'-amino-3'-deoxy-N(6),N(6)-dimethyladenosine; 3,3',4,4',5-pentachlorobiphenyl | 7 | 64756626 | 64761570 | Rat | 274 | symbol , PhenoGen | gene, protein-coding, PROVISIONAL [RefSeq] | | 408364974 | Cyp27b1em1Hfd | cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 1,Hfd | The CRISPR/Cas9 system was used to introduce a 82-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAGAGTCTTCCATCGAGTCCAACTGCCTTCTcagctgggcagtgactcggttctccggagtttatctgatatccctgggccctctacacctagcttcctggctgaactcttctGCAAAGGGGG KO: CTCGCCTC CAGAGTCTTCCATCGAGTCCAACTGCCTTCT--- GCAAAGGGGG | | | | Rat | | symbol , description | gene, allele | | 408364975 | Cyp27b1em2Hfd | cytochrome P450, family 27, subfamily b, polypeptide 1,CRISPR/Cas9 induced mutant 2,Hfd | The CRISPR/Cas9 system was used to introduce a 29-bp deletion in exon 1 of the Cyp27b1 gene of Hsd:SD rat embryos WT: CTCGCCTCCAgagtcttccatcgagtccaactgccttctCAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG KO: CTCGCCTC CA----- CAGCTGGGCAGTGACTCGGTTCTCCGGAGTTTATCTGATATCCCTGGGCCCTCTACACCTAGCTTCCTGGCTGAACTCTTCTGCAAAGGGGG | | | | Rat | | symbol , description | gene, allele | | 124713545 | Cyp27b1em1Thka | cytochrome P450, family 27, subfamily b, polypeptide 1; CRISPR/Cas9 induced mutant 1, Thka | ASSOCIATED WITH abnormal cartilage morphology; abnormal femur morphology; abnormal survival; ASSOCIATED WITH vitamin D-dependent rickets type 1A | | | | Rat | 10 | symbol , description | gene, allele | |