Marker: D20Got43 |
Symbol: |
D20Got43 |
Previously known as: |
OT92.10; oxsts1646;
|
RGD ID: |
60276 |
Expected Size: |
258 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | 20 | 47,187,200 - 47,187,584 (+) | MAPPER | mRatBN7.2 | mRatBN7.2 | 20 | 47,187,326 - 47,187,584 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 20 | 48,451,911 - 48,452,168 | NCBI | Rnor6.0 | Rnor_6.0 | 20 | 48,451,648 - 48,452,168 | NCBI | Rnor6.0 | Rnor_5.0 | 20 | 50,104,236 - 50,104,493 | UniSTS | Rnor5.0 | Rnor_5.0 | 20 | 50,103,973 - 50,104,493 | UniSTS | Rnor5.0 | RGSC_v3.4 | 20 | 47,617,182 - 47,617,440 | RGD | RGSC3.4 | RGSC_v3.4 | 20 | 47,617,183 - 47,617,440 | UniSTS | RGSC3.4 | RGSC_v3.1 | 20 | 47,645,879 - 47,646,137 | RGD | | Celera | 20 | 52,800,895 - 52,801,152 | UniSTS | |
|
Annotation
Strains and Sequence
Sequence
|
Forward Primer |
GAGACAAGTGGGTCCCTGC |
Reverse Primer |
TTAGGTTGGTTGGTATGTGCTG |
|
Region
QTLs in Region (mRatBN7.2)
1598816 | Memor12 | Memory QTL 12 | 2.4 | | exploratory behavior trait (VT:0010471) | average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674) | 20 | 2606836 | 47606836 | Rat | 7411652 | Foco24 | Food consumption QTL 24 | | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 20 | 11757515 | 54435887 | Rat | 9590092 | Insglur9 | Insulin/glucose ratio QTL 9 | 18.38 | 0.001 | blood insulin amount (VT:0001560) | calculated plasma insulin level (CMO:0002170) | 20 | 11757515 | 54435887 | Rat | 4889610 | Pancm3 | Pancreatic morphology QTL 3 | 3.75 | 0.001 | pancreas mass (VT:0010144) | pancreas wet weight (CMO:0000626) | 20 | 17617832 | 47606836 | Rat | 2317880 | Alcrsp25 | Alcohol response QTL 25 | 2.3 | | response to alcohol trait (VT:0010489) | duration of loss of righting reflex (CMO:0002289) | 20 | 17697550 | 54435887 | Rat | 2303626 | Vencon10 | Ventilatory control QTL 10 | | 0.001 | respiration trait (VT:0001943) | respiration rate (CMO:0000289) | 20 | 19190721 | 54435887 | Rat | 2303578 | Gluco50 | Glucose level QTL 50 | 2 | | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 20 | 25106722 | 54435887 | Rat | 2303587 | Bw93 | Body weight QTL 93 | 13 | | body mass (VT:0001259) | body weight (CMO:0000012) | 20 | 25106722 | 54435887 | Rat | 2300188 | Bmd68 | Bone mineral density QTL 68 | 6.4 | 0.0001 | femur mineral mass (VT:0010011) | volumetric bone mineral density (CMO:0001553) | 20 | 25106722 | 54435887 | Rat | 1331747 | Hrtrt16 | Heart rate QTL 16 | 3.163 | | heart pumping trait (VT:2000009) | heart rate (CMO:0000002) | 20 | 25209734 | 54435887 | Rat | 1598869 | Memor6 | Memory QTL 6 | 3.1 | | exploratory behavior trait (VT:0010471) | total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) | 20 | 29244388 | 54435887 | Rat | |
Additional Information
External Database Links
Database |
Acc Id |
Source(s) |
UniSTS |
113281 |
UniSTS |
|
|