RH141714 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH141714

Symbol: RH141714
Previously known as: AI045515; 
RGD ID: 5080670
Expected Size: 183 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2743,593,593 - 43,593,776 (-)MAPPERmRatBN7.2
Rnor_6.0751,404,884 - 51,405,066NCBIRnor6.0
Rnor_5.0751,417,462 - 51,417,644UniSTSRnor5.0
RGSC_v3.4746,987,985 - 46,988,167UniSTSRGSC3.4
Celera740,459,970 - 40,460,152UniSTS
RH 3.4 Map7377.7UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTATGGAATGGAGTCTCACGC
Reverse Primer TGTAAATGCGAACCTAACTGCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620013Ppp1r12aprotein phosphatase 1, regulatory subunit 12A74348280843593689Rat

Nucleotide Sequences
GenBank Nucleotide CH473960 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)7986646760460686Rat
738033Anxrr6Anxiety related response QTL 64.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)71557388960573889Rat
2317059Aia15Adjuvant induced arthritis QTL 152.46joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)71700459862004598Rat
10755451Coatc11Coat color QTL 110coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)71794435762944357Rat
1354637Scl30Serum cholesterol level QTL 303.7blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)71965431749753746Rat
1354644Spl4Serum phospholipid level QTL 44.9blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)71965431749753746Rat
1354639Spl5Serum phospholipid level QTL 53.9blood LDL phospholipid amount (VT:0010505)blood low density lipoprotein phospholipid level (CMO:0001568)71965431752888450Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
7411569Bw137Body weight QTL 1370.001body mass (VT:0001259)body weight gain (CMO:0000420)72192119566921195Rat
1641885Alcrsp9Alcohol response QTL 9alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)72409960669099606Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)72475184169751841Rat
70190Mcs6Mammary carcinoma susceptibility QTL 62.29mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)72673740163902784Rat
1300138Hrtrt9Heart rate QTL 94.72heart pumping trait (VT:2000009)heart rate (CMO:0000002)72940968353612950Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)72940968374409683Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
10755453Coatc12Coat color QTL 120coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)73111283276112832Rat
7411605Foco14Food consumption QTL 1424.10.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)73429328279293282Rat
631534Lnnr1Liver neoplastic nodule remodeling QTL 13.850.001liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)73429328279293282Rat
631513Scl7Serum cholesterol level QTL 74.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)73796056982960569Rat
2303629Vencon3Ventilatory control QTL 37.25respiration trait (VT:0001943)respiration rate (CMO:0000289)74110969256793354Rat
61357Bp38Blood pressure QTL 381.60.052arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)741333674119109060Rat
634326Hc3Hypercalciuria QTL 32.1urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)74278731487787314Rat
10053722Scort27Serum corticosterone level QTL 272.410.0083blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)74322875088228750Rat


Additional Information

Database Acc Id Source(s)
UniSTS 223707 UniSTS