RH139795 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH139795

Symbol: RH139795
Previously known as:
RGD ID: 5077506
Expected Size: 181 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21834,333,872 - 34,334,053 (+)MAPPERmRatBN7.2
Rnor_6.01836,656,903 - 36,657,083NCBIRnor6.0
Rnor_5.01836,321,643 - 36,321,823UniSTSRnor5.0
RGSC_v3.41835,534,071 - 35,534,251UniSTSRGSC3.4
Celera1833,930,782 - 33,930,962UniSTS
Cytogenetic Map18p11UniSTS
Is Marker For: Genes:   Rbm27  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACAATGCAGAAGAGACCGTCAG
Reverse Primer CAGTTGGGCAATCAAGAATCAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1311966Rbm27RNA binding motif protein 27183427352734336124Rat

Nucleotide Sequences
RefSeq Transcripts XM_003751777.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003753038.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)182206624252293055Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
12904673Cm127Cardiac mass QTL 1270.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)182654808246969551Rat
12904675Am19Aortic mass QTL 190.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)182654808246969551Rat
12904677Kidm72Kidney mass QTL 720.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)182654808246969551Rat
12904668Bw188Body weight QTL 1880.03body mass (VT:0001259)body weight (CMO:0000012)182654808246969551Rat
12904669Cm125Cardiac mass QTL 1250.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)182654808246969551Rat
12904670Cm126Cardiac mass QTL 1260.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)182654808246969551Rat
2301413Bp318Blood pressure QTL 3180.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182654808246969551Rat
2293704Bss35Bone structure and strength QTL 354.590.0002femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)182896485373964853Rat
2300157Bmd66Bone mineral density QTL 6613.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
2300177Bmd65Bone mineral density QTL 6519.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
9589816Gluco68Glucose level QTL 687.250.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)182979296574792965Rat
8694378Bw157Body weight QTL 1573.590.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)182979296574792965Rat
9590318Scort22Serum corticosterone level QTL 227.640.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)182979296574792965Rat
1331754Bp230Blood pressure QTL 2304.61609arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182979296574792965Rat
738005Anxrr11Anxiety related response QTL 113.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)183003981375039813Rat
61383Bp47Blood pressure QTL 4717.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)183127168160377755Rat
1331742Bp228Blood pressure QTL 2283.88752arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940859796643Rat
1331774Bp226Blood pressure QTL 2264.41065arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940859796643Rat
1331776Bp225Blood pressure QTL 2252.829arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)183135940859796643Rat
1331798Bp224Blood pressure QTL 2243.53873arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940859796643Rat
1331727Bp237Blood pressure QTL 2373.053arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135940861698465Rat
61429Cia17Collagen induced arthritis QTL 174.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)183135940870263868Rat
2303120Mamtr8Mammary tumor resistance QTL 80.001mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)183135940883218561Rat
6903347Bp350Blood pressure QTL 3504.4arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)183135953059796478Rat
631274Sprol1Serum protein level QTL 15.3blood total protein amount (VT:0005567)serum total protein level (CMO:0000661)183139332077209694Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 361317 UniSTS
UniSTS 221879 UniSTS