RH137292 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH137292

Symbol: RH137292
Previously known as: AA957193; 
RGD ID: 5073190
Expected Size: 183 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21610,005,025 - 10,005,208 (+)MAPPERmRatBN7.2
Rnor_6.01611,028,425 - 11,028,607NCBIRnor6.0
Rnor_5.0169,353,404 - 9,353,586UniSTSRnor5.0
RGSC_v3.41610,336,196 - 10,336,378UniSTSRGSC3.4
Celera165,212,158 - 5,212,340UniSTS
RH 3.4 Map1698.0UniSTS
Cytogenetic Map16p15UniSTS
Is Marker For: Genes:   Wapl  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATGTGTACATATCCCGCAGCTC
Reverse Primer TCGTCATTATTGACTGTGCTTACG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474046 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000246 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1600369Hcas8Hepatocarcinoma susceptibility QTL 8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)16122477621Rat
631830Alc7Alcohol consumption QTL 72.9consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16126727669Rat
634355Rends4Renal damage susceptibility QTL 40.05kidney blood vessel morphology trait (VT:0000530)organ lesion measurement (CMO:0000677)16126727669Rat
1582235Insul8Insulin level QTL 83.30.0063blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)16126727669Rat
9590151Scort8Serum corticosterone level QTL 88.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)16130836262Rat
2302380Slep6Serum leptin concentration QTL 63.36blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)16132139025Rat
2307172Activ4Activity QTL 43.710.00023locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)16133418960Rat
1354584Despr6Despair related QTL 63.10.0067locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16139533930Rat
2303566Bw90Body weight QTL 902body mass (VT:0001259)body weight (CMO:0000012)16139533930Rat
631561Hcuc2Hepatic copper content QTL 22.8liver copper amount (VT:0003065)liver total copper weight (CMO:0001507)16139533949Rat
6903319Bw114Body weight QTL 1142.70.0037body mass (VT:0001259)body weight (CMO:0000012)16143534949Rat
7411664Foco30Food consumption QTL 30110.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)16144588133Rat
1354625Despr7Despair related QTL 73.160.016locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)16144977551Rat
1600378Arunc4Aerobic running capacity QTL 40.03exercise endurance trait (VT:0002332)maximum distance run on treadmill (CMO:0001406)1638024580345693Rat
2293343Glom16Glomerulus QTL 167.4kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1683223646053497Rat
2312660Bw95Body weight QTL 950.05inguinal fat pad mass (VT:0010424)inguinal fat pad weight to body weight ratio (CMO:0001253)1683223659492508Rat
2312663Slep9Serum leptin concentration QTL 90.001blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1683223659492508Rat
2312666Insul16Insulin level QTL 160.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1683223659492508Rat
2312669Stl23Serum triglyceride level QTL 230.01blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)1683223659492508Rat
2301406Kidm39Kidney mass QTL 390.002kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)16285170915884239Rat
1300133Rf24Renal function QTL 243.64blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)16338015021361552Rat
2306902Bp339Blood pressure QTL 3390.01arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16338015043025077Rat
737825Alc13Alcohol consumption QTL 134.5consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760916039848Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760943025077Rat
70183BpQTLcluster13Blood pressure QTL cluster 133.654arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)16422760943025077Rat
737819Hcas4Hepatocarcinoma susceptibility QTL 44.43liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)16422760946975965Rat
61405Niddm6Non-insulin dependent diabetes mellitus QTL 63.660.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)16422760948972724Rat
61338Bp23Blood pressure QTL 234.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)16422760949227609Rat
737826Alc11Alcohol consumption QTL 113.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)16422760960252231Rat
61372Bp40Blood pressure QTL 402.2blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)16422773017696785Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 290577 UniSTS
UniSTS 219380 UniSTS