AU047772 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU047772

Symbol: AU047772
Previously known as:
RGD ID: 5067402
Expected Size: 233 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2998,396,582 - 98,396,815 (+)MAPPERmRatBN7.2
Rnor_6.09111,301,637 - 111,301,869NCBIRnor6.0
Rnor_5.09110,855,019 - 110,855,251UniSTSRnor5.0
RGSC_v3.4997,191,327 - 97,191,559UniSTSRGSC3.4
Celera995,838,084 - 95,838,257UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATCGGTGAGAATAAGAGCCTGA
Reverse Primer CTCCAGGACTGGGAGAGAAT
 

Region

Nucleotide Sequences
GenBank Nucleotide AU047772 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)925661188100929786Rat
1578760Cm53Cardiac mass QTL 533.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)956771635101771635Rat
724515Uae16Urinary albumin excretion QTL 168urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)958163035100929646Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)961381434104821652Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)963869687108869687Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)964573531109573531Rat
1354626Bvd1Brain ventricular dilatation QTL 13.730.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)975712843111552878Rat
4889852Pur26Proteinuria QTL 26150.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)977813894101597663Rat
7794784Mcs31Mammary carcinoma susceptibility QTL 312.98mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)977813894111552878Rat
724547Cm21Cardiac mass QTL 212.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)979271511102910209Rat
1582203Gluco19Glucose level QTL 193.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)992491589100929786Rat


Additional Information

Database Acc Id Source(s)
UniSTS 110185 UniSTS