AI535509 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: AI535509

Symbol: AI535509
Previously known as:
RGD ID: 5065374
Expected Size: 92 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X27,245,782 - 27,245,874 (+)MAPPERmRatBN7.2
Rnor_6.0X28,687,966 - 28,688,057NCBIRnor6.0
Rnor_5.0X29,077,195 - 29,077,286UniSTSRnor5.0
CeleraX27,656,083 - 27,656,174UniSTS
RH 3.4 MapX349.2UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAGAGCACCCATAATGGCATC
Reverse Primer AGGGTTAAGACATCATCATATCCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
7702167LOC102549869uncharacterized LOC102549869X2724569627256791Rat

Nucleotide Sequences
GenBank Nucleotide CH474014 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731181Uae27Urinary albumin excretion QTL 272.70.0059urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)X143491017Rat
70165Bp64Blood pressure QTL 645.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X144812931706553Rat
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X292789847927898Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7440600049406000Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X449454949494549Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
71116Niddm16Non-insulin dependent diabetes mellitus QTL 167.81blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X1529780260297802Rat
1598873Memor2Memory QTL 22.5exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)X2099094741052531Rat
2290375Gluco34Glucose level QTL 342.75blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X2099094741203591Rat


Additional Information

Database Acc Id Source(s)
UniSTS 248127 UniSTS