Marker: DXGot35 |
Symbol: |
DXGot35 |
Previously known as: |
OT30.23; oxsts2804;
|
RGD ID: |
45746 |
Expected Size: |
193 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | X | 43,077,956 - 43,078,149 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | X | 46,377,087 - 46,377,279 | NCBI | Rnor6.0 | Rnor_5.0 | X | 46,590,590 - 46,590,782 | UniSTS | Rnor5.0 | RGSC_v3.4 | X | 64,832,117 - 64,832,310 | RGD | RGSC3.4 | RGSC_v3.4 | X | 64,832,118 - 64,832,310 | UniSTS | RGSC3.4 | RGSC_v3.1 | X | 64,885,587 - 64,885,779 | RGD | | Celera | X | 43,724,136 - 43,724,328 | UniSTS | | RH 3.4 Map | X | 588.1 | UniSTS | | RH 3.4 Map | X | 588.1 | RGD | | RH 2.0 Map | 21 | 482.8 | RGD | |
|
Annotation
References - curated
# |
Reference Title |
Reference Citation |
1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
3. |
UniSTS Pipeline |
RGD automated pipelines
|
4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
|
Forward Primer |
TGGGAGATACTGCTTCATTGA |
Reverse Primer |
TCAGAGAACTTTTGAGTTAACTCGG |
|
Region
QTLs in Region (mRatBN7.2)
731181 | Uae27 | Urinary albumin excretion QTL 27 | 2.7 | 0.0059 | urine albumin amount (VT:0002871) | urine albumin excretion rate (CMO:0000757) | X | 1 | 43491017 | Rat | 1298071 | Edpm12 | Estrogen-dependent pituitary mass QTL 12 | 3.2 | | pituitary gland mass (VT:0010496) | pituitary gland wet weight (CMO:0000853) | X | 2927898 | 47927898 | Rat | 10755455 | Coatc13 | Coat color QTL 13 | | 0 | coat/hair pigmentation trait (VT:0010463) | pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812) | 7 | 4406000 | 49406000 | Rat | 631666 | Iddm5 | Insulin dependent diabetes mellitus QTL 5 | | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 4494549 | 49494549 | Rat | 61430 | Cia18 | Collagen induced arthritis QTL 18 | 3.1 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | X | 14843113 | 120568734 | Rat | 71116 | Niddm16 | Non-insulin dependent diabetes mellitus QTL 16 | 7.81 | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | X | 15297802 | 60297802 | Rat | 1598837 | Memor13 | Memory QTL 13 | 3.2 | | exploratory behavior trait (VT:0010471) | difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678) | X | 41052407 | 146860749 | Rat | 738035 | Stresp1 | Stress response QTL 1 | 4.96 | 0.000011 | stress-related behavior trait (VT:0010451) | defensive burying - coping | X | 41304447 | 112935181 | Rat | |
Additional Information
External Database Links
Database |
Acc Id |
Source(s) |
UniSTS |
115250 |
UniSTS |
|
|