D9Got141 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D9Got141

Symbol: D9Got141
Previously known as: oxsts2709; OT32.17; 
RGD ID: 44669
Expected Size: 162 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.29107,870,241 - 107,870,403 (+)MAPPERmRatBN7.2
Rnor_6.09116,095,029 - 116,095,190NCBIRnor6.0
Rnor_5.09115,584,538 - 115,584,699UniSTSRnor5.0
RGSC_v3.49107,033,912 - 107,034,074RGDRGSC3.4
RGSC_v3.49107,033,913 - 107,034,074UniSTSRGSC3.4
RGSC_v3.19107,243,392 - 107,243,554RGD
Celera9105,030,225 - 105,030,386UniSTS
RH 2.0 Map91084.7RGD
Cytogenetic Map9q37UniSTS
Is Marker For: Genes:   Arhgap28  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines
3. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
4. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GAGGCAGGAGGACTGTGAAT
Reverse Primer ATCTTCTCACAAGCAGACTGAGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1559882Arhgap28Rho GTPase activating protein 289107832584107998030Rat

Nucleotide Sequences
GenBank Nucleotide AU024924 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)963869687108869687Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)964573531109573531Rat
1354626Bvd1Brain ventricular dilatation QTL 13.730.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)975712843111552878Rat
7794784Mcs31Mammary carcinoma susceptibility QTL 312.98mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)977813894111552878Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 301709 UniSTS
UniSTS 115768 UniSTS