D15Got211 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D15Got211

Symbol: D15Got211
Previously known as: oxsts3318; OT20.14; 
RGD ID: 1635632
Expected Size: 77 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21569,545,428 - 69,545,505 (+)MAPPERmRatBN7.2
Rnor_6.01576,991,703 - 76,991,779NCBIRnor6.0
Rnor_5.01580,546,433 - 80,546,509UniSTSRnor5.0
RGSC_v3.41576,034,917 - 76,034,993UniSTSRGSC3.4
Celera1568,932,391 - 68,932,467UniSTS
Cytogenetic Map15q21UniSTS
Is Marker For: Genes:   Pcdh9  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACATGTATGTTCATTTTAAGTCAA
Reverse Primer TAAGCTGTGTGCGTGTGCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306348Pcdh9protocadherin 9156934010870237531Rat

Nucleotide Sequences
GenBank Nucleotide AU027323 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
1582214Stl21Serum triglyceride level QTL 213.10.022blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)152803066582262678Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)152803066582262678Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
1582242Gluco28Glucose level QTL 283.30.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)152803066582262678Rat
1582244Bw79Body weight QTL 7940.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
2293691Bmd37Bone mineral density QTL 376.60.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)153361105871477291Rat
2293686Bmd36Bone mineral density QTL 367.40.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)153361105871477291Rat
1598828Glom14Glomerulus QTL 142.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)153405413979054139Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
724545Niddm54Non-insulin dependent diabetes mellitus QTL 540.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)155079449473699215Rat
2317050Aia24Adjuvant induced arthritis QTL 242.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)155284790873690657Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
61477Aia4Adjuvant induced arthritis QTL 43joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)155559608991365858Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)155559608995018120Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat
2313080Bss65Bone structure and strength QTL 653.90.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)156099046873690657Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1567588667101769107Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1568327165100062518Rat
724548Niddm55Non-insulin dependent diabetes mellitus QTL 550.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)156832736073699069Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 306091 UniSTS
UniSTS 113419 UniSTS